<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Pharmacol.</journal-id>
<journal-title>Frontiers in Pharmacology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Pharmacol.</abbrev-journal-title>
<issn pub-type="epub">1663-9812</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1095307</article-id>
<article-id pub-id-type="doi">10.3389/fphar.2023.1095307</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Pharmacology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Sal003 alleviated intervertebral disc degeneration by inhibiting apoptosis and extracellular matrix degradation through suppressing endoplasmic reticulum stress pathway in rats</article-title>
<alt-title alt-title-type="left-running-head">Chen et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fphar.2023.1095307">10.3389/fphar.2023.1095307</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Yan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="fn" rid="fn1">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Baixing</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="fn" rid="fn1">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Xu</surname>
<given-names>Yue</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="fn" rid="fn1">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zhou</surname>
<given-names>Tangjun</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1346575/overview"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Zhao</surname>
<given-names>Changqing</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2092097/overview"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhao</surname>
<given-names>Jie</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1169899/overview"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Orthopaedic Surgery</institution>, <institution>Shanghai Ninth People&#x2019;s Hospital</institution>, <institution>Shanghai Jiao Tong University School of Medicine</institution>, <addr-line>Shanghai</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Shanghai Key Laboratory of Orthopaedic Implants</institution>, <institution>Shanghai Ninth People&#x2019;s Hospital</institution>, <institution>Shanghai Jiao Tong University School of Medicine</institution>, <addr-line>Shanghai</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Changshu Hospital Affiliated to Nanjing University of Chinese Medicine</institution>, <addr-line>Suzhou</addr-line>, <addr-line>Jiangsu</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/682405/overview">Galina Sud&#x2019;ina</ext-link>, Lomonosov Moscow State University, Russia</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1024349/overview">Lin Zheng</ext-link>, Zhejiang University, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1864746/overview">Zhenghua Hong</ext-link>, Zhejiang Taizhou Hospital, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1677445/overview">Gaocai Li</ext-link>, Huazhong University of Science and Technology, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/996339/overview">Yukun Zhang</ext-link>, Huazhong University of Science and Technology, China</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Tangjun Zhou, <email>zhoutangjun@outlook.com</email>; Changqing Zhao, <email>zhaocq9hospital@163.com</email>
</corresp>
<fn fn-type="equal" id="fn1">
<label>
<sup>&#x2020;</sup>
</label>
<p>These authors have contributed equally to this work</p>
</fn>
<fn fn-type="other">
<p>This article was submitted to Inflammation Pharmacology, a section of the journal Frontiers in Pharmacology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>20</day>
<month>01</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>14</volume>
<elocation-id>1095307</elocation-id>
<history>
<date date-type="received">
<day>11</day>
<month>11</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>11</day>
<month>01</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Chen, Li, Xu, Zhou, Zhao and Zhao.</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Chen, Li, Xu, Zhou, Zhao and Zhao</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Apoptosis and extracellular matrix degradation of the nucleus pulposus are the main initiators of intervertebral disc degeneration (IVDD) and can be explained by endoplasmic reticulum (ER) stress. Thus, pharmacological therapy aimed at suppressing this pathway may be a promising approach for the management of intervertebral disc degeneration. In this study, we aimed to explore the protective effects of Sal003 against intervertebral disc degeneration and its underlying mechanisms. Thapsigargin (Tg)-stimulated rat nucleus pulposus cells and a needle puncture-induced intervertebral disc degeneration rat model were used to explore the protective effects of Sal003. Our results showed that Sal003 inhibited apoptosis and extracellular matrix degradation by suppressing the endoplasmic reticulum stress pathway. The therapeutic effects of Sal003 were also observed in the intervertebral disc degeneration rat model, as evidenced by improved degeneration along with decreased apoptosis and extracellular matrix degradation in intervertebral discs. Our results demonstrated Sal003 as a potential treatment for intervertebral disc degeneration.</p>
</abstract>
<kwd-group>
<kwd>ER stress pathway</kwd>
<kwd>Sal003</kwd>
<kwd>intervertebral disc degeneration</kwd>
<kwd>apoptosis</kwd>
<kwd>extracellular matrix degradation</kwd>
</kwd-group>
</article-meta>
</front>
<body>
<sec id="s1">
<title>1 Introduction</title>
<p>Low back pain (LBP) is one of the top ten causes of injury affecting disability-adjusted life-years (DALYs) (<xref ref-type="bibr" rid="B3">Diseases and Injuries 2020</xref>). It is also a common chief complaint among outpatients (<xref ref-type="bibr" rid="B39">Traeger et al., 2021</xref>). Furthermore, intervertebral disc degeneration (IVDD) is regarded as an important risk factor for LBP and is characterized by the death of nucleus pulposus (NP) cells and degradation of the extracellular matrix (ECM) (<xref ref-type="bibr" rid="B14">Kleimeyer et al., 1976</xref>; <xref ref-type="bibr" rid="B22">Livshits et al., 2011</xref>; <xref ref-type="bibr" rid="B27">Mohd Isa et al., 2022</xref>; <xref ref-type="bibr" rid="B45">Zhang et al., 2022a</xref>). However, the mechanisms underlying IVDD remain unclear and need to be further explored (<xref ref-type="bibr" rid="B16">Li et al., 2022a</xref>; <xref ref-type="bibr" rid="B17">Li et al., 2022b</xref>). Therefore, it is necessary to pay attention to the mechanism and treatment of IVDD (<xref ref-type="bibr" rid="B36">Song et al., 2021</xref>; <xref ref-type="bibr" rid="B44">Yin et al., 2021</xref>).</p>
<p>Endoplasmic reticulum (ER) stress is generally considered as a series of molecular and biochemical changes inside cells due to ER dyshomeostasis when cells are subjected to various stimuli (<xref ref-type="bibr" rid="B23">Luo et al., 2022</xref>). It mainly includes dysfunction of protein folding, impairment of protein transportation, and depletion of Ca<sup>2&#x2b;</sup> in the ER lumen (<xref ref-type="bibr" rid="B6">Groenendyk and Michalak 2005</xref>; <xref ref-type="bibr" rid="B12">Kadowaki et al., 2004</xref>; <xref ref-type="bibr" rid="B49">Zhao et al., 2010</xref>). ER stress is closely related to aging, apoptosis, and ECM degradation in the pathology of numerous diseases including osteoarthritis, Alzheimer&#x2019;s disease, amyotrophic lateral sclerosis, and rheumatoid arthritis (<xref ref-type="bibr" rid="B8">Hosseinzadeh et al., 2016</xref>; <xref ref-type="bibr" rid="B29">Paschen and Mengesdorf 2005</xref>; <xref ref-type="bibr" rid="B31">Rahmati et al., 2018</xref>; <xref ref-type="bibr" rid="B32">Rellmann et al., 2021</xref>; <xref ref-type="bibr" rid="B33">Salminen et al., 2009</xref>). Our results and those of other groups have demonstrated that ER stress is a detrimental process when NP cells are subjected to stimuli, and repression of ER stress could mitigate IVDD (<xref ref-type="bibr" rid="B21">Lin et al., 2021</xref>; <xref ref-type="bibr" rid="B24">Luo et al., 2019</xref>; <xref ref-type="bibr" rid="B40">Wang et al., 2021</xref>). Thapsigargin (Tg), a classical inducer of ER stress <italic>in vitro</italic>, can increase cytoplasmic Ca<sup>2&#x2b;</sup> levels by suppressing cells from pumping Ca<sup>2&#x2b;</sup> back into the ER (<xref ref-type="bibr" rid="B34">Sikkeland et al., 2019</xref>; <xref ref-type="bibr" rid="B46">Zhang et al., 2014</xref>). In addition, Tg has been widely acknowledged as a commonly used activator of ER stress and ER stress-related changes in NP cells in <italic>ex vivo</italic> studies on IVDD (<xref ref-type="bibr" rid="B15">Krupkova et al., 2018</xref>; <xref ref-type="bibr" rid="B28">Novais et al., 2021</xref>; <xref ref-type="bibr" rid="B42">Yang et al., 2022</xref>; <xref ref-type="bibr" rid="B48">Zhang et al., 2022b</xref>).</p>
<p>Sal003 is a recently discovered small molecule that functions as a DNA damage-inducible protein (GADD34) inhibitor. It has also been demonstrated that Sal003 could modulate ER stress and alleviate ROS production in various tissues such as the cornea, kidney, and muscle but not in NP cells (<xref ref-type="bibr" rid="B5">Fujita et al., 2021</xref>; <xref ref-type="bibr" rid="B11">Ju et al., 2017</xref>; <xref ref-type="bibr" rid="B35">Soiberman et al., 2019</xref>). Here, we tested the hypothesis that Sal003 mitigates IVDD by modulating ER stress.</p>
<p>Based on these results, we explored whether Sal003 could exert protective effects on the Tg-induced abnormal phenotypes of NP cells. We also determined whether it could modulate ER stress. Furthermore, the potential therapeutic effects of Sal003 on IVDD were explored <italic>in vivo</italic>.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>2 Materials and methods</title>
<sec id="s2-1">
<title>2.1 Reagents</title>
<p>Sal003 was obtained from Selleck Chemicals (S7437, Houston, TX, United States). DMSO was used to dissolve Sal003. It was then stored at &#x2212;20&#xb0;C with a stock solution of 40&#xa0;mM.</p>
</sec>
<sec id="s2-2">
<title>2.2 NP primary cells isolation and culture</title>
<p>Cervical dislocation was performed in six-week-old male Sprague-Dawley (SD) rats. The rats were then rinsed with 75% ethanol for 30&#xa0;min. We obtained NP tissues from their intervertebral discs (Co1&#x2013;Co6) and soaked them in 1% collagenase II for 2&#xa0;h. The cells were cultured in Dulbecco&#x2019;s Modified Eagle&#x2019;s medium (DMEM) supplemented with 10% fetal bovin serum and 1% penicillin-streptomycin under routine conditions (37&#xb0;C with 5% CO<sup>2</sup>), followed by centrifugation (37&#xb0;C, 300 &#xd7; <italic>g</italic> for 5&#xa0;min) and suspension.</p>
</sec>
<sec id="s2-3">
<title>2.3 Cell counting Kit-8 assay</title>
<p>The Cell Counting Kit-8 Assay (CCK-8 kit, E606335, Sangon Biotech Co. Ltd., Shanghai, China) was used to measure cell toxicity and proliferation. To determine cell toxicity, cells were cultured in 96-well plates by 1&#x2a;10&#x2074; before they were administered with different doses of Sal003 (0, 1.25, 2.5, 5, 10, 20, and 40&#xa0;&#x3bc;M) for 24&#xa0;h. To ascertain proliferation, the culture of cells was performed in 96-well plates at 2.5 &#xd7; 10&#xb3; with previous concentrations and were administered Sal003 for 24, 48, and 72&#xa0;h. Fresh complete media containing 10&#xa0;&#x3bc;L of CCK-8 reagent was added into plates according to specific time periods, and the cells were incubated at 37&#xb0;C for 2&#xa0;h. Absorbance at 450&#xa0;nm (optical density values, OD) was assessed using an Infinite M200 Pro reader (Tecan Life Sciences, M&#xe4;nnedorf, Switzerland).</p>
</sec>
<sec id="s2-4">
<title>2.4 RNA extraction and real-time quantitative PCR analysis</title>
<p>NP primary cells were pre-administered Sal003 (5&#xa0;&#x3bc;M) for 2&#xa0;h following which Tg (1&#xa0;&#x3bc;M) was used to stimulate cells for 24&#xa0;h. Afterwards, extraction was performed using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, United States) according to the manufacturer&#x2019;s instructions. Complementary DNA (cDNA) was obtained from RNAs using a cDNA Synthesis Kit. Real-time quantitive PCR (RT-qPCR) was performed using the TB Green Premix Ex Taq Kit (Takara Bio) in a Real-Time PCR System. NCBI BLAST was used to design specific primer pairs. Primer information is provided in <xref ref-type="table" rid="T1">Table 1</xref>. The target gene expression was adjusted and normalized to that of &#x3b2;-actin. Relative gene expression levels were quantified using the comparative 2<sup>&#x2212;&#x394;&#x394;CT</sup> method.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Primers information.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Target gene</th>
<th align="left">Accession number</th>
<th align="left">Primer sequences 5&#x2032;&#x2192;3&#x2032;</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td rowspan="2" align="left">&#x3b2;-actin</td>
<td rowspan="2" align="left">NM_031144.3</td>
<td align="left">F:GTCCACCCGCGAGTACAAC</td>
</tr>
<tr>
<td align="left">R:GGATGCCTCTCTTGCTCTGG</td>
</tr>
<tr>
<td rowspan="2" align="left">MMP3</td>
<td rowspan="2" align="left">NM_133523.3</td>
<td align="left">F:TTTGGCCGTCTCTTCCATCC</td>
</tr>
<tr>
<td align="left">R:GCATCGATCTTCTGGACGGT</td>
</tr>
<tr>
<td rowspan="2" align="left">MMP9</td>
<td rowspan="2" align="left">NM_031055.2</td>
<td align="left">F:TCTGCCTGCACCACTAAAGG</td>
</tr>
<tr>
<td align="left">R:CAGGCTGTACCCTTGGTCTG</td>
</tr>
<tr>
<td rowspan="2" align="left">MMP13</td>
<td rowspan="2" align="left">NM_133530.1</td>
<td align="left">F:TGCTGCATACGAGCATCCAT</td>
</tr>
<tr>
<td align="left">R:TGTCCTCAAAGTGAACCGCA</td>
</tr>
<tr>
<td rowspan="2" align="left">ADAMTS5</td>
<td rowspan="2" align="left">NM_198761.2</td>
<td align="left">F:CGACAAGAGTCTGGAGGTGAG</td>
</tr>
<tr>
<td align="left">R:CGTGAGCCACAGTGAAAGC</td>
</tr>
<tr>
<td rowspan="2" align="left">Aggrecan</td>
<td rowspan="2" align="left">XM_039101035.1</td>
<td align="left">F:TCCAAACCAACCCGACAAT</td>
</tr>
<tr>
<td align="left">R:TCTCATAGCGATCTTTCTTCTGC</td>
</tr>
<tr>
<td rowspan="2" align="left">ATF4</td>
<td rowspan="2" align="left">NM_024403.2</td>
<td align="left">F:GACCGAGATGAGCTTCCTGAACAG</td>
</tr>
<tr>
<td align="left">R:CCGCCTTGTCGCTGGAGAAC</td>
</tr>
<tr>
<td rowspan="2" align="left">ATF6</td>
<td rowspan="2" align="left">NM_001107196.1</td>
<td align="left">F:CCAGAAGCACGGGTTCAGAT</td>
</tr>
<tr>
<td align="left">R:GCAGGGCTCACACTAGGTTT</td>
</tr>
<tr>
<td rowspan="2" align="left">BiP</td>
<td rowspan="2" align="left">NM_023083.2</td>
<td align="left">F:ACACCTGACCGACCGCTGAG</td>
</tr>
<tr>
<td align="left">R:GCCAACCACCGTGCCTACATC</td>
</tr>
<tr>
<td rowspan="2" align="left">CHOP</td>
<td rowspan="2" align="left">NM_001109986.1</td>
<td align="left">F:CTGAAGAGAACGAGCGGCTCAAG</td>
</tr>
<tr>
<td align="left">R:GACAGGAGGTGATGCCAACAGTTC</td>
</tr>
<tr>
<td rowspan="2" align="left">TRAF2</td>
<td rowspan="2" align="left">NM_001107815.2</td>
<td align="left">F:CGAAGACCGTTGGGGCTTT</td>
</tr>
<tr>
<td align="left">R:TCGTGGCAGCTCTCGTATTC</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-5">
<title>2.5 Protein extraction and western blot analysis</title>
<p>To determine changes in the matrix metalloproteinase (MMP) family, apoptosis, and long-term activated signaling at the protein level, primary NP cells were treated as described previously. After washing twice with 1 &#xd7; phosphate-buffered saline (PBS), RIPA mixed with phosphatase and protease inhibitors (Roche, Basel, Switzerland) was used for the extraction of total cellular proteins. The proteins in the supernatant were collected for further quantification after centrifugation at 12,000&#xd7;<italic>g</italic> for 15&#xa0;min using a BCA protein quantification kit (23,227, Thermo Fisher Scientific, Waltham, MA, United States). After dissolving them in SDS-sample loading buffer, the proteins (approximately 25&#xa0;&#x3bc;g) were separated on 4%&#x2013;20% SDS-PAGE gels and electroblotted onto 0.22-&#x3bc;m PVDF membranes (Merck-Millipore, CA, United States). Membranes were blocked with 5% skim milk at room temperature (RT) for 2&#xa0;h and then incubated with primary antibodies (diluted 1:1,000 in 5% BSA&#x2013;TBST) overnight at 4&#xb0;C. Primary antibodies against MMP3 (ab52915), MMP9 (ab228402), MMP13 (ab39012), aggrecan (ab3773), Bax (ab32503), and Bcl-2 (ab196495) were purchased from Abcam (Cambridge, United Kingdom). Other antibodies used, such as &#x3b2;-actin (D6A8), Cleaved Caspase-3 (ASP175), Bip (3183S), CHOP (L63F7), XBP-1s (E9V3E), and IRE1&#x3b1; (14C10) were purchased from Cell Signaling Technology (Danvers, MA, United States). Membranes were washed three times with TBST for 10&#xa0;min and then incubated with anti-rabbit or anti-mouse secondary antibodies (1:10,000 dilution) for 1&#xa0;h with protection from light exposure. After washing three times with TBST, the protein immunoreactivity of the membranes was analyzed using a fluorescence imaging system (LI-COR Biosciences, Lincoln, NE, United States). Measurements of OD values were performed using ImageJ software (National Institutes of Health, United States).</p>
</sec>
<sec id="s2-6">
<title>2.6 Immunofluorescence</title>
<p>For immunofluorescence detection, slides were used to seed cells in a six-well plate at a density of 4&#xd7;10<sup>5</sup> cells per well for 8 h, waiting for attachment and proliferation. NP cells were pre-administered with or without Sal003 (5&#xa0;&#x3bc;M) for 2&#xa0;h and subsequently treated with Tg (1&#xa0;&#x3bc;M) for 24&#xa0;h. NP cells were fixed with paraformaldehyde (4%) for 15&#xa0;min at RT. For permeation of the membranes, 0.25% Triton X-100 was used for 10&#xa0;min and then washed three times with PBS. After 2&#xa0;h of blocking with 5% BSA at RT, cells were incubated with primary antibodies against MMP13, Aggrecan, CHOP, XBP-1s (diluted 1:200, Abcam) overnight at 4&#xb0;C. PBS was used to wash the cells thrice the next day. Alexa Fluor 488 or 594 secondary antibody (anti-rabbit, Cell Signaling Technology) was used for incubation of the cells for 1&#xa0;h after which they were washed three times. After incubation for 15&#xa0;min with DAPI and washing, the images were obtained using a fluorescence microscope (Leica SP8 confocal microscope, Germany).</p>
</sec>
<sec id="s2-7">
<title>2.7 High density culture</title>
<p>Ten &#x3bc;L NP cells at a density of 1.0&#xd7;10<sup>7</sup> cells/mL were seeded in 24-well plate. After 2&#xa0;h of cell attachment, each well in plate was added DMEM medium with 2.5% FBS and 1% insulin transferrin selenium (ITS) (Gibco, Thermo Fisher Scientific, Waltham, MA, United States) with Tg and Sal003 as mentioned before. The medium was changed every 2&#xa0;days. The cluster of NP cells was subjected to alcian blue and toluidine blue dye overnight at room temperature following fixation by 4% PFA for 10&#xa0;min to assess the production of collagen synthesis after culture for 7&#xa0;days.</p>
</sec>
<sec id="s2-8">
<title>2.8 Flow cytometry assay</title>
<p>Apoptotic NP cells were determined using the Annexin V 633 Apoptosis Detection Kit (AD11, Dojindo, Kumamoto, Japan), according to the manufacturer&#x2019;s protocol. The apoptotic rate (%) in various groups was examined using flow cytometry (BD Co., United States).</p>
</sec>
<sec id="s2-9">
<title>2.9 Surgical procedure</title>
<p>Twenty male SD rats aged 12&#xa0;weeks were kept under appropriate circumstances preoperatively and postoperatively. Percutaneous needle puncture was used to construct an IVDD model in rats (<xref ref-type="bibr" rid="B7">Han et al., 1976</xref>). Briefly, anesthesia was administered to the rats by intraperitoneal injection of pentobarbital sodium (40&#xa0;mg/kg of body weight), and 75% ethanol was used to disinfect the tails. A 20G sterile needle was used to puncture the Co7/8 and Co8/9 discs from the dorsal skin into the NP center. The IVDD model was completed by a subsequent rotation of 360&#xb0; and holding for 30&#xa0;s in position. Eventually, re-sterilization was performed after pulling out the needle to avoid infection. 5&#xa0;&#x3bc;L Sal003 of 5&#xa0;&#xb5;M was given to the Co8/9 discs every week <italic>via</italic> a microsyringe as IVDD &#x2b; Sal003. The IVDD group was administered the same volume of saline weekly into the Co7/8 discs. Co6/7 discs were not administered any treatment as they were the control group.</p>
</sec>
<sec id="s2-10">
<title>2.10 X-ray analysis</title>
<p>The rats underwent X-ray examination 4&#xa0;weeks postoperatively for evaluation of the intervertebral space. Digital imaging was captured in the anteroposterior axis using 21&#xa0;lp/mm detectors supplied with &#xd7;5 geometric magnification (Faxitron VersaVision; Faxitron Bioptics LLC, Tucson, AZ, United States). Calculation of disc height indices (DHIs) was in accordance with a previous report in which the average IVD height (DHI) was calculated by averaging the measurements obtained from the anterior, middle, and posterior portions of the IVD and dividing it by the average of adjacent vertebral body heights. Changes in the DHI of injected discs were expressed as DHI% and normalized to the measured preoperative IVD height (DHI &#x3d; 2&#xd7; (D &#x2b; E &#x2b; F)/(A &#x2b; B &#x2b; C &#x2b; G &#x2b; H &#x2b; I)% &#x3d; postoperative DHI/preoperative DHI &#xd7; 100) (<xref ref-type="bibr" rid="B7">Han et al., 2008</xref>).</p>
</sec>
<sec id="s2-11">
<title>2.11 Magnetic resonance imaging (MRI) analysis</title>
<p>IVDD progression was assessed by MRI. Four weeks postoperatively, the rats were fixed after anesthesia, and the signals of the assigned IVD section were acquired in T2-weighted images (T2WI) of the sagittal planes using a 1.5&#xa0;T magnetic resonance scanner (Philips Eclipse, Cleveland, OH, United States). Subsequently, a grading system for determining IVDD levels based on MRI scan was measured by Pfirrmann grades: A homogeneous bright white structure as Grade I, inhomogeneous white structure and possible horizontal bands as Grade II, clear distinction between annulus and nucleus as Grade III, no collapsed disc space as Grade IV, and collapsed disc space as Grade V (<xref ref-type="bibr" rid="B26">Masuda et al., 1976</xref>).</p>
</sec>
<sec id="s2-12">
<title>2.12 Histology analysis</title>
<p>Four% paraformaldehyde was collected and fixed in four coccygeal IVD tissues for at least 48&#xa0;h. Then, paraffin was embedded in the samples, and 5&#xa0;&#xb5;m sections were obtained in the region of the midsagittal plane. Subsequently, sections were stained with hematoxylin and eosin (HE), alcian blue (AB), toluidine blue (TB) and safranin O-fast green (SO-FG) to assess the IVD structures. The histological score was calculated as previously described (<xref ref-type="bibr" rid="B10">Ji et al., 2018</xref>).</p>
</sec>
<sec id="s2-13">
<title>2.13 Immunohistochemistry</title>
<p>Deparaffinization and rehydration were first administered to sections, and 3% hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) was used for 20&#xa0;min to block endogenous peroxidase. The primary antibodies were incubated overnight at 4&#xb0;C, followed by blocking with 10% goat serum for 2&#xa0;h at RT. Sections were then washed three times with PBS and incubated with HRP-conjugated secondary antibody for 2&#xa0;h at RT the next day. Digital images were obtained using a Leica DM4000 B microscope (Leica Microsystems). The integrated optical density (IOD) was measured for semi-quantitative analysis using Image Pro Plus software (version 6.0; Media Cybernetics, Silver Spring, MD, United States).</p>
</sec>
<sec id="s2-14">
<title>2.14 Tunel</title>
<p>Apoptosis of NP cells was examined by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) using a TUNEL Kit (C1086, Beyotime Biotechnology Co., Shanghai, China). Quantification of positive cells was performed in three randomly selected fields from each sample using Image-Pro Plus 6.0 (Media Cybernetics, Silver Spring, MD, United States). DAPI staining was used to estimate the total cell number under a fluorescence microscope.</p>
</sec>
<sec id="s2-15">
<title>2.15 Statistical analysis</title>
<p>The experiments in our study were performed at least three times to obtain data, which are presented as means &#xb1; standard deviations. Differences between two groups were assessed by the <italic>t</italic>-test, while significant differences among groups were assessed by ANOVA. Statistical significance was set at <italic>p</italic> &#x3c; 0.05. GraphPad Prism 8.3 (GraphPad Software, San Diego, CA, United States) was utilized for data analysis and creating relevant figures.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>3 Results</title>
<sec id="s3-1">
<title>3.1 Influences of Sal003 on viability of NP cells</title>
<p>Sal003 is presented in <xref ref-type="fig" rid="F1">Figure 1A</xref>.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>The chemical structure of Sal003 and effects of Sal003 on NP cells viability and proliferation. <bold>(A)</bold> The chemical structure of Sal003. <bold>(B)</bold> NP cells at a density of 1&#xd7;10<sup>4</sup> cells/well were treated with Sal003 at different concentrations for 24&#xa0;h. CCK-8 experiments were carried out to evaluate the cytotoxicity. <bold>(C&#x2013;E)</bold> The effects of Sal003 on proliferation was also determined by CCK-8 experiments. NP cells at a density of 2.5&#xd7;10<sup>3</sup> cells/well were incubated with Sal003 for 24&#xa0;h <bold>(C)</bold>, 48&#xa0;h <bold>(D)</bold> or 72&#xa0;h <bold>(E)</bold>. All data are presented as mean &#xb1; SD. &#x2a;<italic>p</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>p</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.001, &#x2a;&#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.0001, <italic>n</italic> &#x3d; 3.</p>
</caption>
<graphic xlink:href="fphar-14-1095307-g001.tif"/>
</fig>
<p>To analyze cytotoxicity, each well of the 96-well plates was used for seeding 10,000 NP cells and cultivated for 24&#xa0;h at concentrations of 0, 2.5, 5, 10, 20, and 40&#xa0;&#x3bc;M Sal003. The cytotoxicity of Sal003 was calculated based on the 0&#xa0;&#x3bc;M Sal003 group. Sal003 exhibited cytotoxicity in NP cells at concentrations of 10&#xa0;&#x3bc;M or higher (<xref ref-type="fig" rid="F1">Figure 1B</xref>).</p>
<p>To determine cell proliferation, each well of the 96-well plates was seeded by 2,500 NP cells and cultured for 24&#xa0;h at concentrations of 0, 2.5, 5, 10, 20, and 40&#xa0;&#x3bc;M Sal003. To ensure the proliferation of Sal003, the cells were subjected to a CCK-8 assay for a time period ranging from 24 to 72&#xa0;h following seeding. Sal003 showed an inhibitory influence on the proliferation of NP cells at 20&#xa0;&#x3bc;M or more. NP cells treated with 5&#xa0;&#x3bc;M Sal003 were significantly higher than those treated with other concentrations at 48 and 72&#xa0;h (<xref ref-type="fig" rid="F1">Figures 1C&#x2013;E</xref>). Thus, 5&#xa0;&#x3bc;M Sal003 was used in the following experiments.</p>
</sec>
<sec id="s3-2">
<title>3.2 Sal003 mitigated ECM degradation induced by Tg <italic>in vitro</italic>
</title>
<p>RT-qPCR, Western Blotting, and immunofluorescence were performed to determine the changes in the ECM. RT-qPCR showed upregulation of MMP3, MMP9, MMP13, and ADAMTS5, which are related to the increase in catabolic levels following stimulation by Tg. Furthermore, aggrecan (considered one of the dominant factors of ECM) levels decreased after treatment with Tg. These Tg-induced harmful factors were partially reversed by Sal003 treatment (<xref ref-type="fig" rid="F2">Figure 2A</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Sal003 prevented NP cells from extracellular degradation induced by Tg. <bold>(A)</bold> The relative mRNA expression of MMP3, MMP9, MMP13, ADAMTS5, and Aggrecan were analyzed by RT-qPCR. <bold>(B,D)</bold> The expression of MMP3, MMP9, MMP13, and Aggrecan at protein level were detected by Western Blotting. <bold>(C)</bold> The representative merged images of MMP9 and Aggrecan were obtained by immunofluorescence combined with DAPI staining for nuclei (scale bar: 100&#xa0;&#xb5;m). Values of IOD were measured to determine the results of immunofluorescence. <bold>(E,F)</bold> Alcian blue and toluidine blue staining of high-density culture of NP cells and quantitative analysis. All data are presented as mean &#xb1; SD. &#x2a;<italic>p</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>p</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.001 and &#x2a;&#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.0001, <italic>n</italic> &#x3d; 3.</p>
</caption>
<graphic xlink:href="fphar-14-1095307-g002.tif"/>
</fig>
<p>In addition, Western Blotting demonstrated that ECM degradation, including a decrease in aggrecan and an increase in MMP3, MMP9, and MMP13 protein levels, induced by Tg, could be reversed by Sal003 (<xref ref-type="fig" rid="F2">Figures 2B, D</xref>). The immunofluorescence staining results for MMP13 and aggrecan were also in accordance with the results mentioned in the study (<xref ref-type="fig" rid="F2">Figure 2C</xref>). Micromass culture results were in accordance with previous outcome (<xref ref-type="fig" rid="F2">Figures 2E, F</xref>).</p>
</sec>
<sec id="s3-3">
<title>3.3 Sal003 alleviated Tg-triggered apoptosis <italic>in vitro</italic>
</title>
<p>To determine the potential protective effects of Sal003 in Tg-stimulated NP cells, flow cytometry and Western Blotting were performed to evaluate apoptotic activity. The results of flow cytometry indicated that the number of apoptotic NP cells in the Tg group was markedly higher than that in the Sal003 pretreated group (<xref ref-type="fig" rid="F3">Figures 3A, B</xref>). Moreover, apoptosis-related proteins were detected using Western Blotting analysis (<xref ref-type="fig" rid="F3">Figures 3C, D</xref>). The results indicated that Sal003 increased Bcl-2 and inhibited Bax and cleaved caspase-3 in NP cells. Our results suggest that ER stress-related apoptosis of NP cells caused by Tg induction is decreased following pretreatment with Sal003.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Sal003 mitigated Tg-induced apoptosis of NP cells. <bold>(A,B)</bold> Stained with Annexin V-633 and PI, apoptotic NP cells rates in different groups were determined by flow cytometry. <bold>(C,D)</bold> The expression of Bax, Bcl-2 and cleaved caspase-3 at the protein level were determined by western blotting. All data are presented as mean &#xb1; SD. &#x2a;<italic>p</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>p</italic> &#x3c; 0.01 and &#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.001, &#x2a;&#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.0001, <italic>n</italic> &#x3d; 3.</p>
</caption>
<graphic xlink:href="fphar-14-1095307-g003.tif"/>
</fig>
</sec>
<sec id="s3-4">
<title>3.4 Sal003 reversed Tg-triggered ER stress <italic>in vitro</italic>
</title>
<p>Using RT-PCR and Western Blotting, NP cells were treated with Tg to examine whether Sal003 exerted cytoprotective effects under ER stress. ATF4, ATF6, Bip, and CHOP levels were markedly higher in the Tg-treated group than those in the control group, and Sal003 partially but significantly reversed these increases (<xref ref-type="fig" rid="F4">Figure 4A</xref>). In addition, Western Blotting showed that Sal003 inhibited Tg-activated ER stress by decreasing Bip, CHOP, XBP-1s, and IRE1&#x3b1; at the protein level (<xref ref-type="fig" rid="F4">Figures 4B, C</xref>). The immunofluorescence staining results for CHOP and XBP-1s were also in accordance with the results mentioned in the study (<xref ref-type="fig" rid="F4">Figures 4D, E</xref>).</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>Sal003 downregulated Tg-induced ER stress in NP cells. <bold>(A)</bold> The relative mRNA expression of ATF4, ATF6, BiP, CHOP, and Traf2 were analyzed by RT-qPCR. <bold>(B,C)</bold> The protein level expression of BiP, CHOP, IRE1&#x3b1; and XBP-1s treated by Sal003 were measured by western blotting. <bold>(D,E)</bold> The representative merged images of CHOP and XBP-1s were obtained by immunofluorescence combined with DAPI staining for nuclei (scale bar: 30&#xa0;&#xb5;m). Values of IOD were measured to determine the results of immunofluorescence. All data are presented as mean &#xb1; SD. &#x2a;<italic>p</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>p</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.001 and &#x2a;&#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.0001, <italic>n</italic> &#x3d; 3.</p>
</caption>
<graphic xlink:href="fphar-14-1095307-g004.tif"/>
</fig>
</sec>
<sec id="s3-5">
<title>3.5 Sal003 rescued IVDD induced <italic>via</italic> needle puncture in the rat tail <italic>in vivo</italic>
</title>
<p>Experiments were performed to determine whether Sal003 could function as a therapeutic agent for IVDD <italic>in vivo</italic>. The rat IVDD model was established by needle puncture of caudal discs. Radiography and MRI were performed 4&#xa0;weeks postoperatively. HE, SOFG, AB, and TB staining were also used to assess morphological differences in IVD following Sal003 administration. After assessing histomorphology, observed findings included contraction, reduction of NP cells, disorganization at the border between the nucleus pulposus and annulus fibrosus, and extensive loss of proteoglycans in the IVDD group. However, Sal003 treatment partially mitigated these detrimental changes at the histopathological levels, demonstrating slight shrinking and loss of NP cells and proteoglycan. Histological score analysis also demonstrated the impact of Sal003 in delaying IVDD progression (<xref ref-type="fig" rid="F5">Figures 5A, B</xref>). As shown in <xref ref-type="fig" rid="F5">Figures 5D, E</xref>, the IVDD group showed decreased disc signal and intervertebral height after surgery. However, Sal003 partially reversed the collapsed disc height and decreased the MRI signal. TUNEL assay was also applied to determine whether Sal003 could mitigate apoptosis <italic>in vivo</italic>. Consistent with our <italic>in vitro</italic> results, Sal003 inhibited apoptosis during IVDD (<xref ref-type="fig" rid="F5">Figures 5C, F</xref>). Furthermore, immunohistochemical staining of BiP, CHOP, MMP3, MMP13, Bax and cleaved caspase-3 demonstrated the mitigation by Sal003 of ECM degradation, ER stress activation and apoptosis in the rat IVDD model, which was also in agreement with the results of our <italic>ex vivo</italic> experiments (<xref ref-type="fig" rid="F5">Figures 5G, H</xref>).</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>Sal003 ameliorated IVDD in a rat puncture-induced model <italic>in vivo</italic>. <bold>(A,B)</bold> The representative images and histological scales of HE, SO-FG, AB and TB staining of punctured IVD in different groups (scale bar: 20&#xa0;&#xb5;m). <bold>(C,F)</bold> The semi-quantitative analysis and representative images of TUNEL staining for IVD tissues in different groups (scale bar: 150&#xa0;&#xb5;m). <bold>(D,E)</bold> The representative X-ray and MRI images of a rat tail after 4&#xa0;weeks of surgery with the disc height index and Pfirrmann grades shown in different groups at 4&#xa0;weeks. <bold>(G)</bold> The IOD value/area was calculated to assess the results of immunohistochemistry staining through semi-quantitative analysis. <bold>(H)</bold> The expression of BiP, CHOP, MMP3, MMP13, Bax and cleaved caspase-3 at IVD tissues in different groups were determined by immunohistochemistry staining (scale bar: 5&#xa0;&#xb5;m). All data are presented as mean &#xb1; SD. &#x2a;&#x3c;0.05. &#x2a;&#x2a;<italic>p</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.001 and &#x2a;&#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.0001, <italic>n</italic> &#x3d; 6.</p>
</caption>
<graphic xlink:href="fphar-14-1095307-g005.tif"/>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>4 Discussion</title>
<p>IVDD is a degenerative joint disease characterized by excessive apoptosis of NP cells and degradation of ECM (<xref ref-type="bibr" rid="B19">Liang et al., 2022</xref>). ER stress is a potential mechanism underlying IVDD. In our study, Tg induced ER stress by inhibiting the Ca<sup>2&#x2b;</sup>-ATPase activity. Sal003 is a small-molecule compound that exerts a regulatory effect under ER stress (<xref ref-type="bibr" rid="B1">Dadey et al., 2018</xref>; <xref ref-type="bibr" rid="B2">Darini et al., 2019</xref>). Studies have reported that Sal003 promotes cell expansion and reduces DNA damage (<xref ref-type="bibr" rid="B5">Fujita et al., 2021</xref>; <xref ref-type="bibr" rid="B35">Soiberman et al., 2019</xref>). In this study, we discuss the relationship between the protective effect of Sal003 and ER stress both <italic>in vitro</italic> and <italic>in vivo</italic> for the first time. Our results indicated that Sal003 could regulate the ER stress pathway when Tg was administered to rat NP cells, thus showing the characteristics of inhibiting apoptosis and reducing matrix degradation. Our <italic>in vivo</italic> results showed for the first time that Sal003 could significantly inhibit ER stress and reduce NP cell apoptosis and ECM degradation. In general, our study demonstrated that Sal003 could exert therapeutic effects on IVDD, both <italic>in vivo</italic> and <italic>in vitro</italic> (<xref ref-type="fig" rid="F6">Figure 6</xref>).</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>Potential molecular mechanisms involved in therapeutic impacts of Sal003 on IVDD. Created with <ext-link ext-link-type="uri" xlink:href="http://BioRender.com">BioRender.com</ext-link>.</p>
</caption>
<graphic xlink:href="fphar-14-1095307-g006.tif"/>
</fig>
<p>Excessive ER stress can lead to apoptosis and extracellular matrix (ECM) degradation. ER stress-induced apoptosis involves transcriptional activation of the CHOP pathway, activation of BiP, and induction of the caspase pathway (<xref ref-type="bibr" rid="B30">Puthalakath et al., 2007</xref>). In human IVDD, the expression of ER stress-related biomarkers, including p-PERK, ATF4, BiP, and CHOP, in NP is positively correlated with degeneration grade (<xref ref-type="bibr" rid="B4">Fujii et al., 2018</xref>; <xref ref-type="bibr" rid="B20">Liao et al., 2019</xref>; <xref ref-type="bibr" rid="B21">Lin et al., 2021</xref>). Animal experiments have further proven that the expression of ER stress-related markers is related to the degeneration grade and senescence of rat intervertebral discs (<xref ref-type="bibr" rid="B41">Xie et al., 2017</xref>). Previous studies showed that the degree of apoptosis in intervertebral discs was lower than that of the control group after CHOP gene knockout, and MRI signal and histological scores were significantly improved after injection of CHOP shRNA into rats (<xref ref-type="bibr" rid="B47">Zhang et al., 2011</xref>). Overall, prolonged activation of IRE1&#x3b1; and CHOP can trigger apoptosis under physiological and pathophysiological conditions (<xref ref-type="bibr" rid="B37">Szegezdi et al., 2006</xref>). Unfolded protein reaction (UPR)-induced apoptosis may serve as a useful method to eliminate uncorrected cells under physiological ER stress (<xref ref-type="bibr" rid="B38">Tabas and Ron 2011</xref>). However, chronic ER stress can also induce pathological apoptosis (<xref ref-type="bibr" rid="B13">Kaufman 2002</xref>). We found that Sal003 inhibited Tg-induced activation of ER stress pathways, including IRE1&#x3b1; and CHOP, thus exerting anti-apoptotic functions by regulating the expression of Bax/Bcl-2, which was also in accordance with a previous report (<xref ref-type="bibr" rid="B9">Iurlaro and Munoz-Pinedo 2016</xref>). Furthermore, ER stress can also affect the synthesis and secretion of ECM proteins, causing protein aggregates to accumulate in the ER. Cells secreting ECM would die <italic>via</italic> apoptosis, necroptosis, and autophagy, which could disrupt homeostasis (<xref ref-type="bibr" rid="B32">Rellmann et al., 2021</xref>). In our study, we also explored whether the protective effects of Sal003 were related to attenuation of ER stress. RT-qPCR and Western blotting analysis showed that Sal003 inhibited Tg-induced apoptosis of NP cells and ECM degradation by regulating ER stress signaling pathways. The downregulation of ATF4, CHOP, BiP, IRE1&#x3b1;, XBP-1s, cleaved caspase-3, Bax, and MMP families, as well as the upregulation of Aggrecan and Bcl-2 proved this point. Our results showed that Sal003 reduced the apoptosis of NP cells and mitigated ECM degradation by reducing ER stress.</p>
<p>Some studies have shown that Sal003 can regulate various cell phenotypes by modulating ER stress (<xref ref-type="table" rid="T2">Table 2</xref>). In addition, Sal003 reduced the apoptosis of human renal proximal tubular cells by inhibiting p53 activation and reducing oxidative stress, according to a previously reported study (<xref ref-type="bibr" rid="B11">Ju et al., 2017</xref>). A recent study on musculoskeletal diseases demonstrated that Sal003 could upregulate p-eIF2&#x3b1; <italic>in vitro</italic> to further increase the expansion of muscle satellite cells (<xref ref-type="bibr" rid="B5">Fujita et al., 2021</xref>). However, it remains unclear whether Sal003 protects against IVDD by regulating the ER stress-related pathway. Based on this, we determined the effects of Sal003 on ER stress by measuring stress-related markers at the RNA and protein levels. Results showed that Sal003 could significantly inhibit ER stress pathway by downregulating ATF4, ATF6, BIP, CHOP, IRE1&#x3b1; and XBP-1s induced by Tg at the RNA and protein levels <italic>in vitro</italic>. Although the effects of Sal003 on ER stress showed minor differences from previous reports, it could be due to the interaction with other possible pathways and the specificity of NP cells based on the unique microenvironment of insufficient blood supply and hypoxia inside the intervertebral disc. Furthermore, cell fate after treatment with Sal003 could be determined by cell viability administered by increasing the concentration of Sal003 and differences in the pathological mechanisms of various diseases such as the discrepancy between tumor and musculoskeletal disorders (<xref ref-type="table" rid="T2">Table 2</xref>). The concentration of Sal003 in the <italic>in vivo</italic> experiment, which was 5&#x3bc;m, was determined according to our previous CCK-8 results. The drug dosage of 5&#xa0;&#x3bc;L in this experiment was based on the volume of the IVD and previous reports (<xref ref-type="bibr" rid="B43">Yang et al., 2021</xref>; <xref ref-type="bibr" rid="B50">Zhou et al., 2022</xref>). Furthermore, the weekly injection of Sal003 was based on previous reports as well as the microenvironment inside IVD which is characterized by blood supply that is insufficient to maintain the continuity of the treatment (<xref ref-type="bibr" rid="B18">Li et al., 2022c</xref>; <xref ref-type="bibr" rid="B25">Ma et al., 2022</xref>). In addition, Sal003 significantly reduced the apoptosis of NP cells and degradation of ECM in puncture-induced IVDD rats and alleviated the expression of catabolic and stress-related markers <italic>in vivo</italic>. These results indicate that Sal003 reduced apoptosis and ECM degradation induced by ER stress in rat NP cells. The limitations of our study were that we failed to mention the protective effects of Sal003 on stress-related apoptosis and ECM degradation in human NP cells and the possible interactions between Sal003 and other pathways. These questions are the main direction for future research.</p>
<table-wrap id="T2" position="float">
<label>TABLE 2</label>
<caption>
<p>Literature review of Sal003.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Experiment Type (or cell type) Treatment</th>
<th align="left">Concentration</th>
<th align="left">Measured parameters</th>
<th align="left">Results</th>
<th align="left">PMID</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">
<italic>In vivo</italic>
</td>
<td align="left">20&#xa0;&#x3bc;M</td>
<td rowspan="3" align="left">Inhibition of translation in NAc MSNs and eIF2&#x3b1; dephosphorylation</td>
<td rowspan="3" align="left">reduced cue-induced cocaine craving</td>
<td rowspan="3" align="char" char=".">29431650</td>
</tr>
<tr>
<td align="left">Cue-induced seeking test</td>
<td rowspan="2" align="left">/0.5&#x3bc;L/hemisphere</td>
</tr>
<tr>
<td align="left">Intracranial injections</td>
</tr>
<tr>
<td align="left">
<italic>In vitro</italic> experiment</td>
<td rowspan="2" align="left">10&#xa0;&#x3bc;M</td>
<td rowspan="2" align="left">Promote eIF2&#x3b1; phosphorylation and caspase-7 activation</td>
<td rowspan="2" align="left">Enhanced apoptotic signaling</td>
<td rowspan="2" align="char" char=".">22354021</td>
</tr>
<tr>
<td align="left">Hela cells</td>
</tr>
<tr>
<td align="left">
<italic>In vitro</italic>
</td>
<td rowspan="3" align="left">10&#xa0;&#x3bc;M</td>
<td rowspan="3" align="left">Upregulate CHOP and downregulate cell viability</td>
<td rowspan="3" align="left">Reduced proliferation of GBM</td>
<td rowspan="3" align="char" char=".">29991528</td>
</tr>
<tr>
<td align="left">Glioblastoma multiforme (GBM)</td>
</tr>
<tr>
<td align="left">Ionizing radiation</td>
</tr>
<tr>
<td align="left">
<italic>In vitro</italic> experiment</td>
<td rowspan="2" align="left">5&#xa0;&#x3bc;M</td>
<td rowspan="2" align="left">Stimulate P-eIF2&#x3b1;</td>
<td rowspan="2" align="left">Inhibition of colony forming</td>
<td rowspan="2" align="char" char=".">31086176</td>
</tr>
<tr>
<td align="left">Her2&#x2b;,BT474</td>
</tr>
<tr>
<td align="left">
<italic>In vitro</italic> experiment</td>
<td rowspan="2" align="left">0.6, 1.2, 2.5, 5, 10&#xa0;&#x3bc;M</td>
<td rowspan="2" align="left">Upregulation of ATF4, CHOP and p-eIF-2&#x3b1;</td>
<td rowspan="2" align="left">Stimulated integrated stress response (ISR)</td>
<td rowspan="2" align="char" char=".">35802384</td>
</tr>
<tr>
<td align="left">Corneal Epithelial Cell</td>
</tr>
<tr>
<td align="left">
<italic>In vivo</italic> experiment</td>
<td rowspan="2" align="left">50&#xa0;&#x3bc;g/mL</td>
<td rowspan="2" align="left">Activation of ATF4 and Reduction of Col1a1</td>
<td rowspan="2" align="left">Decreased keratocyte density without affecting normal growth or development</td>
<td rowspan="2" align="char" char=".">34370978</td>
</tr>
<tr>
<td align="left">Administration of ocular surface</td>
</tr>
<tr>
<td align="left">
<italic>In vivo</italic> experiment</td>
<td rowspan="2" align="left">0, 2, 6, and 20&#xa0;&#x3bc;M/side</td>
<td rowspan="2" align="left">Activation of ATF4 and eIF2&#x3b1;</td>
<td rowspan="2" align="left">Disrupted the reconsolidation of morphine- or cocaine-induced conditioned place preference (CPP)</td>
<td rowspan="2" align="char" char=".">25057203</td>
</tr>
<tr>
<td align="left">Intra-basolateral amygdala (BLA) infusion</td>
</tr>
<tr>
<td align="left">
<italic>In vitro</italic> experiment</td>
<td rowspan="2" align="left">0.625, 1.25, 2.5, 5, 10&#xa0;&#x3bc;M</td>
<td rowspan="2" align="left">Decrease of hydroxyproline and COL1A1 transcription and eventual apoptosis in normal fibroblasts</td>
<td rowspan="2" align="left">Stimulated the ISR</td>
<td rowspan="2" align="char" char=".">31390655</td>
</tr>
<tr>
<td align="left">Human corneal stromal cells</td>
</tr>
<tr>
<td align="left">
<italic>In vivo</italic> and <italic>ex vivo</italic> experiment</td>
<td rowspan="3" align="left">10, 20&#xa0;&#x3bc;M</td>
<td rowspan="3" align="left">Activation of p-eIF2&#x3b1; and ATF4</td>
<td rowspan="3" align="left">Intrahippocampal injection of Sal003 impairs contextual memory</td>
<td rowspan="3" align="char" char=".">17418795</td>
</tr>
<tr>
<td align="left">Injection into the hippocampus</td>
</tr>
<tr>
<td align="left">Mouse embryonic fibroblasts</td>
</tr>
<tr>
<td align="left">
<italic>In vitro</italic> experiment</td>
<td rowspan="2" align="left">5&#xa0;&#x3bc;M</td>
<td align="left">Activation of ATF4, p-eiF2&#x3b1; and HO-1</td>
<td rowspan="2" align="left">Inhibition of apoptosis and attenuation of oxidative stress</td>
<td rowspan="2" align="char" char=".">29039478</td>
</tr>
<tr>
<td align="left">human renal proximal tubular cells, HK2 cells</td>
<td align="left">Downregulation of P53, cleaved caspase-3, cleaved PARP and ROS</td>
</tr>
<tr>
<td align="left">
<italic>In vitro</italic> experiment</td>
<td rowspan="2" align="left">10&#xa0;&#x3bc;M</td>
<td rowspan="2" align="left">Maintain P-eIF2&#x3b1;</td>
<td rowspan="2" align="left">Permit the expansion of satellite cells <italic>ex vivo</italic>
</td>
<td rowspan="2" align="char" char=".">33318147</td>
</tr>
<tr>
<td align="left">Muscle satellite cells</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec sec-type="conclusion" id="s5">
<title>5 Conclusion</title>
<p>In conclusion, we demonstrated that Sal003 prevents apoptosis and ECM degradation by inhibiting the ER stress pathway in Tg-stimulated rat NP cells. Our <italic>in vivo</italic> experiment using an IVDD rat model confirmed that Sal003 could alleviate the degree of IVDD, which is related to the improvement of ER stress. These results indicate that Sal003 could be considered as a potential therapeutic treatment for IVDD.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s6">
<title>Data availability statement</title>
<p>The raw data supporting the conclusion of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec id="s7">
<title>Ethics statement</title>
<p>The animal study was reviewed and approved by &#x23;SH9H-2021-TK326-1.</p>
</sec>
<sec id="s8">
<title>Author contributions</title>
<p>TZ and CZ designed and guided all experiments. YC, BL, and YX performed the experiments, organized the data, and drafted the manuscript. JZ performed statistical analysis and critically reviewed the manuscript for important intellectual content. CZ and JZ analyzed the data, confirmed the authenticity of all raw data, and helped write the manuscript. All authors approved the final manuscript.</p>
</sec>
<sec id="s9">
<title>Funding</title>
<p>This study received support from the Suzhou Science and Technology Development Plan Guiding Project (Grant No. SKYXD2022037), the Opening Project of the Shanghai Key Laboratory of Orthopaedic Implants (Grant No. KFKT2022001), and National Natural Science Foundation of China (Grant Nos 82130073, 81572768, and 81972136).</p>
</sec>
<ack>
<p>We are grateful for the huge help from bioimaging platform of Shanghai Institute of Precision Medicine for technical assistance in flow cytometry and <ext-link ext-link-type="uri" xlink:href="http://BioRender.com">BioRender.com</ext-link> in schematic plot design.</p>
</ack>
<sec sec-type="COI-statement" id="s10">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="disclaimer" id="s11">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dadey</surname>
<given-names>D. Y. A.</given-names>
</name>
<name>
<surname>Kapoor</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Khudanyan</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Thotala</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Hallahan</surname>
<given-names>D. E.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>PERK regulates glioblastoma sensitivity to ER stress although promoting radiation resistance</article-title>. <source>Mol. Cancer Res.</source> <volume>16</volume>, <fpage>1447</fpage>&#x2013;<lpage>1453</lpage>. <pub-id pub-id-type="doi">10.1158/1541-7786.MCR-18-0224</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Darini</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Ghaddar</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Chabot</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Assaker</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Sabri</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>An integrated stress response via PKR suppresses HER2&#x2b; cancers and improves trastuzumab therapy</article-title>. <source>Nat. Commun.</source> <volume>10</volume>, <fpage>2139</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-019-10138-8</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Diseases</surname>
<given-names>G. B. D.</given-names>
</name>
<name>
<surname>Injuries</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Global burden of 369 diseases and injuries in 204 countries and territories, 1990-2019: A systematic analysis for the global burden of disease study 2019</article-title>. <source>Lancet</source> <volume>396</volume>, <fpage>1204</fpage>&#x2013;<lpage>1222</lpage>. <pub-id pub-id-type="doi">10.1016/S0140-6736(20)30925-9</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fujii</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Fujita</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Suzuki</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Tsuji</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Takaki</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Umezawa</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>The unfolded protein response mediated by PERK is casually related to the pathogenesis of intervertebral disc degeneration</article-title>. <source>J. Orthop. Res.</source> <volume>36</volume>, <fpage>1334</fpage>&#x2013;<lpage>1345</lpage>. <pub-id pub-id-type="doi">10.1002/jor.23787</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fujita</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Jamet</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Lean</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>H. C. M.</given-names>
</name>
<name>
<surname>Hebert</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kleinman</surname>
<given-names>C. L.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Satellite cell expansion is mediated by P-eIF2&#x3b1;-dependent <italic>Tacc3</italic> translation</article-title>. <source>Development</source> <volume>148</volume>&#x2013;<lpage>dev194480</lpage>. <pub-id pub-id-type="doi">10.1242/dev.194480</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Groenendyk</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Michalak</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Endoplasmic reticulum quality control and apoptosis</article-title>. <source>Acta Biochim. Pol.</source> <volume>52</volume>, <fpage>381</fpage>&#x2013;<lpage>395</lpage>. <pub-id pub-id-type="doi">10.18388/abp.2005_3451</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Han</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>F. C.</given-names>
</name>
<name>
<surname>Xiao</surname>
<given-names>Y. X.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>Z. L.</given-names>
</name>
<etal/>
</person-group> (<year>1976</year>). <article-title>A simple disc degeneration model induced by percutaneous needle puncture in the rat tail</article-title>. <source>Spine (Phila Pa</source> <volume>33</volume>, <fpage>1925</fpage>&#x2013;<lpage>1934</lpage>. <pub-id pub-id-type="doi">10.1097/BRS.0b013e31817c64a9</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hosseinzadeh</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kamrava</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Joghataei</surname>
<given-names>M. T.</given-names>
</name>
<name>
<surname>Darabi</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Shakeri-Zadeh</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Shahriari</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Apoptosis signaling pathways in osteoarthritis and possible protective role of melatonin</article-title>. <source>J. Pineal Res.</source> <volume>61</volume>, <fpage>411</fpage>&#x2013;<lpage>425</lpage>. <pub-id pub-id-type="doi">10.1111/jpi.12362</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Iurlaro</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Munoz-Pinedo</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Cell death induced by endoplasmic reticulum stress</article-title>. <source>FEBS J.</source> <volume>283</volume>, <fpage>2640</fpage>&#x2013;<lpage>2652</lpage>. <pub-id pub-id-type="doi">10.1111/febs.13598</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ji</surname>
<given-names>M. L.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X. J.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>P. L.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Preclinical development of a microRNA-based therapy for intervertebral disc degeneration</article-title>. <source>Nat. Commun.</source> <volume>9</volume>, <fpage>5051</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-018-07360-1</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ju</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Jo</surname>
<given-names>Y. S.</given-names>
</name>
<name>
<surname>Jeon</surname>
<given-names>Y. M.</given-names>
</name>
<name>
<surname>Pae</surname>
<given-names>H. O.</given-names>
</name>
<name>
<surname>Kang</surname>
<given-names>D. G.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>H. S.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Phosphorylation of eIF2&#x3b1; suppresses cisplatin-induced p53 activation and apoptosis by attenuating oxidative stress via ATF4-mediated HO-1 expression in human renal proximal tubular cells</article-title>. <source>Int. J. Mol. Med.</source> <volume>40</volume>, <fpage>1957</fpage>&#x2013;<lpage>1964</lpage>. <pub-id pub-id-type="doi">10.3892/ijmm.2017.3181</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kadowaki</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Nishitoh</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Ichijo</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Survival and apoptosis signals in ER stress: The role of protein kinases</article-title>. <source>J. Chem. Neuroanat.</source> <volume>28</volume>, <fpage>93</fpage>&#x2013;<lpage>100</lpage>. <pub-id pub-id-type="doi">10.1016/j.jchemneu.2004.05.004</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kaufman</surname>
<given-names>R. J.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Orchestrating the unfolded protein response in health and disease</article-title>. <source>J. Clin. Investig.</source> <volume>110</volume>, <fpage>1389</fpage>&#x2013;<lpage>1398</lpage>. <pub-id pub-id-type="doi">10.1172/JCI16886</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kleimeyer</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Alamin</surname>
<given-names>T. F.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>S. S.</given-names>
</name>
<name>
<surname>Cha</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Yanamadala</surname>
<given-names>V.</given-names>
</name>
<etal/>
</person-group> (<year>1976</year>). <article-title>Selective anterior lumbar interbody fusion for low back pain associated with degenerative disc disease versus nonsurgical management</article-title>. <source>Spine (Phila Pa</source> <volume>43</volume>, <fpage>1372</fpage>&#x2013;<lpage>1380</lpage>. <pub-id pub-id-type="doi">10.1097/BRS.0000000000002630</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Krupkova</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Sadowska</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kameda</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Hitzl</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Hausmann</surname>
<given-names>O. N.</given-names>
</name>
<name>
<surname>Klasen</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>p38 MAPK facilitates crosstalk between endoplasmic reticulum stress and IL-6 release in the intervertebral disc</article-title>. <source>Front. Immunol.</source> <volume>9</volume>, <fpage>1706</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2018.01706</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Rong</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2022a</year>). <article-title>Engeletin alleviates the inflammation and apoptosis in intervertebral disc degeneration via inhibiting the NF-&#x3ba;B and MAPK pathways</article-title>. <source>J. Inflamm. Res.</source> <volume>15</volume> (2022c), <fpage>5767</fpage>&#x2013;<lpage>5783</lpage>. <pub-id pub-id-type="doi">10.2147/JIR.S371809</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>W.</given-names>
</name>
<etal/>
</person-group> <year>2022b</year>, <article-title>WTAP-mediated m(6)A modification of lncRNA NORAD promotes intervertebral disc degeneration</article-title>. <source>Nat. Commun.</source> <volume>13</volume> (2022a) <fpage>1469</fpage>, <pub-id pub-id-type="doi">10.1038/s41467-022-28990-6</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>C.</given-names>
</name>
</person-group>, <year>2022c</year>, <article-title>Epigenetic regulation in intervertebral disc degeneration</article-title>. <source>Trends Mol. Med.</source> <volume>28</volume> (2022b) <fpage>803</fpage>&#x2013;<lpage>805</lpage>. <pub-id pub-id-type="doi">10.1016/j.molmed.2022.07.007</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>The proteolysis of ECM in intervertebral disc degeneration</article-title>. <source>Int. J. Mol. Sci.</source> <volume>23</volume>&#x2013;<lpage>1715</lpage>. <pub-id pub-id-type="doi">10.3390/ijms23031715</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liao</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhan</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Exosomes from mesenchymal stem cells modulate endoplasmic reticulum stress to protect against nucleus pulposus cell death and ameliorate intervertebral disc degeneration <italic>in vivo</italic>
</article-title>. <source>Theranostics</source> <volume>9</volume>, <fpage>4084</fpage>&#x2013;<lpage>4100</lpage>. <pub-id pub-id-type="doi">10.7150/thno.33638</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Peng</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Qing</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> <article-title>Reactive oxygen species regulate endoplasmic reticulum stress and ER-mitochondrial Ca(2&#x2b;) crosstalk to promote programmed necrosis of rat nucleus pulposus cells under compression</article-title>. <source>Oxid. Med. Cell Longev.</source> <volume>2021</volume> 8810698 (<year>2021</year>) <fpage>1</fpage>-<lpage>20</lpage>. <pub-id pub-id-type="doi">10.1155/2021/8810698</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livshits</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Popham</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Malkin</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Sambrook</surname>
<given-names>P. N.</given-names>
</name>
<name>
<surname>Macgregor</surname>
<given-names>A. J.</given-names>
</name>
<name>
<surname>Spector</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>Lumbar disc degeneration and genetic factors are the main risk factors for low back pain in women: The UK twin spine study</article-title>. <source>Ann. Rheum. Dis.</source> <volume>70</volume>, <fpage>1740</fpage>&#x2013;<lpage>1745</lpage>. <pub-id pub-id-type="doi">10.1136/ard.2010.137836</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luo</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Cheung</surname>
<given-names>J. P. Y.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>O-GlcNAc transferase regulates intervertebral disc degeneration by targeting FAM134B-mediated ER-phagy</article-title>. <source>Exp. Mol. Med.</source> <volume>54</volume>, <fpage>1472</fpage>&#x2013;<lpage>1485</lpage>. <pub-id pub-id-type="doi">10.1038/s12276-022-00844-7</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luo</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liao</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Yin</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhan</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Impaired calcium homeostasis via advanced glycation end products promotes apoptosis through endoplasmic reticulum stress in human nucleus pulposus cells and exacerbates intervertebral disc degeneration in rats</article-title>. <source>FEBS J.</source> <volume>286</volume>, <fpage>4356</fpage>&#x2013;<lpage>4373</lpage>. <pub-id pub-id-type="doi">10.1111/febs.14972</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ma</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>MFG-E8 alleviates intervertebral disc degeneration by suppressing pyroptosis and extracellular matrix degradation in nucleus pulposus cells via Nrf2/TXNIP/NLRP3 axis</article-title>. <source>Cell Death Discov.</source> <volume>8</volume>, <fpage>209</fpage>. <pub-id pub-id-type="doi">10.1038/s41420-022-01002-8</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Masuda</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Aota</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Muehleman</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Imai</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Okuma</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Thonar</surname>
<given-names>E. J.</given-names>
</name>
<etal/>
</person-group> (<year>1976</year>). <article-title>A novel rabbit model of mild, reproducible disc degeneration by an anulus needle puncture: Correlation between the degree of disc injury and radiological and histological appearances of disc degeneration</article-title>. <source>Spine (Phila Pa</source> <volume>30</volume>, <fpage>5</fpage>&#x2013;<lpage>14</lpage>. <pub-id pub-id-type="doi">10.1097/01.brs.0000148152.04401.20</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mohd Isa</surname>
<given-names>I. L.</given-names>
</name>
<name>
<surname>Mokhtar</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Abbah</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Fauzi</surname>
<given-names>M. B.</given-names>
</name>
<name>
<surname>Devitt</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Pandit</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Intervertebral disc degeneration: Biomaterials and tissue engineering strategies toward precision medicine</article-title>. <source>Adv. Healthc. Mater</source> <volume>11</volume>&#x2013;<lpage>e2102530</lpage>. <pub-id pub-id-type="doi">10.1002/adhm.202102530</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Novais</surname>
<given-names>E. J.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Madhu</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Suyama</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Anjo</surname>
<given-names>S. I.</given-names>
</name>
<name>
<surname>Manadas</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Hypoxia and hypoxia-inducible factor-1&#x3b1; regulate endoplasmic reticulum stress in nucleus pulposus cells: Implications of endoplasmic reticulum stress for extracellular matrix secretion</article-title>. <source>Am. J. Pathol.</source> <volume>191</volume>, <fpage>487</fpage>&#x2013;<lpage>502</lpage>. <pub-id pub-id-type="doi">10.1016/j.ajpath.2020.11.012</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Paschen</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Mengesdorf</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Cellular abnormalities linked to endoplasmic reticulum dysfunction in cerebrovascular disease--therapeutic potential</article-title>. <source>Pharmacol. Ther.</source> <volume>108</volume>, <fpage>362</fpage>&#x2013;<lpage>375</lpage>. <pub-id pub-id-type="doi">10.1016/j.pharmthera.2005.05.008</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Puthalakath</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>O&#x27;Reilly</surname>
<given-names>L. A.</given-names>
</name>
<name>
<surname>Gunn</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Kelly</surname>
<given-names>P. N.</given-names>
</name>
<name>
<surname>Huntington</surname>
<given-names>N. D.</given-names>
</name>
<etal/>
</person-group> (<year>2007</year>). <article-title>ER stress triggers apoptosis by activating BH3-only protein Bim</article-title>. <source>Cell</source> <volume>129</volume>, <fpage>1337</fpage>&#x2013;<lpage>1349</lpage>. <pub-id pub-id-type="doi">10.1016/j.cell.2007.04.027</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rahmati</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Moosavi</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>McDermott</surname>
<given-names>M. F.</given-names>
</name>
<name>
<surname>Stress</surname>
<given-names>E. R.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>A therapeutic target in rheumatoid arthritis?</article-title> <source>Trends Pharmacol. Sci.</source> <volume>39</volume>, <fpage>610</fpage>&#x2013;<lpage>623</lpage>. <pub-id pub-id-type="doi">10.1016/j.tips.2018.03.010</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rellmann</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Eidhof</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Dreier</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Review: ER stress-induced cell death in osteoarthritic cartilage</article-title>. <source>Cell Signal</source> <volume>78</volume>&#x2013;<lpage>109880</lpage>. <pub-id pub-id-type="doi">10.1016/j.cellsig.2020.109880</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Salminen</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kauppinen</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Suuronen</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kaarniranta</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Ojala</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>ER stress in alzheimer&#x27;s disease: A novel neuronal trigger for inflammation and alzheimer&#x27;s pathology</article-title>. <source>J. Neuroinflammation</source> <volume>6</volume>, <fpage>41</fpage>. <pub-id pub-id-type="doi">10.1186/1742-2094-6-41</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sikkeland</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Lindstad</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Nenseth</surname>
<given-names>H. Z.</given-names>
</name>
<name>
<surname>Dezitter</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Qu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Muhumed</surname>
<given-names>R. M.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Inflammation and ER stress differentially regulate STAMP2 expression and localization in adipocytes</article-title>. <source>Metabolism</source> <volume>93</volume>, <fpage>75</fpage>&#x2013;<lpage>85</lpage>. <pub-id pub-id-type="doi">10.1016/j.metabol.2019.01.014</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Soiberman</surname>
<given-names>U. S.</given-names>
</name>
<name>
<surname>Shehata</surname>
<given-names>A. E. M.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>M. X.</given-names>
</name>
<name>
<surname>Young</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Daoud</surname>
<given-names>Y. J.</given-names>
</name>
<name>
<surname>Chakravarti</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Small molecule modulation of the integrated stress response governs the keratoconic phenotype <italic>in vitro</italic>
</article-title>. <source>Investig. Ophthalmol. Vis. Sci.</source> <volume>60</volume>, <fpage>3422</fpage>&#x2013;<lpage>3431</lpage>. <pub-id pub-id-type="doi">10.1167/iovs.19-27151</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Geng</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Mitochondrial quality control in intervertebral disc degeneration</article-title>. <source>Exp. Mol. Med.</source> <volume>53</volume>, <fpage>1124</fpage>&#x2013;<lpage>1133</lpage>. <pub-id pub-id-type="doi">10.1038/s12276-021-00650-7</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Szegezdi</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Logue</surname>
<given-names>S. E.</given-names>
</name>
<name>
<surname>Gorman</surname>
<given-names>A. M.</given-names>
</name>
<name>
<surname>Samali</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Mediators of endoplasmic reticulum stress-induced apoptosis</article-title>. <source>EMBO Rep.</source> <volume>7</volume>, <fpage>880</fpage>&#x2013;<lpage>885</lpage>. <pub-id pub-id-type="doi">10.1038/sj.embor.7400779</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tabas</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Ron</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress</article-title>. <source>Nat. Cell Biol.</source> <volume>13</volume>, <fpage>184</fpage>&#x2013;<lpage>190</lpage>. <pub-id pub-id-type="doi">10.1038/ncb0311-184</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Traeger</surname>
<given-names>A. C.</given-names>
</name>
<name>
<surname>Qaseem</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>McAuley</surname>
<given-names>J. H.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Low back pain</article-title>. <source>JAMA</source> <volume>326</volume>, <fpage>286</fpage>. <pub-id pub-id-type="doi">10.1001/jama.2020.19715</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Ke</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Mechanosensitive ion channel Piezo1 activated by matrix stiffness regulates oxidative stress-induced senescence and apoptosis in human intervertebral disc degeneration</article-title>. <source>Oxid. Med. Cell Longev.</source> <volume>2021</volume>&#x2013;<lpage>8884922</lpage>. <pub-id pub-id-type="doi">10.1155/2021/8884922</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xie</surname>
<given-names>Z. Y.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Endoplasmic reticulum stress is involved in nucleus pulposus degeneration and attenuates low pH-induced apoptosis of rat nucleus pulposus cells</article-title>. <source>DNA Cell Biol.</source> <volume>36</volume>, <fpage>627</fpage>&#x2013;<lpage>637</lpage>. <pub-id pub-id-type="doi">10.1089/dna.2017.3736</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Ouyang</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Taurine attenuates ER stressassociated apoptosis and catabolism in nucleus pulposus cells</article-title>. <source>Mol. Med. Rep.</source> <volume>25</volume>&#x2013;<lpage>172</lpage>. <pub-id pub-id-type="doi">10.3892/mmr.2022.12688</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Bleomycin induces fibrotic transformation of bone marrow stromal cells to treat height loss of intervertebral disc through the TGF&#x3b2;R1/Smad2/3 pathway</article-title>. <source>Stem Cell Res. Ther.</source> <volume>12</volume>, <fpage>34</fpage>. <pub-id pub-id-type="doi">10.1186/s13287-020-02093-9</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yin</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Das</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>The REDD1/TXNIP complex accelerates oxidative stress-induced apoptosis of nucleus pulposus cells through the mitochondrial pathway</article-title>. <source>Oxid. Med. Cell Longev.</source> <volume>2021</volume>&#x2013;<lpage>7397516</lpage>. <pub-id pub-id-type="doi">10.1155/2021/7397516</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Lei</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Cytosolic escape of mitochondrial DNA triggers cGAS-STING-NLRP3 axis-dependent nucleus pulposus cell pyroptosis</article-title>. <source>Exp. Mol. Med.</source> <volume>54</volume> (2022a), <fpage>129</fpage>&#x2013;<lpage>142</lpage>. <pub-id pub-id-type="doi">10.1038/s12276-022-00729-9</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>Endoplasmic reticulum stress induced by tunicamycin and thapsigargin protects against transient ischemic brain injury: Involvement of PARK2-dependent mitophagy</article-title>. <source>Autophagy</source> <volume>10</volume>, <fpage>1801</fpage>&#x2013;<lpage>1813</lpage>. <pub-id pub-id-type="doi">10.4161/auto.32136</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>C. Q.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>L. S.</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>L. Y.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Lentiviral shRNA silencing of CHOP inhibits apoptosis induced by cyclic stretch in rat annular cells and attenuates disc degeneration in the rats</article-title>. <source>Apoptosis</source> <volume>16</volume>, <fpage>594</fpage>&#x2013;<lpage>605</lpage>. <pub-id pub-id-type="doi">10.1007/s10495-011-0596-y</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Teng</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2022b</year>). <article-title>Orientin downregulating oxidative stress-mediated endoplasmic reticulum stress and mitochondrial dysfunction through AMPK/SIRT1 pathway in rat nucleus pulposus cells <italic>in vitro</italic> and attenuated intervertebral disc degeneration <italic>in vivo</italic>
</article-title>. <source>Apoptosis</source> <volume>27</volume>, <fpage>1031</fpage>&#x2013;<lpage>1048</lpage>. <pub-id pub-id-type="doi">10.1007/s10495-022-01770-9</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname>
<given-names>C. Q.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>S. D.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>L. S.</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>L. Y.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Both endoplasmic reticulum and mitochondria are involved in disc cell apoptosis and intervertebral disc degeneration in rats</article-title>. <source>Age (Dordr)</source> <volume>32</volume>, <fpage>161</fpage>&#x2013;<lpage>177</lpage>. <pub-id pub-id-type="doi">10.1007/s11357-009-9121-4</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Prussian blue nanoparticles stabilize SOD1 from ubiquitination-proteasome degradation to rescue intervertebral disc degeneration</article-title>. <source>Adv. Sci. (Weinh)</source> <volume>9</volume>&#x2013;<lpage>e2105466</lpage>. <pub-id pub-id-type="doi">10.1002/advs.202105466</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>