This randomized, open-label, single-center study aimed to investigate the different drug–drug interactions between different metabolized statins and clopidogrel in patients with CI. Some research data (
Study design.
All the subjects were recruited at the Third Affiliated Hospital of Guangzhou Medical University between March 2015 and September 2017. The genic and H4 data of all the subjects were completed in May 2018. During this period, 160 patients with various types of CI, who were stable after suffering an acute CI, were recruited. The clinical diagnosis of CI was made in accordance with standards established by the World Health Organization. (
A total of 130 patients with first or second onset of acute ischemic stroke hospitalized in the Department of Neurology of the Third Affiliated Hospital of Guangzhou Medical University from March 2015 to September 2017 were selected continuously, and 98 patients (75%) were finally observed. During the observation period, 2 patients (1.5%) withdrew from the observation due to drug allergy. Thirty patients (23%) withdrew from the study due to economic burden and settlement in other places. Inclusion criteria for the ischemic stroke group were as follows: the diagnosis was confirmed by computed tomography (CT) or 3.0T magnetic resonance imaging (MRI) in accordance with the world Health Organization standards. This study was approved by the Ethics Committee of the Third Affiliated Hospital of Guangzhou Medical University, and all patients or their families signed informed consent. 1) All patients with cerebral infarction met the criteria revised by the National Cerebrovascular Disease Conference. 2) Age >45 and <85; 3) NIHSS score ≤23; 4) Platelet count >150 × 109/L and <500 × 109/L; 5) Taking clopidogrel for the first time, or taking aspirin, dipyriddamole, clopidogrel and other antiplatelet aggregation drugs before but stopping for at least 2 weeks; 6) did not take statins or had stopped taking statins for 2 weeks; 7) The patient and his/her family have informed consent and can adhere to the medication and cooperate with the visitors. Exclusion criteria 1) Patients allergic to clopidogrel, rosuvastatin and atorvastatin; 2) Patients with NIHSS score >23 or NIHSS scale problem 1A score of 2 or above are excluded; 3) Patients with atrial fibrillation and ventricular septal defect; 4) Severe damage of heart, liver and kidney function or complicated with hemorrhage, tumor, immune system, respiratory system and other diseases; 5) Patients who have recently taken a proton pump inhibitor. 6) Recent major surgery or serious external injuries; 7) Patients who cannot receive regular outpatient follow-up or patients with poor compliance.
The protocol was approved by the Ethics Committee of the Third Hospital affiliated to Guangzhou Medical University. All the participants provided written informed consent prior to participating in the study.
Blood samples were collected using the double-syringe technique, in which the first 4 ml of blood was discarded to avoid spontaneous platelet activation. The platelet function was measured using a PL-11 analyzer (SINNOWA Medical Science &Technology Co., Nanjing, China) (
Principle and method of pl-11 multiparameter platelet multifunction analyzer to detect platelet aggregation function.
Pl-11 multiparameter Platelet multifunction analyzer mainly measures Platelet aggregation function according to SPCM (continuous Counting Method). The instrument continuously counted the number of platelets in patients before and after the addition of ADP reagent, and evaluated the platelet aggregation function by comparing the change of platelet number and the rate of platelet decline before and after the addition of ADP reagent. MAR Max Aggregation Ratio (%) = (original platelet count -- number of aggregated platelets)/original platelet count ×100%.
1) Open the power button of pl-11 multiparameter platelet multifunction analyzer, and the instrument will automatically enter the state of cleaning and self-test for about one minute; After the test is complete, wait until the word “Ready” is displayed at the top of the screen to start the test. 2) Turn on the power button of the thermostatic mixer and adjust the temperature to 37°C. 3) Sample preparation: during the test, the indoor temperature should not be lower than 22°C, and the test can be started only after mixing samples with a constant temperature blender for 5–10 min, and the thermostat should be set to 25°C. New blood was extracted with 1:9 anticoagulant tube of citrate, and the test was completed within 2 h after blood collection. When transferring the sample, you need to handle it gently and do not shake it forcibly. 4) Start testing: The samples shaken by the constant temperature blender are divided into 0.5 ml sample tubes with pipette gun, and then open the sample door of the instrument and place the sample tube in the sample position. Press the instrument start button and the instrument starts to operate. The multiparameter platelet analyzer will automatically perform two platelet counts, after which the screen will appear indicating the addition of ADP attractant. At this time, the sample site door will be opened again, and 40 ul ADP attractant will be added into the sample tube with a micropipette gun. Attention should be paid to this operation: the sample tube should not be taken out to add inducer. After adding the post-inducer on the tip of the micropipette gun, it should be sucked back and forth 2–3 times to make the inducer fully mixed with the blood sample, and the tip of the micropipette gun should be kept below the blood sample when it is sucked back and forth. The preceding procedure needs to be completed within 1 min. After adding inducer, close the side door, press [OK] button, and then press no. 1 button, the instrument will automatically measure 3 times, then the instrument will automatically stop, and the test results will be displayed on the screen. When the words “Waiting for test” and “Ready” are displayed again at the top of the screen, the next test can be performed.
After admission, the patient’s gender, age, and blood pressure were recorded, and the patient’s past history, personal history, medication history and family history were carefully questioned. All patients received the National Institutes of Health Stroke Scale (NIHSS) score immediately after admission, and underwent brain CT or MRI examination on the same day. Blood routine examination, coagulation routine examination, biochemical routine examination, blood lipid routine examination, hBA1C and blood glucose examination were performed the next day. Platelet aggregation rates were evaluated before clopidogrel administration (interview 0), 1 week after clopidogrel administration (interview 1), 1 month after statin administration (interview 2), 3 months after statin administration (interview 3), and 6 months after statin administration (interview 4).
All patients were monitored with cranial magnetic resonance imaging scans and routine blood tests (platelet counts, international standardized ratios, glucose and lipid analyses). Hypertension was defined as systolic blood pressure ≥140 mmHg and/or diastolic blood pressure ≥90 mmHg, and/or the use of antihypertensive drugs. Diabetes was defined as fasting blood glucose ≥7.0 mmol/L, or hemoglobin a1c ≥ 6.0% and/or a history of diabetes. Hyperlipidemia was defined as total cholesterol ≥5.0 mmol/L and low density lipoprotein ≥3.5 mmol/L.
All subjects were genotyped for CYP3A4 receptor genes, CYP2C9, and CYP2C19. The reference sequence was found in the National Center for Biotechnology Information, and DNA was extracted from the whole blood samples with a TIANamp Blood DNA Kit (Sigma Corporation, USA) according to the manufacturer’s instructions. The primer sequences can be seen in
The primers of genes.
| Genes | Primers | Product length |
|---|---|---|
| CYP2C9*2 | F: CCCTCCTAGTTTCGTTT | |
| rs1799853 | R:GCACAATCATGCCTGTA | 376 bp |
| CYP2C9*3 | F:TGTCTTATCAGCTAAAGTCCAGG | 286 bp |
| rs1057910 | R:CCCGGTGATGGTAGAGGTTT | |
| CYP2C19*2 | F:AAAGCAGGTATAAGTC | 494 bp |
| rs4244285 | R:CATCCGTAGTAAACAC | |
| CYP2C19*3 | F:CACTTTCATCCTGGGCTGTG | 292 bp |
| rs4986893 | R:TCTTTTCCAGATATTCACCCCAT | |
| CYP3A4*3 | F:CTACTAGTTGAGGGGTGGCC | 383 bp |
| rs4986910 | R:TCTTTGGCCCAGAGAACAAA |
PCR amplification products map.
Five mL of blood was drawn from patient 1 and 6 months after clopidogrel administration into vacuum systems containing EDTA-K (Yangpu Medical Technology Company, China). Clopidogrel thiol metabolite H4 (H4) was measured by (LC-MS/MS) (
Chromatography-mass spectrometry procedures were as follows. 1)Setting of blood sample collection time: Blood samples were collected 1 month and 6 months after clopidogrel administration (75 mg or 300 mg). 2)Preparation and use of stabilizer. Preparation: alkylation agent MBP(500 mm.L-1): ethyleneglycol solution (20 ml)+MBP(2.2907 g), fully dissolved, refrigerated at 4 °C for reserve. Use: Blood + stabilizer = 200:1 (V: V), [final concentration of MBP = 2.5 mm.L-1], that is, add 25 ul of 500 mm.L-1 stabilizer MBP per 5 ml blood. 3)Specimen pretreatment (sample collection and preservation). Preliminary treatment: The blood samples with stabilizers were immediately centrifuged, 1620 4)Sample processing before machine (mass spectrometry analysis before processing). Take 25 μl of sample standard solution or supernatant of sample to be tested using EP tube, add 25 μl of internal standard solution, and mix well. Add 250 μl of blank plasma and mix well. Next, 450 μl of cold acetonitrile is added to precipitate the protein. Swirl for 5 min, then centrifuge 22570 5)Chromatographic and mass spectrometry analysis. Chromatographic conditions: Chromatographic column was Zorbax Plus C18 Column (100 mm/2.1 mm, 3.5 μm, Agilent Technologies, USA). Mobile phase was acetonitrile (containing 0.1% formic acid): water (containing 0.1% formic acid) (9:1, V/V). Washing balance was as follows: The gradient was as follows:0–7 min linear from 42 to 90% B, Return from 90 to 42%B and the post time of 5 min with 42%B for column Slides bration. The flow rate was 350 μl min−1. Sample volume was 25 μl. The column temperature was 40°C. The analysis time was 3.2 min. 6)Mass spectrometry conditions: Ion source:ESI + electrospray ionization; Detection method: positive ion mode; Scanning methods: multiple response monitoring (MRM); Spray gas: N2 (40 psi); Solvation gas: N2 (10 L/min); Solvent removal gas flow rate: 650 L h−1; Solvent temperature: 300°C; Ion source temperature: 120°C; Collision chamber gas: N2
7) preparation of mother liquor 1)Preparation of the original clopidogrel hydrogen sulfate reserve solution: weigh 1 mg clopidogrel hydrogen sulfate, add 1 ml acetonitrile to make its final concentration 1.0 mg/ml, and store in the refrigerator at −20°C for later use. 2)Preparation of active metabolic derivative of clopidogrel (MP-H4) reserve liquid: accurate respectively. Weigh 1 mg MP-H4, add 1 ml acetonitrile to make its final concentration 1.0 mg/ml, and freeze it in the refrigerator at −20°C for later use. 3)Preparation of internal standard piroxicam storage and distribution solution: weigh 1 mg piroxicam, add 1 ml acetonitrile to dissolve it, make its final concentration 1.0 mg/ml, and freeze it in the refrigerator at −20° for reserve. 8) Working fluid preparation 1)Preparation of clopidogrel hydrogen sulfate working solution (0.1 mg/ml = 100 ug/ml = 100000 ng/ml): 1.0 mg/ml mother solution diluted 10 times with L acetonitrile. 2)Preparation of clopidogrel active metabolic derivative (MP-H4) working solution (0.1 mg/ml = 100 ug/ml = 100000ng/ml): 1.0 mg/ml mother solution diluted 10 times with L acetonitrile.
Statistical analysis was performed using the SPSS version 22.0 for Windows (SPSS Inc., USA). Continuous variables, presented as means and standard deviations (mean ± SD), were tested using Student’s t test. Categorical variables were compared using the Pearson chi-square test. PAR was tested using the general linear model-repeated measurement. H4 was tested using the Sphericity Assumed. Analysis of variance (ANOVA) was used to compare platelet function and H4 changes. Correlation between the genotype and allele frequency distribution differences and the CR were analyzed using multivariate regression models. Multivariable logistic regression analysis analyzed the relationship between DCR and risk factors.