<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Pharmacol.</journal-id>
<journal-title>Frontiers in Pharmacology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Pharmacol.</abbrev-journal-title>
<issn pub-type="epub">1663-9812</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fphar.2017.00256</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Pharmacology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>SRT1720 Alleviates ANIT-Induced Cholestasis in a Mouse Model</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Yu</surname> <given-names>Linxi</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name><surname>Liu</surname> <given-names>Xiaoxin</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name><surname>Yuan</surname> <given-names>Zihang</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name><surname>Li</surname> <given-names>Xiaojiaoyang</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name><surname>Yang</surname> <given-names>Hang</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name><surname>Yuan</surname> <given-names>Ziqiao</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name><surname>Sun</surname> <given-names>Lixin</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Zhang</surname> <given-names>Luyong</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<xref ref-type="author-notes" rid="fn001"><sup>&#x002A;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/118867/overview"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Jiang</surname> <given-names>Zhengzhou</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff4"><sup>4</sup></xref>
<xref ref-type="author-notes" rid="fn001"><sup>&#x002A;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/298187/overview"/>
</contrib>
</contrib-group>
<aff id="aff1"><sup>1</sup><institution>Jiangsu Key Laboratory of Drug Screening, China Pharmaceutical University</institution> <country>Nanjing, China</country></aff>
<aff id="aff2"><sup>2</sup><institution>Jiangsu Center for Pharmacodynamics Research and Evaluation, China Pharmaceutical University</institution> <country>Nanjing, China</country></aff>
<aff id="aff3"><sup>3</sup><institution>State Key Laboratory of Natural Medicines, China Pharmaceutical University</institution> <country>Nanjing, China</country></aff>
<aff id="aff4"><sup>4</sup><institution>Key Laboratory of Drug Quality Control and Pharmacovigilance, China Pharmaceutical University &#x2013; Ministry of Education</institution> <country>Nanjing, China</country></aff>
<author-notes>
<fn fn-type="edited-by"><p>Edited by: <italic>Gaetano Cairo, Universit&#x00E0; degli Studi di Milano, Italy</italic></p></fn>
<fn fn-type="edited-by"><p>Reviewed by: <italic>Cecilia M. P. Rodrigues, Universidade de Lisboa, Portugal; Lindsey Kennedy, Texas A&#x0026;M University, USA</italic></p></fn>
<fn fn-type="corresp" id="fn001"><p>&#x002A;Correspondence: <italic>Zhengzhou Jiang, <email>beaglejiang@cpu.edu.cn</email> Luyong Zhang, <email>lyzhang@cpu.edu.cn</email></italic></p></fn>
<fn fn-type="other" id="fn002"><p>This article was submitted to Experimental Pharmacology and Drug Discovery, a section of the journal Frontiers in Pharmacology</p></fn></author-notes>
<pub-date pub-type="epub">
<day>11</day>
<month>05</month>
<year>2017</year>
</pub-date>
<pub-date pub-type="collection">
<year>2017</year>
</pub-date>
<volume>8</volume>
<elocation-id>256</elocation-id>
<history>
<date date-type="received">
<day>08</day>
<month>10</month>
<year>2016</year>
</date>
<date date-type="accepted">
<day>25</day>
<month>04</month>
<year>2017</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#x00A9; 2017 Yu, Liu, Yuan, Li, Yang, Yuan, Sun, Zhang and Jiang.</copyright-statement>
<copyright-year>2017</copyright-year>
<copyright-holder>Yu, Liu, Yuan, Li, Yang, Yuan, Sun, Zhang and Jiang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/"><p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p></license>
</permissions>
<abstract>
<p>Intrahepatic cholestasis is a kind of clinical syndrome along with hepatotoxicity which caused by intrahepatic and systemic accumulations of bile acid. There are several crucial generating factors of the pathogenesis of cholestasis, such as inflammation, dysregulation of bile acid transporters and oxidative stress. SIRT1 is regarded as a class III histone deacetylase (HDAC). According to a set of researches, SIRT1 is one of the most important factors which can regulate the hepatic bile acid metabolism. SRT1720 is a kind of activator of SIRT1 which is 1000 times more potent than resveratrol, and this paper is aimed to study its protective influence on hepatotoxicity and cholestasis induced by alpha-naphthylisothiocyanate (ANIT) in mice. The findings revealed that SRT1720 treatment increased FXR and Nrf2 gene expressions to shield against hepatotoxicity and cholestasis induced by ANIT. The mRNA levels of hepatic bile acid transporters were also altered by SRT1720. Furthermore, SRT1720 enhanced the antioxidative system by increasing Nrf2, SOD, GCLc, GCLm, Nqo1, and HO-1 gene expressions. In conclusion, a protective influence could be provided by SRT1720 to cure ANIT-induced hepatotoxicity and cholestasis, which was partly through FXR and Nrf2 activations. These results indicated that SIRT1 could be regarded as a therapeutic target to cure the cholestasis.</p>
</abstract>
<kwd-group>
<kwd>SRT1720</kwd>
<kwd>ANTI</kwd>
<kwd>cholestasis</kwd>
<kwd>FXR</kwd>
<kwd>Nrf2</kwd>
</kwd-group>
<contract-num rid="cn001">81320108029</contract-num>
<contract-num rid="cn001">81573514</contract-num>
<contract-num rid="cn001">81273604</contract-num>
<contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content></contract-sponsor>
<counts>
<fig-count count="10"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="45"/>
<page-count count="15"/>
<word-count count="0"/>
</counts>
</article-meta>
</front>
<body>
<sec><title>Introduction</title>
<p>Intrahepatic cholestasis is a kind of hepatic disease characterized by symptoms including systematic and intrahepatic accumulations of excessive bile acid. It may be caused by pregnancy, drugs, hormones, and inflammatory cytokines, or progressive bile duct destruction. And it increases the risk of hepatitis, liver cirrhosis, or other hepatic and gall-bladder diseases (<xref ref-type="bibr" rid="B39">Stone et al., 2012</xref>; <xref ref-type="bibr" rid="B14">Hirschfield et al., 2013</xref>; <xref ref-type="bibr" rid="B10">Geenes et al., 2014</xref>; <xref ref-type="bibr" rid="B16">Ji et al., 2014</xref>; <xref ref-type="bibr" rid="B30">Meng et al., 2015a</xref>). Recently, standard treatment for cholesteric diseases is limited to the use of ursodeoxycholic acid (UDCA) for primary biliary cholangitis (PBC), while there are no accepted treatments for other adult cholesteric disorders (<xref ref-type="bibr" rid="B40">Tanaka and Gershwin, 2017</xref>) Therefore, looking for new targets and developing new drugs for the treatment of cholestasis are necessary.</p>
<p>Alpha-naphthylisothiocyanate (ANIT) is a kind of chemical substance which can cause acute cholesteric liver injury in rodents. It is widely utilized because it can cause cholestasis repeatedly. A single dose of ANIT to rat can lead the impairment of bile duct epithelial cell (<xref ref-type="bibr" rid="B7">Dahm and Roth, 1991</xref>). The mechanisms of ANIT-induced liver injury are not entirely clarified. However, it has been proved that ANIT inhibited the expressions of bile acid transporters in mouse primary hepatocytes (<xref ref-type="bibr" rid="B12">Guo et al., 2014</xref>). In the liver, ANIT also significantly decreased the expressions of Mrp2 (multidrug resistance-associated protein 2), FXR (farnesoid X receptor), Ntcp (Na<sup>+</sup>-dependent taurocholate cotransporter), Bsep (bile salt export pump), and CYP7A1 (cholesterol 7&#x03B1;-hydroxylase) (<xref ref-type="bibr" rid="B43">Wang T. et al., 2014</xref>), and it has been reported that ANIT made bile duct epithelial cells produce substance which was regarded as an activator for neutrophils to hurt hepatocytes (<xref ref-type="bibr" rid="B13">Hill and Roth, 1998</xref>; <xref ref-type="bibr" rid="B20">Kobayashi et al., 2010</xref>). The lipid peroxidation caused by reactive oxygen species (ROS) was also related to the development of the liver injury that was induced by ANIT in mice (<xref ref-type="bibr" rid="B23">Kongo et al., 1999</xref>). ANIT also led to inflammatory reactions, it could increase the levels of TNF-&#x03B1; (tumor necrosis factor alpha) and IL-6 (interleukin-6) in rat livers (<xref ref-type="bibr" rid="B43">Wang T. et al., 2014</xref>). Therefore, inflammation, dysregulation of bile acid transporters and oxidative stress are important generating factors for the liver injury induced by ANIT (<xref ref-type="bibr" rid="B29">Ma et al., 2015</xref>).</p>
<p>SIRT1 is one of the important silent information regulators and it is an NAD-dependent deacetylase which can regulate a wide range of cellular processes, including inflammation, aging, and lifespan extension (<xref ref-type="bibr" rid="B5">Bordone et al., 2007</xref>). SIRT1 regulates various nuclear receptors and cofactors directly or indirectly, such as FXR, HNF1&#x03B1;, LXR, E2F1, p53, PGC-1&#x03B1;, and HSF1 (<xref ref-type="bibr" rid="B11">Gerhart-Hines et al., 2007</xref>; <xref ref-type="bibr" rid="B15">Hou et al., 2008</xref>; <xref ref-type="bibr" rid="B35">Ponugoti et al., 2010</xref>). It has been considered to be a metabolic sensor for a wide range of metabolic processes. FXR has been considered as a crucial nuclear receptor in bile acid metabolism. Hepatic SIRT1 deficiency decreased the gene expression of FXR and increased hepatic BA concentrations. It largely through lack of hepatic SIRT1 down-regulated HNF1&#x03B1; (hepatocyte nuclear factor 1&#x03B1;)-FXR signaling. HNF1&#x03B1; is a transcription factor which can bind to the promoter of FXR directly. Deficiency of SIRT1 decreased the recruitment of HNF1&#x03B1; to the promoter of FXR and decreased the FXR mRNA level along with FXR target genes such as Bsep and short heterodimer partner (Shp), as a result, transport process of phospholipids and biliary bile acid can be injured (<xref ref-type="bibr" rid="B19">Kemper et al., 2009</xref>; <xref ref-type="bibr" rid="B36">Purushotham et al., 2012</xref>; <xref ref-type="bibr" rid="B18">Kazgan et al., 2014</xref>). Therefore, liver SIRT1 can regulate FXR and is one of the most important factors which can influence the metabolism of hepatic bile acid, and it has been reported that SRT1720 can treat the cholesteric liver injury in a mice model of cholestasis (<xref ref-type="bibr" rid="B24">Kulkarni et al., 2016</xref>).</p>
<p>Nrf2 (nuclear factor erythroid 2-related factor 2), a transcription factor, seems to be a sensor to regulate various antioxidative stress genes expressions (<xref ref-type="bibr" rid="B44">Xu et al., 2008</xref>). Emerging evidence has shown that the Nrf2/ARE (antioxidant response element) antioxidant pathway is important in ANTI-induced cholestasis and liver injury (<xref ref-type="bibr" rid="B29">Ma et al., 2015</xref>). SIRT1 can increase Nrf2 protein expression and enhance gene expressions of its downstream genes: SOD and HO-1. Furthermore, through regulating the Nrf2 deacetylation function, SIRT1 can improve Nrf2 stability. Therefore, SIRT1 could help cells to avoid oxidative stress-induced injury through active Nrf2 and its downstream gene expressions (<xref ref-type="bibr" rid="B45">Xue et al., 2016</xref>).</p>
<p>Taken together, SIRT1 is associated with the activations of FXR and Nrf2. Therefore, we speculate that SIRT1 is a therapeutic target for the cholestasis treatment. To verify our hypothesis, SRT1720, a specific activator of SIRT1, was chosen. The compound is attached to the SIRT1 enzyme-peptide substrate composition at an allosteric site which is at the end of an amino acid with catalyst; it decreases the Michaelis constant for substrates that are acetylated. Under certain circumstances, such as when mice are obese, the compound increases the sensitive for insulin and the capacity of mitochondrion, and decreases plasma glucose level. It is 1000 times more potent than resveratrol. In fact, resveratrol is not a unique activator for SIRT1 (<xref ref-type="bibr" rid="B32">Milne et al., 2007</xref>; <xref ref-type="bibr" rid="B38">Smith et al., 2009</xref>).</p>
<p>Although SIRT1 could modulate bile acid metabolism, it was not confirmed whether its activator could reverse ANIT-induced cholestasis and liver injury. The aim of this study was to investigate whether oral administration of SRT1720, the activator of SIRT1, could alleviate ANIT-induced cholestasis and hepatotoxicity in mice. Additionally, the potential mechanisms would be studied <italic>in vivo</italic> and <italic>in vitro</italic> experiments.</p>
</sec>
<sec id="s1" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec><title>Chemical Drugs</title>
<p>ANIT (purity >98%) has been collected from Sigma&#x2013;Aldrich Co. (St Louis, MO, USA). SRT1720 was purchased from Medscheme Express Co., Ltd. (Princeton, NJ, USA). Serum alanine-transaminase (ALT), alkaline phosphatase (ALP), total bile acid (TBA), aspartate transaminase (AST), complete bilirubin (TBIL), and gamma-glutamyl transferees (&#x03B3;-GGT) had been analyzed utilizing commercial kits in accordance with the protocols provided by manufacturers (Whitman Biotech, Nanjing, China). Antibodies to BSEP (sc-74500), MRP2 (sc-5770), and HNF1&#x03B1; (sc-135939) were provided by Santa Cruz Biotechnology Inc. (Dallas, TX, USA). Antibody to FXR (bs-12867R) was obtained from Bioss Biotechnology (Bioss, Beijing, China).</p>
</sec>
<sec><title>Experimental Animals and Drug Therapy</title>
<p>Female C57BL/6 mice (8&#x2013;9 weeks old) had been procured from SIPPR-BK Laboratory Animal Enterprise (Shanghai, China), and they were put in the 12-hour dark/light cycle. All of the mice had been sheltered in the conditions where there was not germ with constant humidity and controlled temperature (24&#x00B0;C &#x00B1; 2&#x00B0;C). The mice were provided with free liquid and normal food. Previous to the tests, the mice had been acclimated to the laboratory environment for 1 week. Animal Ethics Council of China Pharmaceutical University has given permission to all animal treatment and proceedings. The tests were implemented in accordance with the Declaration of Helsinki. SRT1720 was prepared in in 0.5% CMC-Na suspension. ANIT was dissolved in olive oil. Mice had been divided into four groups casually (<italic>n</italic> = 6): (1) control group, in which mice were treated with 0.2% carboxymethylcellulose solution (ip) for 5 days; (2) ANIT group, in which the mice took 50 mg/kg dose of ANIT orally, at 48h before sacrifice; (3) ANIT+ SRT1720 (10 mg/kg), in which mice were given SRT1720 (10 mg/kg, ip) for five days; on the 3rd day, 4 h after SRT1720 or excipient medication, mice took ANIT (50 mg/kg) orally for 48h; (4) ANIT+SRT1720 (20 mg/kg), in which mice were treated with SRT1720 (20 mg/kg, ip) for 5 days; on the 3rd day, 4 h after SRT1720 or excipient medication, mice took ANIT (50 mg/kg) orally for 48 h. On the fifth day, 4 h after SRT1720 (10 mg/kg, 20 mg/kg) and vehicle treatment, mice were sacrificed to collect livers and blood. The protocol for the other animal experiment was as below. Mice had been divided into four groups casually (<italic>n</italic> = 6): (1) control group, in which mice were treated with 0.2% carboxymethylcellulose solution (ip) for 5 days; (2) ANIT group, in which the mice took 50 mg/kg dose of ANIT orally, at 24 h before sacrifice; (3) ANIT+ SRT1720 (10 mg/kg), in which mice were given SRT1720 (10 mg/kg, ip) for 5 days; on the 4th day, 4 h after SRT1720, or excipient medication, mice took ANIT (50 mg/kg) orally for 24 h; (4) ANIT+SRT1720 (20 mg/kg), in which mice were treated with SRT1720 (20 mg/kg, ip) for 5 days; on the 4th day, 4 h after SRT1720 or excipient medication, mice took ANIT (50 mg/kg) orally for 24 h. On the 5th day, 4 h after SRT1720 (10 mg/kg, 20 mg/kg) and vehicle treatment, mice were sacrificed to collect livers and blood.</p>
<p>The blood had been gathered in the tubes with no anticoagulation and centrifuged at room temperature to obtain serum. Livers had been put in the 10% formaldehyde solution.</p>
</sec>
<sec><title>Serum and Liver Biochemistry Analysis</title>
<p>After sacrificed, blood of mice was centrifuged for serum and 50 mg liver tissue was collected to homogenize in RIPA buffer. ALT, ALP, AST, TBA, TBIL, and &#x03B3;-GGT in mice serum were measured by corresponding commercial kits in accordance with the producer&#x2019;s protocols (Whitman Biotech, Nanjing, China). Liver samples were homogenization with RIPA buffer to measure the content of bile acid. The bile acid in supernant after centrifugation had been analyzed utilizing a commercial kit (Whitman Biotech) in accordance with the protocol. The results were normalized with total protein concentrations which were evaluated by BCA protein assay Kit (Beyotime, Shanghai, China). The results obtained were the mean of six different animal livers.</p>
</sec>
<sec><title>Histopathological Evaluations</title>
<p>After scarified, small pieces of mice livers were collected and directly put in the 10% formaldehyde solution, then inserted in paraffin and sliced to 6 &#x03BC;m slices. All slices were stained with H&#x0026;E for necrotic and hepatocyte degeneration variations. Images were captured with the microscope (Olympus IX81). Then pathology assessments were performed by a professional pathologist (Wenxia Bai, Jiangsu Medicine Institute, Nanjing, China).</p>
</sec>
<sec><title>Quantitative Real-Time Polymerase Chain Reaction</title>
<p>For animal experiment, 50 mg liver tissue was prepared from each mouse. TRIzol agent (Invitrogen Life Technologies, Carlsbad, USA) had been utilized to isolate entire RNA from liver. Then 2 &#x03BC;g of entire RNA was reversed into cDNA by Prime Script RT reagent (Takara, Osaka, Japan). QPCR had been implemented with SYBR PCR Master Mix (Takara, Osaka, Japan) with specific PCR primers (<bold>Table <xref ref-type="table" rid="T1">1</xref></bold>), and reports were generated on IQTM5 Optical System Software (Version 2.1, Bio-Rad). &#x03B2;-actin had been normalized as an internal control. Primers set for the HNF1&#x03B1;, FXR, Ntcp, Oatp1b2, Bsep, Mrp2, Mrp3, Mrp4, Cyp7A1, Shp, Nrf2, SOD, GCLc, GCLm, HO-1, and Nqo1 genes are shown in <bold>Table <xref ref-type="table" rid="T1">1</xref></bold>.</p>
<table-wrap position="float" id="T1">
<label>Table 1</label>
<caption><p>The primer sequences used for real-time PCR assay in mice.</p></caption>
<table cellspacing="5" cellpadding="5" frame="hsides" rules="groups">
<thead>
<tr>
<th valign="top" align="left">Gene</th>
<th valign="top" align="center">Forward primer (5&#x2032;&#x2013;3&#x2032;)</th>
<th valign="top" align="center">Reverse primer (5&#x2032;&#x2013;3&#x2032;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">HNF1&#x03B1;</td>
<td valign="top" align="left">GACCTGACCGAGTTGCCTAAT</td>
<td valign="top" align="left">CCGGCTCTTTCAGAATGGGT</td></tr>
<tr>
<td valign="top" align="left">FXR</td>
<td valign="top" align="left">GCTTGATGTGCTACAAAAGCTG</td>
<td valign="top" align="left">CGTGGTGATGGTTGAATGTCC</td>
</tr>
<tr>
<td valign="top" align="left">Ntcp</td>
<td valign="top" align="left">GCATGATGCCACTCCTCTTATAC</td>
<td valign="top" align="left">TACATAGTGTGGCCTTTTGGACT</td>
</tr>
<tr>
<td valign="top" align="left">Oatp1b2</td>
<td valign="top" align="left">GGGAACATGCTTCGTGGGATA</td>
<td valign="top" align="left">GGAGTTATGCGGACACTTCTC</td>
</tr>
<tr>
<td valign="top" align="left">Bsep</td>
<td valign="top" align="left">AGCAGGCTCAGCTGCATGAC</td>
<td valign="top" align="left">AATGGCCCGAGCAATAGCAA</td>
</tr>
<tr>
<td valign="top" align="left">Mrp2</td>
<td valign="top" align="left">AACTGCCTCTTCAGAATCTTA</td>
<td valign="top" align="left">GCCAGCCACGGAACCAGCTGCT</td>
</tr>
<tr>
<td valign="top" align="left">Mrp3</td>
<td valign="top" align="left">CTGGGTCCCCTGCATCTAC</td>
<td valign="top" align="left">GCCGTCTTGAGCCTGGATAAC</td>
</tr>
<tr>
<td valign="top" align="left">Mrp4</td>
<td valign="top" align="left">CATCGCGGTAACCGTCCTC</td>
<td valign="top" align="left">CCGCAGTTTTACTCCGCAG</td>
</tr>
<tr>
<td valign="top" align="left">Cyp7A1</td>
<td valign="top" align="left">CAAGAACCTGTACATGAGGGAC</td>
<td valign="top" align="left">CACTTCTTCAGAGGCTGCTTTC</td>
</tr>
<tr>
<td valign="top" align="left">Shp</td>
<td valign="top" align="left">CCCCTATCTCTCAGTACACATGG</td>
<td valign="top" align="left">GACCATAAGGAGGACAAAGGTCT</td>
</tr>
<tr>
<td valign="top" align="left">Nrf2</td>
<td valign="top" align="left">TCTTGGAGTAAGTCGAGAAGTGT</td>
<td valign="top" align="left">GTTGAAACTGAGCGAAAAAGGC</td></tr>
<tr>
<td valign="top" align="left">SOD</td>
<td valign="top" align="left">GCCCGCTAAGTGCTGAGTC</td>
<td valign="top" align="left">CCAGAAGGATAACGGATGCCA</td>
</tr>
<tr>
<td valign="top" align="left">GCLm</td>
<td valign="top" align="left">AGGAGCTTCGGGACTGTATCC</td>
<td valign="top" align="left">GGGACATGGTGCATTCCAAAA</td></tr>
<tr>
<td valign="top" align="left">GCLc</td>
<td valign="top" align="left">GGGGTGACGAGGTGGAGTA</td>
<td valign="top" align="left">GTTGGGGTTTGTCCTCTCCC</td>
</tr>
<tr>
<td valign="top" align="left">Nqo1</td>
<td valign="top" align="left">ATGGGAGGTGGTCGAATCTGA</td>
<td valign="top" align="left">GCCTTCCTTATACGCCAGAGATG</td>
</tr>
<tr>
<td valign="top" align="left">HO-1</td>
<td valign="top" align="left">AAGCCGAGAATGCTGAGTTCA</td>
<td valign="top" align="left">GCCGTGTAGATATGGTACAAGGA</td></tr>
<tr>
<td valign="top" align="left">&#x03B2;-actin</td>
<td valign="top" align="left">TATTGGCAACGAGCGGTTC</td>
<td valign="top" align="left">ATGCCACAGGATTCCATACCC</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec><title>Western Blot Analysis</title>
<p>A total protein extraction kit (KeyGEN Biotech) had been used to extract liver protein. The level of the protein was evaluated by the BCA protein assay Kit (Beyotime Biotech, Shanghai, China). Fifty microgram protein was added to the each hole of SDS-PAGE gel (10%) and then removed to PVDF membranes. After being blocked with 5% skimmed milk for 1 h, the membranes were further incubated with special antibodies (FXR, Bsep, Mrp2, HNF1&#x03B1;, and GAPDH) overnight at 4&#x00B0;C. After rinsed three times with TBST, membranes were incubated with second antibodies at room temperature for 1 h. Then Bio-Rad Imaging System (Bio-Rad, Hercules, CA, USA) was used to detect certain bands with ECL reagents (Thermo, Waltham, MA, USA).</p>
</sec>
<sec><title>Immunofluorescent Staining</title>
<p>Cut the liver tissue into appropriate size, and fixed them on the frozen embedding mold utilizing O.T.C embedding agent. Adjusted the parameters of frozen slicer and started to cut liver tissue. The thickness of the slice is about 6 &#x03BC;M. Then placed slices on APES treated slides. 30 min later, the slices had been put inside formaldehyde solution (4%) for 30 min and were penetrated with Triton X-100 (0.1%) for 15 mins. Then, slices were blocking with 5% BSA for 1 h to block non-specific binding and incubated with different antibodies, placed in humidified atmosphere during the night at the temperature of 4&#x00B0;C. The antibodies adopted in the research were Bsep and Mrp2. The slices were then wished with phosphate-buffered saline (PBS) for three times and incubated with secondary antibodies for 1 h. Finally, DAPI had been utilized for nuclear staining. After that, images were obtained from Olympus IX81 motorized inverted fluorescence microscope and analyzed by Image-Pro plus 10.0 software.</p>
</sec>
<sec><title>Isolation and Sandwich Cultivation of Mice Primary Hepatocytes</title>
<p>After anesthetized, C57BL/6 mouse primary hepatocytes had been isolated by a two-step collagenase digestion method (<xref ref-type="bibr" rid="B30">Meng et al., 2015a</xref>). The isolated hepatocytes were collected and resuspended with William&#x2019;s E medium (Invitrogen, Carlsbad, CA, USA) with penethamate (100 U/mL), streptomycin (100 U/mL), dexamethasone (0.1 mM), and thyroxine (1 mM). Then, hepatocytes were seeded into collagen type I (Sigma, St. Louis, MO, USA) pre-coated cell culture dishes. After 24 h incubation, hepatocytes were coated with collagen I solution and then cultivated in complete medium to achieve sandwich culture model (<xref ref-type="bibr" rid="B26">Li et al., 2016</xref>).</p>
</sec>
<sec><title>RNA Silencing Experiments</title>
<p>Mouse primary hepatocytes had been transiently transfected with siRNA which targeting mouse HNF1&#x03B1; (sc-35568) or a negative control siRNA utilizing Lipofectamine<sup>TM</sup> 3000 (Invitrogen, Carlsbad, CA, USA). Seven hours later, medium had been changed with fresh medium. After 48 h, DMSO or SRT1720 (10 &#x03BC;M) had been added to the cell culture medium for 12 h. Then, primary hepatocytes cells were collected for further QPCR experiment.</p>
</sec>
<sec><title>Liver Enzymes Assays</title>
<p>Mouse livers had been homogeneous with ice-cold 0.9% normal saline and the slurry was centrifuged at 4&#x00B0;C (3500 rpm/min), then supernatant had been utilized for hepatic enzymes assays. The levels of IL-6, TNF-&#x03B1;, and myeloperoxidase (MPO) activity in supernatant had been measured to evaluate inflammatory reactions and neutrophil activation in livers. The IL-6 and TNF-&#x03B1; levels were measured by ELISA kits (UNIV-bio, Shanghai, China). MPO activity was measured by a commercial assay kit (Jian cheng Bio-engineering Institution, Nanjing, China). The activities of entire antioxidant capacity (T-AOC), glutathione (GSH), malondialdehyde (MDA), and superoxide dismutase (SOD) had been determined to access the oxidant state in the hepatic constitution. Liver T-AOC, GSH, SOD, and MDA activities had been measured by their respective assay kit (Jian cheng Bioengineering Institute, Nanjing, China).</p>
</sec>
<sec><title>Statistical Analysis</title>
<p>Statistics are processed with a software called Graphpad Prism (5th version) (Graph-Pad, La Jolla, CA, USA) and are shown as the mean &#x00B1; SD. Through utilizing one-way variance analysis, the significance of the statistic from multiple groups is determined. The data is considered statistically significant when <italic>P</italic> &#x003C; 0.05.</p>
</sec>
</sec>
<sec><title>Results</title>
<sec><title>Protective Effects of SRT1720 on Cholestasis and Hepatotoxicity Induced by ANIT</title>
<p>To determine whether SRT1720 could reverse mice cholestatic liver injury induced by ANIT, C57BL/6 mice were treated with ANIT, 0.2% CMC-Na, or SRT1720 (10 mg/kg or 20 mg/kg) for 5 days. The SRT1720 chemical structure was showed in <bold>Figure <xref ref-type="fig" rid="F1">1</xref></bold>. Biochemical indicators in mice intraperitoneal administered vehicle, with 10 or 20 mg/kg of SRT1720, were evaluated 24 or 48 h later after taking ANIT. Taking ANIT led to the damage in the liver which was demonstrated by the remarkable increase in the serum AST and ALT expressions compared with control group. Upon SRT1720 treatment, plasma AST and ALT levels remarkably lessened by 70% compared with ANIT-treated group (<bold>Figures <xref ref-type="fig" rid="F2">2A,B</xref></bold>). ALP is produced by osteoblasts, absorbed by the liver, and then secreted through the bile acid. The level of plasma ALP will increase significantly during cholestasis. The &#x03B3;-GGT is mainly distributed in the liver and intrahepatic bile duct epithelium, when cholestasis, this enzyme may countercurrent into the blood. ANIT administration remarkably increased the plasma levels of ALP and &#x03B3;-GGT and SRT1720 remarkably reduced them compared to ANIT-treated group (<bold>Figures <xref ref-type="fig" rid="F2">2C</xref>&#x2013;<xref ref-type="fig" rid="F2">D</xref></bold>). Furthermore, SRT1720 dosage dependently reversed ANIT-induced increases in, TBA total bilirubin and hepatic TBA (<bold>Figures <xref ref-type="fig" rid="F2">2E</xref>&#x2013;<xref ref-type="fig" rid="F2">G</xref></bold>). ANIT reduced bile acid output at 24 h after administration, and SRT1720 remarkably attenuated this variation (<bold>Figure <xref ref-type="fig" rid="F2">2H</xref></bold>). Because all of the biochemical indicators of hepatobiliary injury were observed to be higher at 48 h than 24 h after ANIT administration, the 48 h time point had been selected for the subsequent studies. The H&#x0026;E staining results demonstrated that SRT1720 treatment remarkably attenuated ANIT-induced degenerative changes and necrotic foci in the livers (<bold>Figure <xref ref-type="fig" rid="F3">3</xref></bold>), which further demonstrated protective effects of SRT1720 on liver damage which induced by ANIT. In conclusion, all these results above demonstrated that SRT1720 could provide remarkable protective effects on cholestasis and hepatotoxicity induced by ANIT.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption><p><bold>The chemical structure of SRT1720</bold>.</p></caption>
<graphic xlink:href="fphar-08-00256-g001.tif"/>
</fig>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption><p><bold>Protective effects of SRT1720 on cholestasis and hepatotoxicity induced by alpha-naphthylisothiocyanate (ANIT).</bold> Biochemical indicators in mice treated with vehicle or, 10 or, 20 mg/kg of SRT1720, were determined at the time points of 24 and 48 h after ANIT or vehicle administration. <bold>(A)</bold> Serum ALT, <bold>(B)</bold> AST, <bold>(C)</bold> ALP, and <bold>(D)</bold> &#x03B3;-GGT activity, as well as <bold>(E)</bold> serum total bilirubin, <bold>(F)</bold> serum total bile acid (TBA), and <bold>(G)</bold> hepatic TBA. <bold>(H)</bold> Bile acid output decreased in mice due to ANIT and was significantly ameliorated in SRT1720-treated mice. Data are the mean &#x00B1; SD (<italic>n</italic> = 6). <sup>&#x2217;</sup><italic>P</italic> &#x003C; 0.05 versus vehicle; <sup>#</sup><italic>P</italic> &#x003C; 0.05 versus vehicle +ANIT.</p></caption>
<graphic xlink:href="fphar-08-00256-g002.tif"/>
</fig>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption><p><bold>SRT1720 attenuated liver injury induced by ANIT in mice.</bold> Images of H&#x0026;E stained liver sections (200&#x00D7; magnification) at 48 h after ANIT administration were shown. <bold>(A)</bold> Vehicle: no histological change was observed; ANIT: necrotic and degenerative changes were observed. SRT1720 10mg/kg+ANIT: small necrotic and degenerative changes were observed; SRT1720 20 mg/kg+ANIT: small degenerative changes were observed. Areas of severe liver necrosis were marked by triangle arrows, and degenerative changes were marked by normal arrows. <bold>(B)</bold> Graph showed the quantitative analysis of necrotic lesions and degenerative changes. Data are the mean &#x00B1; SD (<italic>n</italic> = 6). <sup>&#x2217;</sup><italic>P</italic> &#x003C; 0.05 versus vehicle; <sup>#</sup><italic>P</italic> &#x003C; 0.05 versus vehicle +ANIT.</p></caption>
<graphic xlink:href="fphar-08-00256-g003.tif"/>
</fig>
</sec>
<sec><title>SRT1720 Altered mRNA Levels of Bile Acid Transporters</title>
<p>To explain the potential mechanisms of SRT1720 hepatoprotective effects, the gene expressions of bile acid transporters had been evaluated by real-time PCR. First, we determined the expressions of HNF1&#x03B1; and FXR, both of which are important nuclear receptors to regulate systemic bile acid metabolism. The gene expressions of HNF1&#x03B1; and FXR were reduced by 65 and 56%, respectively, following ANIT administration. SRT1720 treatment increased the mRNA levels of HNF1&#x03B1; and FXR (<bold>Figure <xref ref-type="fig" rid="F4">4A</xref></bold>). Just like illustrated in <bold>Figure <xref ref-type="fig" rid="F4">4B</xref></bold>, ANIT caused a decrease in the gene expressions of Ntcp and Oatp1b2, and SRT1720 treatment enhanced both of them. Then, we examined the gene expressions of Bsep and Mrp2. <bold>Figure <xref ref-type="fig" rid="F4">4C</xref></bold> showed that ANIT reduced the expressions of Bsep and Mrp2 remarkably and SRT1720 treatment increased their expressions. <bold>Figure <xref ref-type="fig" rid="F4">4D</xref></bold> illustrated that the mRNA level of Mrp3 showed a 1.5-fold increase, while SRT1720 demonstrated no effect at all. The mRNA expression of Mrp4 was reduced by ANIT, and SRT1720 increased its gene expression. Together, the above results suggested that ANIT remarkably decreased the expressions of HNF1&#x03B1;, FXR, Ntcp, Oatp1b2, Bsep, Mrp2, and Mrp4, which aligns with the findings of a previous research (<xref ref-type="bibr" rid="B43">Wang T. et al., 2014</xref>). SRT1720 treatment restored the expressions of HNF1&#x03B1;, FXR, Ntcp, Oatp1b2, Bsep, Mrp2, and Mrp4, which caused an increase of bile acid efflux and influx in the liver. However, SRT1720 did not have remarkable effect on Mrp3 expression.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption><p><bold>SRT1720 altered the gene expressions of hepatic transporters involved in bile acid transport in mice total livers.</bold> Quantitative real-time PCR analysis was performed to measure the gene expression levels <bold>(A)</bold> HNF1&#x03B1; and FXR, <bold>(B)</bold> Ntcp and Oatp1b2, <bold>(C)</bold> Bsep and Mrp2, <bold>(D)</bold> Mrp3 and Mrp4, <bold>(E)</bold> Cyp7A1 and Shp. Data are the mean &#x00B1; SD (<italic>n</italic> = 6). <sup>&#x2217;</sup><italic>P</italic> &#x003C; 0.05 versus vehicle; <sup>#</sup><italic>P</italic> &#x003C; 0.05 versus vehicle +ANIT.</p></caption>
<graphic xlink:href="fphar-08-00256-g004.tif"/>
</fig>
</sec>
<sec><title>SRT1720 Altered the mRNA Level of Cyp7a1</title>
<p>In addition to the transporters mentioned before, bile acid synthetic enzymes are also included in bile acid homeostasis. In order to further analyze the hepatoprotective effects of SRT1720, we examined the mRNA expression of Cyp7a1, the enzyme in bile acid synthesis that limits the reaction rate. As illustrated in <bold>Figure <xref ref-type="fig" rid="F4">4E</xref></bold>, the mRNA level of Cyp7a1 was decreased in ANIT group compared with control group. And SRT1720 therapy further decreased mRNA level of Cyp7a1. We then examined the mRNA level of Shp which is its upstream gene. Shp activation has been demonstrated to restrain Cyp7a1 transcriptionally (<xref ref-type="bibr" rid="B22">Kong et al., 2012b</xref>). SRT1720 treatment increased the mRNA level of Shp (<bold>Figure <xref ref-type="fig" rid="F4">4E</xref></bold>). These findings suggested that the inhibition of Cyp7a1 by SRT1720 could be mediated by FXR-Shp signaling pathway.</p>
</sec>
<sec><title>SRT1720 Regulated Bile Acid Detoxifying Enzymes</title>
<p>Phase I enzymes like Cyp2b10 and Cyp3a11, and phase II enzymes like UDP-glucuronosyltransferase 1a1 (Ugt1a1) and sulfotransferase 2a1 (Sult2a1) are bile acid detoxifying enzymes in the liver. As shown in <bold>Figure <xref ref-type="fig" rid="F5">5A</xref></bold>, ANIT increased the mRNA levels of Cyp3a11 and Cyp2b10, and SRT1720 increased Cyp2b10 mRNA level further. ANIT decreased mRNA levels of Sult2a1 and Ugt1a1, and SRT1720 caused an increase in the mRNA expression of Sult2a1 (<bold>Figure <xref ref-type="fig" rid="F5">5B</xref></bold>). These results indicated that mRNA levels of bile acid detoxifying enzymes could be enhanced by SRT1720 compared with ANIT group.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption><p><bold>SRT1720 altered the gene expressions of hepatic enzymes involved in bile acid metabolism in mice total livers. (A)</bold> Bile acid metabolizing enzymes, including the phase I enzymes Cyp3a11 and Cyp2b10 were shown. <bold>(B)</bold> Bile acid metabolizing enzymes, including the phase II enzymes Ugt1a1 and Sult2a1, were shown. Data are the mean &#x00B1; SD (<italic>n</italic> = 6). <sup>&#x2217;</sup><italic>P</italic> &#x003C; 0.05 versus vehicle; <sup>#</sup><italic>P</italic> &#x003C; 0.05 versus vehicle +ANIT.</p></caption>
<graphic xlink:href="fphar-08-00256-g005.tif"/>
</fig>
</sec>
<sec><title>SRT1720 Up-regulated the Protein Levels of Bsep, Mrp2, and FXR in Mice</title>
<p>To check Real-time PCR results, western blotting method was used to evaluate the protein expressions of Bsep, Mrp2, and FXR. <bold>Figures <xref ref-type="fig" rid="F6">6A,B</xref></bold> indicated that ANIT caused decreases of protein expressions of Bsep, Mrp2, and FXR, and a 20 mg/kg SRT1720 treatment caused an increase in these levels. <bold>Figures <xref ref-type="fig" rid="F6">6C,D</xref></bold> showed that fluorescence intensities of Bsep and Mrp2 in cytomembranes were remarkably decreased by ANIT, which suggested that bile acid transporters were impaired by ANIT. SRT1720 increased fluorescence intensities of Bsep and Mrp2 in cytomembranes remarkable.</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption><p><bold>SRT1720 restored the protein expressions of FXR, Bsep, and Mrp2 in mice total livers. (A)</bold> Western blot analysis was used to measure FXR, Bsep, and Mrp2 expressions. <bold>(B)</bold> Specific band intensity was quantified, normalized to GAPDH. <bold>(C)</bold> Immunofluorescence staining of frozen liver sections showing Bsep and Mrp2 expressions. <bold>(D)</bold> Fluorescent intensities of Bsep and Mrp2 were measured by Image-Pro Plus software.</p></caption>
<graphic xlink:href="fphar-08-00256-g006.tif"/>
</fig>
</sec>
<sec><title>SRT1720 Up-regulated the Expressions of FXR Target Genes <italic>In Vitro</italic></title>
<p>To determine whether SRT1720 could regulate the expressions of FXR and its downstream genes <italic>in vitro</italic>, FXR, Bsep and Mrp2 mRNA levels were quantified in mouse primary hepatocytes which treated with different concentrations of SRT1720. SRT1720 was incubated with ANIT for 24 h, as shown in <bold>Figures <xref ref-type="fig" rid="F7">7A,B</xref></bold>, in control cells, Bsep staining was localized in thin continuous lines outlining the cells, and after treatment with ANIT for 24 h, the fluorescence intensity of BSEP was decreased, and SRT1720 increased Bsep fluorescence intensity compared with the cells treated with ANIT, which suggested that the inhibitory effects of ANIT could be improved by SRT1720. As shown in <bold>Figure <xref ref-type="fig" rid="F7">7C</xref></bold>, SRT1720 was incubated with ANIT for 12 h, ANIT inhibited FXR, Bsep and Mrp2 expressions at the mRNA level, and SRT1720 increased all of them. To determine the potential mechanism of SRT1720 mediated activation of FXR, HNF1&#x03B1; gene silencing experiment was performed <italic>in vitro</italic>. The protein expression of HNF1&#x03B1; had been evaluated by western blot analysis after transfected with HNF1&#x03B1; siRNA and a control siRNA (<bold>Figure <xref ref-type="fig" rid="F7">7D</xref></bold>). <bold>Figure <xref ref-type="fig" rid="F7">7E</xref></bold> revealed that SRT1720 increased the mRNA level of FXR in normal mouse primary hepatocytes and it had no effect on it in HNF1&#x03B1; deficiency mouse primary hepatocytes (<bold>Figure <xref ref-type="fig" rid="F7">7E</xref></bold>). These results demonstrated that SRT1720 mediated activation of FXR was largely through HNF1&#x03B1;.</p>
<fig id="F7" position="float">
<label>FIGURE 7</label>
<caption><p><bold>Effects of SRT1720 on FXR, Bsep, and Mrp2 expressions <italic>in vitro</italic>. (A)</bold> Immunofluorescence was used to investigate the effects of SRT1720 on Bsep; after treatment with ANIT for 24 h, Bsep decreased in fluorescence intensity, and SRT1720 (5 &#x03BC;M, 10 &#x03BC;M) induced up-regulation of Bsep, which was observed compared with groups treated with ANIT. <bold>(B)</bold> Fluorescent intensity of Bsep was measured by Image-Pro Plus software. <bold>(C)</bold> Mouse primary hepatocytes were treated with ANIT (40 &#x03BC;M), and SRT1720 (5 &#x03BC;M, 10 &#x03BC;M); ANIT inhibited FXR, Bsep, and Mrp2 expression at the mRNA level, and SRT1720 increased all of them. <bold>(D)</bold> HNF1&#x03B1; silencing efficiency was measured by Western blot. <bold>(E)</bold> HNF1&#x03B1; silencing abrogated the regulation of FXR by SRT1720 (10 &#x03BC;M) in mice primary hepatocytes. <sup>&#x2217;</sup><italic>P</italic> &#x003C; 0.05 versus DMSO alone; <sup>#</sup><italic>P</italic> &#x003C; 0.05 versus SRT1720 alone.</p></caption>
<graphic xlink:href="fphar-08-00256-g007.tif"/>
</fig>
</sec>
<sec><title>Effects of SRT1720 on Hepatic MDA, GSH, T-AOC, and SOD Activities</title>
<p><bold>Figure <xref ref-type="fig" rid="F8">8A</xref></bold> revealed that the activities of hepatic T-AOC, SOD, and GSH in the livers were significantly inhibited by ANIT, which suggested that ANIT could cause antioxidant defense systems disruption in the liver. Comparatively, activities of T-AOC, SOD, and GSH could be restored by SRT1720 at 10 mg/kg and 20 mg/kg, respectively (<bold>Figure <xref ref-type="fig" rid="F8">8A</xref></bold>). Forty-eight hours after ANIT-treatment, hepatic MDA level increased notably in the group with ANIT treatment compared with the control group. And both doses of SRT1720 significantly decreased MDA concentrations (<bold>Figure <xref ref-type="fig" rid="F8">8A</xref></bold>). Taken together, SRT1720 exerted an antioxidant effect on ANIT-induced hepatotoxicity and cholestasis.</p>
<fig id="F8" position="float">
<label>FIGURE 8</label>
<caption><p><bold>Effects of SRT1720 on antioxidant system and inflammatory factors <italic>in vivo</italic>. (A)</bold> Effects of SRT1720 on hepatic T-AOC, SOD, GSH, and MDA activities at 48 h after ANIT administration in mice. <bold>(B)</bold> Effects of SRT1720 on MPO activity, TNF-&#x03B1; and IL-6 levels at 48 h after ANIT administration in mice. Data are the mean &#x00B1; SD (<italic>n</italic> = 6). <sup>&#x2217;</sup><italic>P</italic> &#x003C; 0.05 versus vehicle; <sup>#</sup><italic>P</italic> &#x003C; 0.05 versus vehicle +ANIT.</p></caption>
<graphic xlink:href="fphar-08-00256-g008.tif"/>
</fig>
</sec>
<sec><title>Effects of SRT1720 on Hepatic Inflammatory Cytokines and MPO Activity</title>
<p>Forty-eight hours later, the hepatic MPO activity in the control group was lower than the group with ANIT treatment. And SRT1720 dose-dependently inhibited MPO activity that was induced by ANIT (<bold>Figure <xref ref-type="fig" rid="F8">8B</xref></bold>). This was further confirmed by the Immunohistochemical staining of MPO (Supplementary Figure <xref ref-type="supplementary-material" rid="SM1">S1A</xref>). Multiple reports demonstrated that inflammatory reaction was related to cholestasis and SRT1720 could alleviate inflammatory reaction. ANIT increased the levels of TNF-&#x03B1; and IL-6 at 48 h and SRT1720 caused a decrease in the concentrations of TNF-&#x03B1; and IL-6. The results revealed that SRT1720 has an anti-inflammatory effect in ANIT-treated mice (<bold>Figure <xref ref-type="fig" rid="F8">8B</xref></bold>).</p>
</sec>
<sec><title>SRT1720 Up-regulated the Expressions of Nrf2 Target Genes</title>
<p><bold>Figure <xref ref-type="fig" rid="F9">9</xref></bold> revealed that mRNA levels of Nrf2 and its target genes were increased by SRT1720 in ANIT-treated group dose-dependently. The mRNA levels Nrf2, GCLc, GCLm, and SOD were significantly decreased by ANIT at 48 h and SRT1720 up-regulated the expressions of Nrf2 and its target genes dose-dependently (<bold>Figures <xref ref-type="fig" rid="F9">9A</xref>&#x2013;<xref ref-type="fig" rid="F9">D</xref></bold>). ANIT did not inhibit expressions of HO-1 and Nqo1, and SRT1720 increased their mRNA levels dose-dependently (<bold>Figures <xref ref-type="fig" rid="F9">9E,F</xref></bold>). Taken together, these results clearly demonstrated that SRT1720 exerted an anti-oxidation effect through activating the Nfr2/ARE pathway in ANIT-treated mice (<bold>Figure <xref ref-type="fig" rid="F9">9</xref></bold>).</p>
<fig id="F9" position="float">
<label>FIGURE 9</label>
<caption><p><bold>SRT1720 altered gene expressions of Nrf2/ARE signalling in ANTI-induced liver hepatotoxicity and cholestasis in mice. (A)</bold> Nrf2, <bold>(B)</bold> SOD, <bold>(C)</bold> GCLm, <bold>(D)</bold> GCLc, <bold>(E)</bold> Nqo1, and <bold>(F)</bold> HOO-1. Data are the mean &#x00B1; SD (<italic>n</italic> = 6). <sup>&#x2217;</sup><italic>P</italic> &#x003C; 0.05 versus vehicle; <sup>#</sup><italic>P</italic> &#x003C; 0.05 versus vehicle +ANIT.</p></caption>
<graphic xlink:href="fphar-08-00256-g009.tif"/>
</fig>
</sec>
</sec>
<sec><title>Discussion</title>
<p>Cholestasis, with the impairment of bile flow, could cause excessive bile acids accumulated in liver and could lead to liver cirrhosis and biliary fibrosis ultimately (<xref ref-type="bibr" rid="B3">Anwer, 2014</xref>). It is demonstrated that ANIT could lead to cholestasis through injuring biliary epithelial cell directly and inhibiting the expressions of bile acid transporters. It has been demonstrated that ANIT glutathione conjugate transported into bile through Mrp2. Mrp2 is an important hepatic canalicular efflux transporter that responsible for biliary excretion of various conjugated endobiotics and xenobiotic. The expression of Mrp2 in liver is different between male and female mice. Normally speaking, the expression of Mrp2 in male mice is lower than female mice. So, different regulation of Mrp2 expression and function between males and females may cause different liver damage during cholestasis (<xref ref-type="bibr" rid="B21">Kong et al., 2012a</xref>; <bold>Figure <xref ref-type="fig" rid="F10">10</xref></bold>).</p>
<fig id="F10" position="float">
<label>FIGURE 10</label>
<caption><p><bold>The possible mechanism of SRT1720 attenuated ANIT-induced cholestasis and liver injury</bold>.</p></caption>
<graphic xlink:href="fphar-08-00256-g010.tif"/>
</fig>
<p>It is concluded that the reasons for liver injury caused by ANIT comprise the dysregulation of bile acid transporters, the release of inflammatory mediators and the hepatic antioxidant defense system that improves lipid peroxidation of liver (<xref ref-type="bibr" rid="B33">Ohta et al., 1999</xref>; <xref ref-type="bibr" rid="B6">Cui et al., 2009</xref>). Previous studies have reported that SRT1720 could reverses the liver injury induced by 1% cholic acid feeding of mice by hepatic and extra hepatic mechanisms (<xref ref-type="bibr" rid="B24">Kulkarni et al., 2016</xref>). In current study, our results clearly indicated that SRT1720 could alleviate cholestatic liver injury caused by ANIT according to the given dosage. Since the dosage of SRT1720 given to mice is 20 mg/kg and the dosage convert coefficient between mice and human is 0.11, so the dosage of SRT1720 for human is about 2.2 mg/kg. SRT1720 not only significantly increased the expressions of bile acid uptake transporters (Ntcp, Oatp1b2), but also increased the expressions of efflux transporters (Bsep, Mrp2). SRT1720 decreased the levels of inflammatory cytokines in the liver, leading to a reduction in the inflammatory process. Moreover, SRT1720 alleviated liver oxidative stress response via activation of Nrf2/ARE signal pathway.</p>
<p>SRT1720 caused a decrease in the elevations of serum ALT, ALP, AST, TBIL, TBA, and &#x03B3;-GGT levels that are induced by ANIT (<bold>Figure <xref ref-type="fig" rid="F2">2</xref></bold>). After SRT1720 medication, the histological injuries healed. (<bold>Figures <xref ref-type="fig" rid="F3">3A,B</xref></bold>). These results indicated that SRT1720 has a significant effect on liver damage that is induced by ANIT. Various enzymes as well as transporters played important roles in bile acid homeostasis. Plenty of nuclear receptors are responsible for regulating these transporters as well as enzymes. Among them, HNF1&#x03B1; was called the &#x2018;regulator of regulators&#x2019;, and a recent study reported that the plasma TBA level in HNF1&#x03B1;<sup>-/-</sup> mice was higher than normal mice. It was demonstrated that Ntcp and Oatp1b2 were direct target genes of HNF1&#x03B1;, and HNF1&#x03B1;<sup>-/-</sup> mice showed decreased expressions of these genes, and thus caused damage to uptake of bile acid as well as increase in plasma&#x2019;s concentration in bile acid (<xref ref-type="bibr" rid="B37">Shih et al., 2001</xref>). The transporters on basolateral domains, Ntcp and Oatp1b2, are responsible for reabsorption of bile acid from blood to hepatocyte. It was reported that bile acid could decrease the expression of HNF1&#x03B1;, Oatp1b2 and Ntcp (<xref ref-type="bibr" rid="B17">Jung and Kullak-Ublick, 2003</xref>). ANIT down-regulated expressions of Ntcp and Oatp1b2 in mouse liver which consistent with a previous study (<xref ref-type="bibr" rid="B43">Wang T. et al., 2014</xref>), and SRT1720 treatment increased ANIT-suppressed HNF1&#x03B1;, Oatp1b2, and Ntcp expressions. Two mechanisms might be involved in which SRT1720 can restore HNF1&#x03B1; gene expression: 1. SRT1720 increased HNF1&#x03B1; expression directly in ANIT-treated mice; or 2. SRT1720 decreased hepatic TBAs in ANIT-treated mice, and it alleviated bile acids-suppressed HNF1&#x03B1;, Ntcp, and Oatp1b2. How SRT1720 regulates the activity of HNF1&#x03B1; is unknown, and more experiments are needed further.</p>
<p>HNF1&#x03B1; could directly bind to the promoter of FXR to regulate its expression (<xref ref-type="bibr" rid="B37">Shih et al., 2001</xref>). It has been demonstrated that Bsep and Mrp2, two major canalicular bile acid transports, are FXR target genes. FXR induces not only Bsep and Mrp2 but also Shp expression, which reversely causes transcriptional repression of Cyp7a1 gene. Both serum and liver TBA levels were increased in FXR<sup>-/-</sup>mice compared with normal mice (<xref ref-type="bibr" rid="B28">Lu et al., 2012</xref>). The paper has shown that ANIT has led to significant decrease in the gene expressions of FXR, Bsep and Mrp2, whereas SRT1720 caused an increase in all of them. Cyp7a1 is the rate-limiting enzyme in bile acids synthesis which also important in bile acid metabolism. The mRNA level of Cyp7a1 was decreased by ANIT and SRT1720 treatment further decreased ANIT-suppressed Cyp7a1 expression. Since Cyp7a1 limits the rate of cholesterol convert to bile acid, the inhibition of Cyp7a1 may increases the content of cholesterol in the liver (<xref ref-type="bibr" rid="B9">Ferrell et al., 2016</xref>). In the liver, BA hydroxylation and hydrophobicity are regulated by phase I enzymes like Cyp2b10 as well as Cyp3a11, and phase II enzymes like Ugt1a1 and Sult2a1 (<xref ref-type="bibr" rid="B31">Meng et al., 2015b</xref>). Cyp3a11 is a target gene of pregnane X receptor (PXR), and Cyp2b10 is a target gene of constitutive androstane receptor (CAR) (<xref ref-type="bibr" rid="B25">Lee et al., 2015</xref>) Supplementary Figure <xref ref-type="supplementary-material" rid="SM1">S2</xref>. Sult2a1 is the target gene of FXR (<xref ref-type="bibr" rid="B31">Meng et al., 2015b</xref>). However, SRT1720 increased the gene expressions of Cyp2b10 and Sult2a1 in mice, suggesting that CAR may also involve in hepatoprotection of SRT1720 (<bold>Figure <xref ref-type="fig" rid="F5">5</xref></bold>). In addition to HNF1&#x03B1; and FXR, there are many others nuclear receptors that also participate in bile acids metabolism, such as CAR, PPAR&#x03B1;, and SRT1720 may also affect them to alleviate ANIT-induced cholestasis; thus, additional experiments are needed to determine its mechanism.</p>
<p>To further analyze the influence of SRT1720 on FXR signaling, Bsep, Mrp2, and FXR expressions were quantified in sandwich cultured mouse hepatocytes that treated with different dose of SRT1720. The evidence demonstrated that SRT1720 increased the expressions of FXR, Mrp2 and Bsep (<bold>Figures <xref ref-type="fig" rid="F7">7A,B</xref></bold>). As shown in <bold>Figure <xref ref-type="fig" rid="F7">7C</xref></bold>, the activation of FXR induced by SRT1720 was abrogated after HNF1&#x03B1; silencing (<bold>Figure <xref ref-type="fig" rid="F7">7D</xref></bold>).</p>
<p>It was commonly recognized that oxidative stress also involved in cholestatic liver injury caused by ANIT (<xref ref-type="bibr" rid="B1">Aboutwerat et al., 2003</xref>). ROS is an oxidants which produced by almost all cells. Excessive ROS can injure cells and tissues. SOD is an important antioxidant enzyme which can prevent damages caused by oxidants. It promotes the production of O<sub>2</sub> and H<sub>2</sub>O<sub>2</sub> from O<sub>2</sub><sup>-</sup> to prevent the initiation of free-radical chain reactions (<xref ref-type="bibr" rid="B33">Ohta et al., 1999</xref>). T-AOC is considered as a vital indicator of antioxidant enzyme system for removing excessive ROS from the cells. GSH is one of the most important cellular antioxidants which can eliminate ROS (<xref ref-type="bibr" rid="B27">Lu, 2009</xref>). MDA is the product which produced by the interaction between ROS and polyunsaturated fatty acids. It was used as an indicator of oxidative stress. Assessing the level of MDA is a reliable method for assessing the degree of oxidative damage to the cell membrane (<xref ref-type="bibr" rid="B8">Duval et al., 1990</xref>). Significantly higher levels of MDA and reduced activities of GSH, T-AOC and SOD in hepatic tissue were observed in the present study, indicating antioxidant defenses were decreased by ANIT and oxidative damage were existed in the liver. SRT1720 markedly restored SOD, GSH and T-AOC activities (<bold>Figure <xref ref-type="fig" rid="F8">8A</xref></bold>). It is well known that developments of hepatic injuries caused by ANIT are largely influenced by infiltration of neutrophils. The indicator of neutrophils is MPO enzyme. In the current research, ANIT caused a significant increase in the MPO activity in the liver which indicated infiltration of neutrophil. The amount of neutrophil that infiltrated in the liver was reduced by SRT1720. In addition, it is observed that SRT1720 decreased liver TNF-&#x03B1; and IL-6 levels. So, we considered that SRT1720 could decrease neutrophil recruitment and the release of inflammatory cytokines to alleviate liver injury caused by ANIT (<bold>Figure <xref ref-type="fig" rid="F8">8B</xref></bold>).</p>
<p>Nrf2 is a vital transcription factor which can regulate various antioxidative stress genes (<xref ref-type="bibr" rid="B34">Okada et al., 2009</xref>). Nrf2 activation could alleviate cholestasis caused by BDL and ANIT models through activation of many antioxidative stress genes (<xref ref-type="bibr" rid="B2">Aleksunes et al., 2006</xref>; <xref ref-type="bibr" rid="B41">Tanaka et al., 2009</xref>). Several studies have reported that Nrf2 is suppressed by actin-binding protein keap1 (Kelch-like ECH-associated protein 1) in normal cells. Upon oxidative stress, Nrf2 dissociates from of Keap1 and then translocates into nucleus to bind antioxidant response element (ARE) in order to initiate the transcription of a series of antioxidative stress genes (<xref ref-type="bibr" rid="B42">Wang G. et al., 2014</xref>). It has been proved that Nrf2 can regulate the expressions of GCL subunits expressions (GCLm and GCLc), SOD, HO-1 and Nqo1 (<xref ref-type="bibr" rid="B4">Arisawa et al., 2009</xref>). The paper revealed that the mRNA levels of Nrf2, SOD, GCLc, and GCLm in the group treated with ANIT decreased significantly compared with control group (<bold>Figure <xref ref-type="fig" rid="F9">9A</xref></bold>) and SRT1720 increased all of them. However, the gene expressions of Nqo1 and HO-1 were not affected by ANIT. SRT1720 also increased their mRNA levels. Thus, sufficient evidence proved that SRT1720 increases the mRNA levels of Nrf2 and its target genes in cholestasis which induced by ANIT.</p>
</sec>
<sec><title>Conclusion</title>
<p>The current research demonstrated how SRT1720 exert its protective effect for liver damage and cholestasis induced by ANIT. And it suggested that activators of SIRT1 are effective agents for the treatment of cholestasis. Moreover, SIRT1 may be an effective therapeutic target for treating diseases related to cholestasis.</p>
</sec>
<sec><title>Author Contributions</title>
<p>LY contributed to the acquisition of data. XL, ZY, XL, HY, ZY, and LS contributed to the writing of the manuscript. ZJ and LZ were in charge of the overall conception and design of the study.</p>
</sec>
<sec><title>Conflict of Interest Statement</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
</body>
<back>
<fn-group>
<fn fn-type="financial-disclosure">
<p><bold>Funding.</bold> This study was supported by the National Natural Science Foundation of China (81320108029, 81573514, 81273604), the Natural Science Foundation of Jiangsu Province (BK20151439), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), the National &#x201C;Major Scientific and Technological Special Project for Significant New Drugs&#x201D; project (2015ZX09501004-002-004), and the Specific Fund for Public Interest Research of Traditional Chinese Medicine, Ministry of Finance (201507004-002). This study was partially supported by the 111 Project (111-2-07).</p></fn>
</fn-group>
<sec sec-type="supplementary material">
<title>Supplementary Material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="http://journal.frontiersin.org/article/10.3389/fphar.2017.00256/full#supplementary-material">http://journal.frontiersin.org/article/10.3389/fphar.2017.00256/full#supplementary-material</ext-link></p>
<supplementary-material xlink:href="Data_Sheet_1.DOCX" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Aboutwerat</surname> <given-names>A.</given-names></name> <name><surname>Pemberton</surname> <given-names>P. W.</given-names></name> <name><surname>Smith</surname> <given-names>A.</given-names></name> <name><surname>Burrows</surname> <given-names>P. C.</given-names></name> <name><surname>McMahon</surname> <given-names>R. F.</given-names></name> <name><surname>Jain</surname> <given-names>S. K.</given-names></name><etal/></person-group> (<year>2003</year>). <article-title>Oxidant stress is a significant feature of primary biliary cirrhosis.</article-title> <source><italic>Biochim. Biophys. Acta</italic></source> <volume>1637</volume> <fpage>142</fpage>&#x2013;<lpage>150</lpage>. <pub-id pub-id-type="doi">10.1016/S0925-4439(02)00225-9</pub-id></citation></ref>
<ref id="B2"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Aleksunes</surname> <given-names>L. M.</given-names></name> <name><surname>Slitt</surname> <given-names>A. L.</given-names></name> <name><surname>Maher</surname> <given-names>J. M.</given-names></name> <name><surname>Dieter</surname> <given-names>M. Z.</given-names></name> <name><surname>Knight</surname> <given-names>T. R.</given-names></name> <name><surname>Goedken</surname> <given-names>M.</given-names></name><etal/></person-group> (<year>2006</year>). <article-title>Nuclear factor-E2-related factor 2 expression in liver is critical for induction of NAD(P)H: quinone oxidoreductase 1 during cholestasis.</article-title> <source><italic>Cell Stress Chaperones</italic></source> <volume>11</volume> <fpage>356</fpage>&#x2013;<lpage>363</lpage>. <pub-id pub-id-type="doi">10.1379/CSC-217.1</pub-id></citation></ref>
<ref id="B3"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Anwer</surname> <given-names>M. S.</given-names></name></person-group> (<year>2014</year>). <article-title>Role of protein kinase C isoforms in bile formation and cholestasis.</article-title> <source><italic>Hepatology</italic></source> <volume>60</volume> <fpage>1090</fpage>&#x2013;<lpage>1097</lpage>. <pub-id pub-id-type="doi">10.1002/hep.27088</pub-id></citation></ref>
<ref id="B4"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Arisawa</surname> <given-names>S.</given-names></name> <name><surname>Ishida</surname> <given-names>K.</given-names></name> <name><surname>Kameyama</surname> <given-names>N.</given-names></name> <name><surname>Ueyama</surname> <given-names>J.</given-names></name> <name><surname>Hattori</surname> <given-names>A.</given-names></name> <name><surname>Tatsumi</surname> <given-names>Y.</given-names></name><etal/></person-group> (<year>2009</year>). <article-title>Ursodeoxycholic acid induces glutathione synthesis through activation of PI3K/Akt pathway in HepG2 cells.</article-title> <source><italic>Biochem. Pharmacol.</italic></source> <volume>77</volume> <fpage>858</fpage>&#x2013;<lpage>866</lpage>. <pub-id pub-id-type="doi">10.1016/j.bcp.2008.11.012</pub-id></citation></ref>
<ref id="B5"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bordone</surname> <given-names>L.</given-names></name> <name><surname>Cohen</surname> <given-names>D.</given-names></name> <name><surname>Robinson</surname> <given-names>A.</given-names></name> <name><surname>Motta</surname> <given-names>M. C.</given-names></name> <name><surname>van Veen</surname> <given-names>E.</given-names></name> <name><surname>Czopik</surname> <given-names>A.</given-names></name><etal/></person-group> (<year>2007</year>). <article-title>SIRT1 transgenic mice show phenotypes resembling calorie restriction.</article-title> <source><italic>Aging Cell</italic></source> <volume>6</volume> <fpage>759</fpage>&#x2013;<lpage>767</lpage>. <pub-id pub-id-type="doi">10.1111/j.1474-9726.2007.00335.x</pub-id></citation></ref>
<ref id="B6"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Cui</surname> <given-names>Y. J.</given-names></name> <name><surname>Aleksunes</surname> <given-names>L. M.</given-names></name> <name><surname>Tanaka</surname> <given-names>Y.</given-names></name> <name><surname>Goedken</surname> <given-names>M. J.</given-names></name> <name><surname>Klaassen</surname> <given-names>C. D.</given-names></name></person-group> (<year>2009</year>). <article-title>Compensatory induction of liver efflux transporters in response to ANIT-induced liver injury is impaired in FXR-null mice.</article-title> <source><italic>Toxicol. Sci.</italic></source> <volume>110</volume> <fpage>47</fpage>&#x2013;<lpage>60</lpage>. <pub-id pub-id-type="doi">10.1093/toxsci/kfp094</pub-id></citation></ref>
<ref id="B7"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Dahm</surname> <given-names>L. J.</given-names></name> <name><surname>Roth</surname> <given-names>R. A.</given-names></name></person-group> (<year>1991</year>). <article-title>Protection against alpha-naphthylisothiocyanate induced liver injury by decreased hepatic non-protein sulfhydryl content.</article-title> <source><italic>Biochem. Pharmacol.</italic></source> <volume>42</volume> <fpage>1181</fpage>&#x2013;<lpage>1188</lpage>. <pub-id pub-id-type="doi">10.1016/0006-2952(91)90252-Z</pub-id></citation></ref>
<ref id="B8"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Duval</surname> <given-names>D. L.</given-names></name> <name><surname>Howard</surname> <given-names>D.</given-names></name> <name><surname>McCalden</surname> <given-names>T. A.</given-names></name> <name><surname>Billings</surname> <given-names>R. E.</given-names></name></person-group> (<year>1990</year>). <article-title>The determination of myeloperoxidase activity in liver.</article-title> <source><italic>Life Sci.</italic></source> <volume>47</volume> <fpage>145</fpage>&#x2013;<lpage>150</lpage>. <pub-id pub-id-type="doi">10.1016/0024-3205(90)90164-M</pub-id></citation></ref>
<ref id="B9"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ferrell</surname> <given-names>J. M.</given-names></name> <name><surname>Boehme</surname> <given-names>S.</given-names></name> <name><surname>Li</surname> <given-names>F.</given-names></name> <name><surname>Chiang</surname> <given-names>J. Y.</given-names></name></person-group> (<year>2016</year>). <article-title>Cholesterol 7&#x03B1;-hydroxylase-deficient mice are protected from high-fat/high-cholesterol diet-induced metabolic disorders.</article-title> <source><italic>J. Lipid Res.</italic></source> <volume>57</volume> <fpage>1144</fpage>&#x2013;<lpage>1154</lpage>. <pub-id pub-id-type="doi">10.1194/jlr.M064709</pub-id></citation></ref>
<ref id="B10"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Geenes</surname> <given-names>V.</given-names></name> <name><surname>Chappell</surname> <given-names>L. C.</given-names></name> <name><surname>Seed</surname> <given-names>P. T.</given-names></name> <name><surname>Steer</surname> <given-names>P. J.</given-names></name> <name><surname>Knight</surname> <given-names>M.</given-names></name> <name><surname>Williamson</surname> <given-names>C.</given-names></name></person-group> (<year>2014</year>). <article-title>Association of severe intrahepatic cholestasis of pregnancy with adverse pregnancy outcomes: a prospective population-based case-control study.</article-title> <source><italic>Hepatology</italic></source> <volume>59</volume> <fpage>1482</fpage>&#x2013;<lpage>1491</lpage>. <pub-id pub-id-type="doi">10.1002/hep.26617</pub-id></citation></ref>
<ref id="B11"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Gerhart-Hines</surname> <given-names>Z.</given-names></name> <name><surname>Rodgers</surname> <given-names>J. T.</given-names></name> <name><surname>Bare</surname> <given-names>O.</given-names></name> <name><surname>Carles</surname> <given-names>L.</given-names></name> <name><surname>Kim</surname> <given-names>S.-H.</given-names></name> <name><surname>Mostoslavsky</surname> <given-names>R.</given-names></name><etal/></person-group> (<year>2007</year>). <article-title>Metabolic control of muscle mitochondrial function and fatty acid oxidation through SIRT1/PGC-1 alpha.</article-title> <source><italic>Embo J.</italic></source> <volume>26</volume> <fpage>1913</fpage>&#x2013;<lpage>1923</lpage>. <pub-id pub-id-type="doi">10.1038/sj.emboj.7601633</pub-id></citation></ref>
<ref id="B12"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Guo</surname> <given-names>C.</given-names></name> <name><surname>He</surname> <given-names>L.</given-names></name> <name><surname>Yao</surname> <given-names>D.</given-names></name> <name><surname>A</surname> <given-names>J.</given-names></name> <name><surname>Cao</surname> <given-names>B.</given-names></name> <name><surname>Ren</surname> <given-names>J.</given-names></name><etal/></person-group> (<year>2014</year>). <article-title>Alpha-naphthylisothiocyanate modulates hepatobiliary transporters in sandwich cultured rat hepatocytes.</article-title> <source><italic>Toxicol. Lett.</italic></source> <volume>224</volume> <fpage>93</fpage>&#x2013;<lpage>100</lpage>. <pub-id pub-id-type="doi">10.1016/j.toxlet</pub-id></citation></ref>
<ref id="B13"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hill</surname> <given-names>D. A.</given-names></name> <name><surname>Roth</surname> <given-names>R. A.</given-names></name></person-group> (<year>1998</year>). <article-title>&#x03B1;-Naphthylisothiocyanate causes neutrophils to release factors that are cytotoxic to hepatocytes.</article-title> <source><italic>Toxicol. Appl. Pharmacol.</italic></source> <volume>148</volume> <fpage>169</fpage>&#x2013;<lpage>175</lpage>. <pub-id pub-id-type="doi">10.1006/taap.1997.8314</pub-id></citation></ref>
<ref id="B14"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hirschfield</surname> <given-names>G. M.</given-names></name> <name><surname>Chapman</surname> <given-names>R. W.</given-names></name> <name><surname>Karlsen</surname> <given-names>T. H.</given-names></name> <name><surname>Lammert</surname> <given-names>F.</given-names></name> <name><surname>Lazaridis</surname> <given-names>K. N.</given-names></name> <name><surname>Mason</surname> <given-names>A. L.</given-names></name></person-group> (<year>2013</year>). <article-title>The genetics of complex cholestatic disorders.</article-title> <source><italic>Gastroenterology</italic></source> <volume>144</volume> <fpage>1357</fpage>&#x2013;<lpage>1374</lpage>. <pub-id pub-id-type="doi">10.1053/j.gastro.2013.03.053</pub-id></citation></ref>
<ref id="B15"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hou</surname> <given-names>X.</given-names></name> <name><surname>Xu</surname> <given-names>S.</given-names></name> <name><surname>Maitland-Toolan</surname> <given-names>K. A.</given-names></name> <name><surname>Sato</surname> <given-names>K.</given-names></name> <name><surname>Jiang</surname> <given-names>B.</given-names></name> <name><surname>Ido</surname> <given-names>Y.</given-names></name><etal/></person-group> (<year>2008</year>). <article-title>SIRT1 regulates hepatocyte lipid metabolism through activating AMP-activated protein kinase.</article-title> <source><italic>J. Biol. Chem.</italic></source> <volume>283</volume> <fpage>20015</fpage>&#x2013;<lpage>20026</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.M802187200</pub-id></citation></ref>
<ref id="B16"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ji</surname> <given-names>F.</given-names></name> <name><surname>Deng</surname> <given-names>H.</given-names></name> <name><surname>Li</surname> <given-names>Z.</given-names></name></person-group> (<year>2014</year>). <article-title>Eltrombopag for thrombocytopenic patients with hepatitis C virus infection and cirrhosis.</article-title> <source><italic>Gastroenterology</italic></source> <volume>147</volume> <fpage>253</fpage>&#x2013;<lpage>254</lpage>. <pub-id pub-id-type="doi">10.1053/j.gastro.2013.12.046</pub-id></citation></ref>
<ref id="B17"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Jung</surname> <given-names>D.</given-names></name> <name><surname>Kullak-Ublick</surname> <given-names>G. A.</given-names></name></person-group> (<year>2003</year>). <article-title>Hepatocyte nuclear factor 1 alpha: a key mediator of the effect of bile acids on gene expression.</article-title> <source><italic>Hepatology</italic></source> <volume>37</volume> <fpage>622</fpage>&#x2013;<lpage>631</lpage>. <pub-id pub-id-type="doi">10.1053/jhep.2003.50100</pub-id></citation></ref>
<ref id="B18"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kazgan</surname> <given-names>N.</given-names></name> <name><surname>Metukuri</surname> <given-names>M. R.</given-names></name> <name><surname>Purushotham</surname> <given-names>A.</given-names></name> <name><surname>Lu</surname> <given-names>J.</given-names></name> <name><surname>Rao</surname> <given-names>A.</given-names></name> <name><surname>Lee</surname> <given-names>S.</given-names></name><etal/></person-group> (<year>2014</year>). <article-title>Intestine-specific deletion of SIRT1 in mice impairs DCoH2&#x2013;HNF1&#x03B1;&#x2013;FXR signalling and alters systemic bile acid homeostasis.</article-title> <source><italic>Gastroenterology</italic></source> <volume>146</volume> <fpage>1006</fpage>&#x2013;<lpage>1016</lpage>. <pub-id pub-id-type="doi">10.1053/j.gastro.2013.12.029</pub-id></citation></ref>
<ref id="B19"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kemper</surname> <given-names>J. K.</given-names></name> <name><surname>Xiao</surname> <given-names>Z.</given-names></name> <name><surname>Ponugoti</surname> <given-names>B.</given-names></name> <name><surname>Miao</surname> <given-names>J.</given-names></name> <name><surname>Fang</surname> <given-names>S.</given-names></name> <name><surname>Kanamaluru</surname> <given-names>D.</given-names></name><etal/></person-group> (<year>2009</year>). <article-title>FXR acetylation is normally dynamically regulated by p300 and SIRT1 but constitutively elevated in metabolic disease states.</article-title> <source><italic>Cell Metab.</italic></source> <volume>10</volume> <fpage>392</fpage>&#x2013;<lpage>404</lpage>. <pub-id pub-id-type="doi">10.1016/j.cmet.2009.09.009</pub-id></citation></ref>
<ref id="B20"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kobayashi</surname> <given-names>M.</given-names></name> <name><surname>Higuchi</surname> <given-names>S.</given-names></name> <name><surname>Mizuno</surname> <given-names>K.</given-names></name> <name><surname>Tsuneyama</surname> <given-names>K.</given-names></name> <name><surname>Fukami</surname> <given-names>T.</given-names></name> <name><surname>Nakajima</surname> <given-names>M.</given-names></name><etal/></person-group> (<year>2010</year>). <article-title>Interleukin-17 is involved in alpha-naphthylisothiocyanate-induced liver injury in mice.</article-title> <source><italic>Toxicology</italic></source> <volume>275</volume> <fpage>50</fpage>&#x2013;<lpage>57</lpage>. <pub-id pub-id-type="doi">10.1016/j.tox.2010.05.011</pub-id></citation></ref>
<ref id="B21"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kong</surname> <given-names>B.</given-names></name> <name><surname>Csanaky</surname> <given-names>I. L.</given-names></name> <name><surname>Aleksunes</surname> <given-names>L. M.</given-names></name> <name><surname>Patni</surname> <given-names>M.</given-names></name> <name><surname>Chen</surname> <given-names>Q.</given-names></name> <name><surname>Ma</surname> <given-names>X.</given-names></name><etal/></person-group> (<year>2012a</year>). <article-title>Gender-specific reduction of hepatic Mrp2 expression by high-fat diet protects female mice from ANIT toxicity.</article-title> <source><italic>Toxicol. Appl. Pharmacol.</italic></source> <volume>261</volume> <fpage>189</fpage>&#x2013;<lpage>195</lpage>. <pub-id pub-id-type="doi">10.1016/j.taap.2012.04.001</pub-id></citation></ref>
<ref id="B22"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kong</surname> <given-names>B.</given-names></name> <name><surname>Wang</surname> <given-names>L.</given-names></name> <name><surname>Chiang</surname> <given-names>J. Y.</given-names></name> <name><surname>Zhang</surname> <given-names>Y.</given-names></name> <name><surname>Klaassen</surname> <given-names>C. D.</given-names></name> <name><surname>Guo</surname> <given-names>G. L.</given-names></name></person-group> (<year>2012b</year>). <article-title>Mechanism of tissue-specific farnesoid X receptor in suppressing the expression of genes in bile-acid synthesis in mice.</article-title> <source><italic>Hepatology</italic></source> <volume>56</volume> <fpage>1034</fpage>&#x2013;<lpage>1043</lpage>. <pub-id pub-id-type="doi">10.1002/hep.25740</pub-id></citation></ref>
<ref id="B23"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kongo</surname> <given-names>M.</given-names></name> <name><surname>Ohta</surname> <given-names>Y.</given-names></name> <name><surname>Nishida</surname> <given-names>K.</given-names></name> <name><surname>Sasaki</surname> <given-names>E.</given-names></name> <name><surname>Harada</surname> <given-names>N.</given-names></name> <name><surname>Ishiguro</surname> <given-names>I.</given-names></name></person-group> (<year>1999</year>). <article-title>An association between lipid peroxidation and &#x03B1;-naphthylisothiocyanate-induced liver injury in rats.</article-title> <source><italic>Toxicol. Lett.</italic></source> <volume>105</volume> <fpage>103</fpage>&#x2013;<lpage>110</lpage>. <pub-id pub-id-type="doi">10.1016/S0378-4274(98)00397-X</pub-id></citation></ref>
<ref id="B24"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kulkarni</surname> <given-names>S. R.</given-names></name> <name><surname>Soroka</surname> <given-names>C. J.</given-names></name> <name><surname>Hagey</surname> <given-names>L. R.</given-names></name> <name><surname>Boyer</surname> <given-names>J. L.</given-names></name></person-group> (<year>2016</year>). <article-title>Sirtuin 1 activation alleviates cholestatic liver injury in a cholic acid-fed mouse model of cholestasis.</article-title> <source><italic>Hepatology</italic></source> <volume>64</volume> <fpage>2151</fpage>&#x2013;<lpage>2164</lpage>. <pub-id pub-id-type="doi">10.1002/hep.28826</pub-id></citation></ref>
<ref id="B25"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname> <given-names>S. Y.</given-names></name> <name><surname>Lee</surname> <given-names>J. Y.</given-names></name> <name><surname>Kim</surname> <given-names>Y. M.</given-names></name> <name><surname>Kim</surname> <given-names>S. K.</given-names></name> <name><surname>Oh</surname> <given-names>S. J.</given-names></name></person-group> (<year>2015</year>). <article-title>Expression of hepatic cytochrome P450s and UDP-glucuronosyltransferases in PXR and CAR double humanized mice treated with rifampicin.</article-title> <source><italic>Toxicol. Lett.</italic></source> <volume>235</volume> <fpage>107</fpage>&#x2013;<lpage>115</lpage>. <pub-id pub-id-type="doi">10.1016/j.toxlet.2015.03.015</pub-id></citation></ref>
<ref id="B26"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>X.</given-names></name> <name><surname>Liu</surname> <given-names>R.</given-names></name> <name><surname>Yu</surname> <given-names>L.</given-names></name> <name><surname>Yuan</surname> <given-names>Z.</given-names></name> <name><surname>Sun</surname> <given-names>R.</given-names></name> <name><surname>Yang</surname> <given-names>H.</given-names></name><etal/></person-group> (<year>2016</year>). <article-title>Alpha-naphthylisothiocyanate impairs bile acid homeostasis through AMPK-FXR pathways in rat primary hepatocytes.</article-title> <source><italic>Toxicology</italic></source> <volume>370</volume> <fpage>106</fpage>&#x2013;<lpage>115</lpage>. <pub-id pub-id-type="doi">10.1016/j.tox.2016.09.020</pub-id></citation></ref>
<ref id="B27"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lu</surname> <given-names>S. C.</given-names></name></person-group> (<year>2009</year>). <article-title>Regulation of glutathione synthesis.</article-title> <source><italic>Mol. Aspects Med.</italic></source> <volume>30</volume> <fpage>42</fpage>&#x2013;<lpage>59</lpage>. <pub-id pub-id-type="doi">10.1016/j.mam.2008.05.005</pub-id></citation></ref>
<ref id="B28"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lu</surname> <given-names>Y.</given-names></name> <name><surname>Zhang</surname> <given-names>Z.</given-names></name> <name><surname>Xiong</surname> <given-names>X.</given-names></name> <name><surname>Wang</surname> <given-names>X.</given-names></name> <name><surname>Li</surname> <given-names>J.</given-names></name> <name><surname>Shi</surname> <given-names>G.</given-names></name><etal/></person-group> (<year>2012</year>). <article-title>Glucocorticoids promote hepatic cholestasis in mice by inhibiting the transcriptional activity of the farnesoid X receptor.</article-title> <source><italic>Gastroenterology</italic></source> <volume>143</volume> <fpage>1630</fpage>&#x2013;<lpage>1640.e8</lpage>. <pub-id pub-id-type="doi">10.1053/j.gastro.2012.08.029</pub-id></citation></ref>
<ref id="B29"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ma</surname> <given-names>X.</given-names></name> <name><surname>Zhao</surname> <given-names>Y. L.</given-names></name> <name><surname>Zhu</surname> <given-names>Y.</given-names></name> <name><surname>Chen</surname> <given-names>Z.</given-names></name> <name><surname>Wang</surname> <given-names>J. B.</given-names></name> <name><surname>Li</surname> <given-names>R. Y.</given-names></name><etal/></person-group> (<year>2015</year>). <article-title><italic>Paeonia lactiflora</italic> Pall. protects against ANIT-induced cholestasis by activating Nrf2 via PI3K/Akt signalling pathway.</article-title> <source><italic>Drug Des. Devel. Ther.</italic></source> <volume>9</volume> <fpage>5061</fpage>&#x2013;<lpage>5074</lpage>. <pub-id pub-id-type="doi">10.2147/DDDT.S90030</pub-id></citation></ref>
<ref id="B30"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Meng</surname> <given-names>Q.</given-names></name> <name><surname>Chen</surname> <given-names>X. L.</given-names></name> <name><surname>Wang</surname> <given-names>C. Y.</given-names></name> <name><surname>Liu</surname> <given-names>Q.</given-names></name> <name><surname>Sun</surname> <given-names>H. J.</given-names></name> <name><surname>Sun</surname> <given-names>P. Y.</given-names></name><etal/></person-group> (<year>2015a</year>). <article-title>Alisol B 23-acetate protects against ANIT-induced hepatotoxicity and cholestasis, due to FXR-mediated regulation of transporters and enzymes involved in bile acid homeostasis.</article-title> <source><italic>Toxicol. Appl. Pharmacol.</italic></source> <volume>283</volume> <fpage>178</fpage>&#x2013;<lpage>186</lpage>. <pub-id pub-id-type="doi">10.1016/j.taap.2015.01.020</pub-id></citation></ref>
<ref id="B31"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Meng</surname> <given-names>Q.</given-names></name> <name><surname>Chen</surname> <given-names>X.</given-names></name> <name><surname>Wang</surname> <given-names>C.</given-names></name> <name><surname>Liu</surname> <given-names>Q.</given-names></name> <name><surname>Sun</surname> <given-names>H.</given-names></name> <name><surname>Sun</surname> <given-names>P.</given-names></name><etal/></person-group> (<year>2015b</year>). <article-title>Protective effects of alisol B 23-acetate via farnesoid X receptor-mediated regulation of transporters and enzymes in estrogen-induced cholestatic liver injury in mice.</article-title> <source><italic>Pharm. Res.</italic></source> <volume>32</volume> <fpage>3688</fpage>&#x2013;<lpage>3698</lpage>. <pub-id pub-id-type="doi">10.1007/s11095-015-1727-x</pub-id></citation></ref>
<ref id="B32"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Milne</surname> <given-names>J. C.</given-names></name> <name><surname>Lambert</surname> <given-names>P. D.</given-names></name> <name><surname>Schenk</surname> <given-names>S.</given-names></name> <name><surname>Carney</surname> <given-names>D. P.</given-names></name> <name><surname>Smith</surname> <given-names>J. J.</given-names></name> <name><surname>Gagne</surname> <given-names>D. J.</given-names></name><etal/></person-group> (<year>2007</year>). <article-title>Small molecule activators of SIRT1 as therapeutics for the treatment of type 2 diabetes.</article-title> <source><italic>Nature</italic></source> <volume>450</volume> <fpage>712</fpage>&#x2013;<lpage>716</lpage>. <pub-id pub-id-type="doi">10.1038/nature06261</pub-id></citation></ref>
<ref id="B33"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ohta</surname> <given-names>Y.</given-names></name> <name><surname>Kongo</surname> <given-names>M.</given-names></name> <name><surname>Sasaki</surname> <given-names>E.</given-names></name> <name><surname>Harada</surname> <given-names>N.</given-names></name></person-group> (<year>1999</year>). <article-title>Change in hepatic antioxidant defense system with liver injury development in rats with a single &#x03B1;-naphthylisothiocyanate intoxication.</article-title> <source><italic>Toxicology</italic></source> <volume>139</volume> <fpage>265</fpage>&#x2013;<lpage>275</lpage>. <pub-id pub-id-type="doi">10.1016/S0300-483X(99)00131-6</pub-id></citation></ref>
<ref id="B34"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Okada</surname> <given-names>K.</given-names></name> <name><surname>Shoda</surname> <given-names>J.</given-names></name> <name><surname>Taguchi</surname> <given-names>K.</given-names></name> <name><surname>Maher</surname> <given-names>J. M.</given-names></name> <name><surname>Ishizaki</surname> <given-names>K.</given-names></name> <name><surname>Inoue</surname> <given-names>Y.</given-names></name><etal/></person-group> (<year>2009</year>). <article-title>Nrf2 counteracts cholestatic liver injury via stimulation of hepatic defense systems.</article-title> <source><italic>Biochem. Biophys. Res. Commun.</italic></source> <volume>389</volume> <fpage>431</fpage>&#x2013;<lpage>436</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbrc.2009.08.156</pub-id></citation></ref>
<ref id="B35"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ponugoti</surname> <given-names>B.</given-names></name> <name><surname>Kim</surname> <given-names>D. H.</given-names></name> <name><surname>Xiao</surname> <given-names>Z.</given-names></name> <name><surname>Smith</surname> <given-names>Z.</given-names></name> <name><surname>Miao</surname> <given-names>J.</given-names></name> <name><surname>Zang</surname> <given-names>M. W.</given-names></name><etal/></person-group> (<year>2010</year>). <article-title>SIRT1 deacetylates and inhibits SREBP-1C activity in regulation of hepatic lipid metabolism.</article-title> <source><italic>J. Biol. Chem.</italic></source> <volume>285</volume> <fpage>33959</fpage>&#x2013;<lpage>33970</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.M110.122978</pub-id></citation></ref>
<ref id="B36"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Purushotham</surname> <given-names>A.</given-names></name> <name><surname>Xu</surname> <given-names>Q.</given-names></name> <name><surname>Lu</surname> <given-names>J.</given-names></name> <name><surname>Foley</surname> <given-names>J. F.</given-names></name> <name><surname>Yan</surname> <given-names>X.</given-names></name> <name><surname>Kim</surname> <given-names>D.-H.</given-names></name><etal/></person-group> (<year>2012</year>). <article-title>Hepatic deletion of SIRT1 decreases hepatocyte nuclear factor 1&#x03B1;/farnesoid X receptor signalling and induces formation of cholesterol gallstones in mice.</article-title> <source><italic>Mol. Cell. Biol.</italic></source> <volume>32</volume> <fpage>1226</fpage>&#x2013;<lpage>1236</lpage>. <pub-id pub-id-type="doi">10.1128/MCB.05988-11</pub-id></citation></ref>
<ref id="B37"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Shih</surname> <given-names>D. Q.</given-names></name> <name><surname>Bussen</surname> <given-names>M.</given-names></name> <name><surname>Sehayek</surname> <given-names>E.</given-names></name> <name><surname>Ananthanarayanan</surname> <given-names>M.</given-names></name> <name><surname>Shneider</surname> <given-names>B. L.</given-names></name> <name><surname>Suchy</surname> <given-names>F. J.</given-names></name><etal/></person-group> (<year>2001</year>). <article-title>Hepatocyte nuclear factor-1&#x03B1; is an essential regulator of bile acid and plasma cholesterol metabolism.</article-title> <source><italic>Nat. Genet.</italic></source> <volume>27</volume> <fpage>375</fpage>&#x2013;<lpage>384</lpage>. <pub-id pub-id-type="doi">10.1038/86871</pub-id></citation></ref>
<ref id="B38"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Smith</surname> <given-names>J. J.</given-names></name> <name><surname>Kenney</surname> <given-names>R. D.</given-names></name> <name><surname>Gagne</surname> <given-names>D. J.</given-names></name> <name><surname>Frushour</surname> <given-names>B. P.</given-names></name> <name><surname>Ladd</surname> <given-names>W.</given-names></name> <name><surname>Galonek</surname> <given-names>H. L.</given-names></name><etal/></person-group> (<year>2009</year>). <article-title>Small molecule activators of SIRT1 replicate signalling pathways triggered by calorie restriction in vivo.</article-title> <source><italic>BMC Syst. Biol.</italic></source> <volume>3</volume>:<issue>31</issue>. <pub-id pub-id-type="doi">10.1186/1752-0509-3-31</pub-id></citation></ref>
<ref id="B39"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Stone</surname> <given-names>A.</given-names></name> <name><surname>Chau</surname> <given-names>C.</given-names></name> <name><surname>Eaton</surname> <given-names>C.</given-names></name> <name><surname>Foran</surname> <given-names>E.</given-names></name> <name><surname>Kapur</surname> <given-names>M.</given-names></name> <name><surname>Prevatt</surname> <given-names>E.</given-names></name><etal/></person-group> (<year>2012</year>). <article-title>Biochemical characterization of P4-ATPase mutations identified in patients with progressive familial intrahepatic cholestasis.</article-title> <source><italic>J. Biol. Chem.</italic></source> <volume>287</volume> <fpage>41139</fpage>&#x2013;<lpage>41151</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.M112.413039</pub-id></citation></ref>
<ref id="B40"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Tanaka</surname> <given-names>A.</given-names></name> <name><surname>Gershwin</surname> <given-names>M. E.</given-names></name></person-group> (<year>2017</year>). <article-title>Finding the cure for primary biliary cholangitis-Still waiting.</article-title> <source><italic>Liver Int.</italic></source> <volume>37</volume> <fpage>500</fpage>&#x2013;<lpage>502</lpage>. <pub-id pub-id-type="doi">10.1111/liv.13344</pub-id></citation></ref>
<ref id="B41"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Tanaka</surname> <given-names>Y.</given-names></name> <name><surname>Aleksunes</surname> <given-names>L. M.</given-names></name> <name><surname>Cui</surname> <given-names>Y. J.</given-names></name> <name><surname>Klaassen</surname> <given-names>C. D.</given-names></name></person-group> (<year>2009</year>). <article-title>ANIT-induced intrahepatic cholestasis alters hepatobiliary transporter expression via Nrf2-dependent and independent signalling.</article-title> <source><italic>Toxicol. Sci.</italic></source> <volume>108</volume> <fpage>247</fpage>&#x2013;<lpage>257</lpage>. <pub-id pub-id-type="doi">10.1093/toxsci/kfp020</pub-id></citation></ref>
<ref id="B42"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>G.</given-names></name> <name><surname>Xiu</surname> <given-names>P.</given-names></name> <name><surname>Li</surname> <given-names>F.</given-names></name> <name><surname>Xin</surname> <given-names>C.</given-names></name> <name><surname>Li</surname> <given-names>K.</given-names></name></person-group> (<year>2014</year>). <article-title>Vitamin A supplementation alleviates extrahepatic cholestasis liver injury through Nrf2 activation.</article-title> <source><italic>Oxid. Med. Cell. Longev.</italic></source> <volume>2014</volume>:<issue>273692</issue>. <pub-id pub-id-type="doi">10.1155/2014/273692</pub-id></citation></ref>
<ref id="B43"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>T.</given-names></name> <name><surname>Zhou</surname> <given-names>Z. X.</given-names></name> <name><surname>Sun</surname> <given-names>L. X.</given-names></name> <name><surname>Li</surname> <given-names>X.</given-names></name> <name><surname>Xu</surname> <given-names>Z. M.</given-names></name> <name><surname>Chen</surname> <given-names>M.</given-names></name><etal/></person-group> (<year>2014</year>). <article-title>Resveratrol effectively attenuates &#x03B1;-naphthylisothiocyanate-induced acute cholestasis and liver injury through choleretic and anti-inflammatory mechanisms.</article-title> <source><italic>Acta Pharmacol. Sin.</italic></source> <volume>35</volume> <fpage>1527</fpage>&#x2013;<lpage>1536</lpage>. <pub-id pub-id-type="doi">10.1038/aps.2014.119</pub-id></citation></ref>
<ref id="B44"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Xu</surname> <given-names>W.</given-names></name> <name><surname>Hellerbrand</surname> <given-names>C.</given-names></name> <name><surname>K&#x00F6;hler</surname> <given-names>U. A.</given-names></name> <name><surname>Bugnon</surname> <given-names>P.</given-names></name> <name><surname>Kan</surname> <given-names>Y. W.</given-names></name> <name><surname>Werner</surname> <given-names>S.</given-names></name><etal/></person-group> (<year>2008</year>). <article-title>The Nrf2 transcription factor protects from toxin-induced liver injury and fibrosis.</article-title> <source><italic>Lab. Invest.</italic></source> <volume>88</volume> <fpage>1068</fpage>&#x2013;<lpage>1078</lpage>. <pub-id pub-id-type="doi">10.1038/labinvest.2008.75</pub-id></citation></ref>
<ref id="B45"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Xue</surname> <given-names>F.</given-names></name> <name><surname>Huang</surname> <given-names>J. W.</given-names></name> <name><surname>Ding</surname> <given-names>P. Y.</given-names></name> <name><surname>Zang</surname> <given-names>H. G.</given-names></name> <name><surname>Kou</surname> <given-names>Z. J.</given-names></name> <name><surname>Li</surname> <given-names>T.</given-names></name><etal/></person-group> (<year>2016</year>). <article-title>Nrf2/antioxidant defense pathway is involved in the neuroprotective effects of Sirt1 against focal cerebral ischemia in rats after hyperbaric oxygen preconditioning.</article-title> <source><italic>Behav. Brain Res.</italic></source> <volume>309</volume> <fpage>1</fpage>&#x2013;<lpage>8</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbr.2016.04.045</pub-id></citation></ref>
</ref-list>
</back>
</article>