Adult male Sprague Dawley rats (180–220 g, obtained from Center of Laboratory Animal of Guangdong Province, SCXK [Yue] 2008-0020, SYXK [Yue] 2008-0085) were pair-housed in plastic cages in a temperature-controlled (25°C) colony room at a 12/12-h light/dark cycle. Food and water were available ad libitum. All experimental protocols were approved by the Center of Laboratory Animals of the Guangdong Institute of Microbiology. All efforts were made to minimize the number of animals used.

The rats were randomly divided into four groups as follows: control group that received oral distilled water, model group that received intraperitoneal injection (i.p) of 100 mg/kg/d D-galactose (Zhong et al., 2016; Liang et al., 2017), low-dose group that received i.p D-galactose (100 mg/kg/d), and gavage at a dosage of 50 mg/[kg⋅d] in ethanol:water (8:2) extracts from H. erinaceus (EH), and high-dose group that received D-galactose i.p (100 mg/kg/d) and gavage at a dosage of 100 mg/[kg⋅d] in ethanol:water (8:2) extracts from H. erinaceus (EH) every day in the morning, the dose of EH was according to other literatures (Zhang et al., 2016) proved that H. erinaceus extracts at doses of 0.3, 1.0, and 3.0 g/kg for 4 weeks can significantly enhanced the Ach and ChAT concentrations in serum and the hypothalamus in the AlCl₃- and D-gal-induced AD mice. Every group consisted of eight animals and the procedure duration was 8 weeks.

Rat spatial learning and memory abilities were tested in the Morris water maze (MWM, DMS-2, Chinese Academy of Medical Sciences Institute of Medicine). The MWM consisted of a circular opaque fiberglass pool (200-cm diameter) filled with water (25 ± 1°C). The pool was surrounded by light blue curtains, and three distal visual cues were fixed on the curtains. A total of four floor light sources of equal power provided uniform illumination to the pool and testing room. A CCD camera was placed above the center of the pool in order to record animal swim paths. The video output was digitized by an EthoVision tracking system (Noldus, Leesburg, VA, USA). The water maze tests included three periods: initial spatial training, spatial reversal training, the probe test and the procedures same to those described previously (Chen et al., 2014).

The appearance, behavior and the fur color of the animals were observed and documented every day. Animal weight was measured every 3 days during the drug administration period. Following the water maze testing, the blood and serum were acquired. Routine index and cytokines (Wang et al., 2016) were measured and the brains of the animals were dissected. A total of four brains from each group were fixed in 4% paraformaldehyde solution and prepared as paraffin sections. The sections were stained with hematoxylin-eosin (H&E) and immunohistochemistry staining and observed under light microscopy (Zeng et al., 2013; Chen et al., 2014).

Dried material was loaded onto a column that was eluted with twofold greater volume of petroleum ether:ethanol (9:1, PE) for the volatile compounds and the fatty acid fraction. The samples were sequentially eluted with fourfold greater volume of ethanol:water (8:2) for the crude extraction and the elute was dried and loaded on the D-101 macroporous resin. The samples were subsequently eluted with twofold greater volume of petroleum ether and fourfold greater volume of acetone consecutively. The acetone elute was collected and evaporated to dryness. The extraction and separation process was developed in-house and the patent application is pending, and the extraction steps showed in Figure 5A.

PC12 cells were obtained from the American Type Culture Collection (Rockville, MD, USA). They were maintained in DMEM supplemented with 10% FBS at 37°C in a humidified atmosphere of 95% air and 5% CO₂ and seeded in 25 cm² culture dishes (Chen et al., 2013). The cells were initially stabilized at 37°C for 24 h, at 80% of confluence, and subsequently cultured in serum free medium following passaging. The cells were incubated with different concentrations of 3HF (final concentrations: 0.05, 1.00, and 1.50 μg/ml) for 2 h. NaN₃ was incubated at a final concentration of 0.03 mM to the cell culture for an additional 24 h. All the cells used in the present study were undifferentiated.

The cell viability of PC12 following treatment of 3HF was measured by quantitative colorimetric assay using the cell counting kit-8 (CCK-8, Dojindo Laboratories, Japan) assay. The assay was conducted as described previously (Xiong et al., 2015). The cells were seeded in 96-well culture plates at a density of 2 × 10⁴ cells/well. Following drug treatment, 10 μL/well of CCK8 solution was added, and the cells were incubated at 37°C for 1 h. The optical density of each well was determined at 450 nm using a microplate reader (RT-2100C, USA). Cell viability was expressed as percentage of survival compared with the non-treated control. The data are presented as the mean and standard error of the mean (SEM) for three independent experiments.

The intracellular ROS level was measured using the 2′, 7′-dichlorofluorescein diacetate (DCFH-DA) method (Chen et al., 2013), whereas the mitochondrial membrane potential was measured using rhodamine 123 fluorescent dye (Chen et al., 2013). The calcium ion concentration [Ca²⁺]_i was measured using the Fura-2/AM fluorescent dye (Chen et al., 2013). The results are expressed as percentage of activity compared with the non-treated control.

The cells were seeded in 25 cm² culture dishes. At 80% confluence, the cells incubated with different concentrations of 3HF (final concentrations: 0.05, 1.00, and 1.50 μg/ml) for 2 h. NaN₃ was used at a final concentration of 0.03 mM and was subsequently added to the culture for an additional 24 h. At the end of the drug treatment, the cells were washed with D-Hanks solution, scraped from the plates in the presence of 1 mL ice-cold PBS (0.1 M, containing 0.05 mM EDTA) and homogenized. The homogenate was centrifuged at 4,000 × g for 10 min at 4°C. The resulting supernatants were stored at -80°C until further analyses. The activity of the enzymes F₁F₀-ATPase, NADH-CoQ reductase and the ATP levels within the mitochondria was determined using corresponding kits as demonstrated previously (McKenzie et al., 2007). The protein concentration of the cells was determined using the Coomassie Brilliant Blue G250 assay. The enzyme activities and protein content were all determined using the Detection kits purchased from Nanjing Jiancheng Bioengineering Insititute (Nanjing, Jiangsu, China). The procedures were carried out according to the manufacturer instruction. The levels were normalized to the protein concentration of each sample and expressed as a percentage of activity compared with the non-treated control.

The presence of viable mitochondria was identified by Mito-tracker green (Molecular Probes, Beyotime, Shanghai, China) staining as described by Chang et al. (2014) with minor modifications. The stock solution of Mito-tracker green was prepared at a concentration of 1 mM in DMSO and stored at -20°C. The cells were stained in PBS with Mito-tracker Green (0.2 mM) at 37°C for 10 min. Following washing of the samples with PBS, the embryos were visualized using a fluorescent microscope at 490 nm.

The cells were fixed in 2.5% glutaraldehyde in PBS (pH 7.3). Following treatment with 1% osmium tetroxide solution (OsO₄), 2% uranylacetate (UA) and dehydration in ethanol and acetone solvents, the samples were embedded in epoxy resin and polymerized for 48 h at 60°C. Ultrathin sections were cut using an ultramicrotome and placed on copper net (150 mesh). The sections on the grids were post-stained for 2 min with 1% UA, and for 6 min with 1% lead citrate by the addition of single drops of the staining solution at room temperature. The sections were rinsed in deionized water, dried and finally observed using a H7650 electron microscope (Hitachi, Tokyo, Japan), as described in previous studies (Ghobeh et al., 2014).

Following drug treatment, the cells were washed with D-Hanks solution, scraped from the plates in the presence of 1 mL ice-cold PBS (0.1 M, containing 0.05 mM EDTA) and homogenized. The homogenate was centrifuged at 4,000 × g for 10 min at 4°C. The resulting supernatants were kept at -80°C until further analyses. The activities of COX I, COX II, NF-κB, Caspase-3, and Caspase-9 enzymes were measured by the Detection kits purchased from Cloud-Clone, Corp. (Houston, TX, USA). The procedures were carried out according to the manufacturer instruction. The levels of enzyme activity were normalized according to the protein concentration of each sample and expressed as a percentage of activity compared with non-treated control.

Cells were seeded in 25 mL plastic flask at a density of 2 × 10⁵ cells/mL and incubated with different concentrations of 3HF (final concentrations: 0.05, 1.00, and 1.50 μg/ml, respectively) for 2 h. NaN₃ was used at a final concentration of 0.03 mM and was added to the culture for an additional 4, 8, or 24 h. The cells were harvested and the total RNA was extracted using Trizol reagent, whereas the remaining DNA was removed by DNase I. Consequently, purified RNA was obtained and the yield and purity was calculated by spectrophotometric estimation of the OD value at 260 and 280 nm respectively (k2800, Beijing Kai’ao Company).

A q-RT PCR assay was conducted using RNA obtained from PC12 cells. The expression levels of p21, PARP1, and NF-κB in mitochondria were examined. Amplification was carried out using ABI ViiA 7 Detection System and Hema9600 PCR (Zhuhai Heima medical equipment corporation) instruments. The mRNA levels of a control group were used as the baseline; As a result, ^ΔΔCt was calculated using the formula ^ΔΔC_T = ^ΔC_T of target gene -ΔC_T of the baseline. The fold change of the mRNA levels was calculated as fold = 2^-ΔΔCT. The PCR primer sequences were as follows: sense: TCTTCTGCTGTGGGT CAGGAGG and antisense: GGCAGGCAGCGTATATCAGGAGA for p21;sense: TGCTGTCAAGGAGGA AGGTGTC and antisense: TCCAGGACGTGTGCAGAGTGTT for PARP1; sense: TGAGGAAGAGGCATG TAGAGACT and antisense: ACTGGCACTTCGGACAACAGAAG for NF-κB.

Cells were seeded in 6-well culture plates at 5 × 10⁶ cells/well and were washed twice with D-Hanks solution following drug treatment. The cells were harvested and lysed with protein lysis buffer and the concentration of the protein was determined using the Coomassie Brilliant Blue G250 assay kit (Nanjing JianCheng Bioengineering Institute, China). Protein samples were separated by SDS-PAGE electrophoresis for 1.5 h at 90 V. The separated proteins were transferred to PVDF membranes using a transblotting apparatus (Bio-Rad Laboratories, USA) for 90 min at 90 V. The membranes were blocked with 5% (w/v) non-fat milk in TBS-T (Tris-buffer saline containing 0.1% Tween-20) at room temperature for 30 min and subsequently incubated at 4°C overnight with appropriate amount of primary antibody against BACE1 (ab183612), p-Tau (ab64193), Aβ_1-42 (ab201060), PARP1 (ab191217), p21 (ab80633), and NF-κB p65 (ab16502) proteins. The primary antibodies were purchased from Abcam, Cambridge, UK, with the exception of the antibody for ARP1 (sc-393500) that was purchased from Santa Cruz Biotechnology, Inc. Following binding with the primary antibody, the membrane was washed with TBS-T once for 15 min and subsequently for 5 min for three times. The membrane was probed with horseradish peroxidase-conjugated secondary antibody at 4°C overnight. Incubation of the membranes with primary antibody against GAPDH at 4°C overnight, followed by a horseradish peroxidase-conjugated goat anti-mouse IgG at 37°C for 2 h was used as a loading control. The membrane were further washed with TBS-T for three times and the protein bands were visualized by ECL western blotting detection reagents (Amersham Biosciences, Buckinghamshire, UK).

The fur of the EH-treated animals was apparently smoother compared with that of the model group, which indicated that treatment with the EH can retain the fur at a healthy state. The weight records indicated that there were no significant difference (F = 2.55, p > 0.05) in the average weight change rate between the treated and the model groups, as shown in Figure 1A. The mean weight of the animals was approximately 330 ± 11.27 g at the beginning and 475 ± 20.00 g at the end of the experiment, which implied that the drugs exhibited no serious adverse effects on the animal weight.

The incubation period for each EH-treated group (62.85 ± 11.97 s) was significantly shorter in length compared with that noted in the model group. The low-dose EH group incubation period was 74.16 ± 15.61 s, while the incubation period for the high-dose EH group was 66.73 ± 10.56 s on the first day. The differences noted in the incubation periods of the aforementioned groups were significant (F = 9.66, p < 0.05) compared with those noted in the model group (incubation period of 94.25 ± 12.20 s). On the fifth day, the low-dose EH group incubation period was 24.94 ± 5.30 s, whereas for the high-dose group the corresponding value was 21.98 ± 4.71 s. The differences were significant compared with the model group 67.65 ± 9.71 s (F = 98.71, p < 0.01), as shown in Figure 1B. Furthermore the swimming time in NW quadrant was improved (Figure 1C). The results indicated that EH can ameliorate D-galactose-induced learning and memory dysfunction in rats.

The probe test results indicated that there were no significant differences (p > 0.05) among the groups with regard to the total swimming distance and/or speed. The swimming time of the control group in the NW quadrant (33.12 ± 12.31 s) was longer compared with that noted in the other three quadrants, and the differences among them were significant (F = 6.63, p < 0.01). The swimming time of the model group was 17.23 ± 7.43 s, which was significantly lower compared with the control group (p < 0.01), suggesting that the rats couldn’t remember the location of the platform. The swimming times of the low- and high-dose EH groups were 31.55 ± 8.87 s, 36.66 ± 9.26 s in the NW quadrant, which were significantly greater in length compared with the model group (F = 6.63, p < 0.01). The differences noted in the parameters measured of the aforementioned groups were significant (F = 6.63, p < 0.01), as shown in Figure 1D compared with those noted in the model group. In addition, the swimming trajectory of the EH group was apparently denser in the NW quadrant compared with the other quadrants, as shown in Figure 1E. The results suggested that EH could ameliorate D-galactose-induced learning and memory dysfunction in rats.

The phosphorylation status of the intracellular markers that are involved in the neurodegenerative processes, such as tau, Aβ_1-42 and beta-site amyloid precursor protein cleaving enzyme 1 (BACE1) was assessed by western immunoblotting. The expression of the modulators BACE1, p-Tau and Aβ₄₂ was investigated in NaN₃-induced PC12 cells. The cells were pretreated with 3HF at the concentrations of 0.05, 1.00, and 1.50 μg/ml for 2 h, followed by exposure to 0.03 mM of NaN₃ for 4, 8, and 24 h (Figure 4). The expression of BACE1, p-Tau and Aβ₄₂ proteins were decreased in all three 3HF treatment groups compared with the normal group. The expression of the proteins p21, NF-κB p65, and PARP1 that are related to mitochondrial dysfunction or cellular aging was further investigated. The data suggested that the expression levels of the aforementioned proteins were reversed following treatment with EH compared with the model group.

The mRNA expression of six genes that are considered to be associated with the mitochondrial dysfunction processes was investigated in order to add further insight in the mechanism involved in the improvement of the mitochondrial dysfunction caused by 3HF (Picone et al., 2014; Ajith and Padmajanair, 2015). The cells were pretreated with 3HF at the concentrations of 0.5, 1.00, and 1.50 μg/ml for 2 h and further exposed to 0.03 mM of NaN₃ for 4, and 8 h. The mRNA expression levels of p21, NF-κB p65, and PARP1 in the mitochondria were measured. The PARP1, p21, and NF-κB p65 expression levels increased following treatment from 4 to 8 h with 0.03 mM of NaN₃. These increased trends were reversed by co-administration with different concentrations of 3HF, notably at the high 3HF dose (1.50 μg/ml) group, while the mRNA expression of the aforementioned genes was reversed to normal levels (Figure 4).

Cell viability was assessed by the CCK-8 assay. PC12 cells were treated with different concentrations of 3HF for 24 h, and the cell viability was compared between 3HF-treated groups and control groups, showed in Figure 5B. When the cells were treated with 3HF at a concentration range of 0.01 to 2.00 μg/ml for 24 h, the cell viability was significantly increased compared with the control group (100%), while at the concentration of 5.00 μg/ml, the cell viability was decreased compared with the 2.00 μg/ml-treated group but increased compared with the control group. The results indicated that 3HF under 5.00 μg/ml was considerably non-toxic in PC12 cells.

Treatment of PC12 cells with a concentration range of 0 to 0.1 mM of NaN₃ for 24 h induced cytotoxicity (Figure 5C). The cell viability was reduced to 24.74% of the control value (100%), as shown in Figure 5B. When the cells were co-incubated with 3HF at the concentrations of 0.05, 1.00, and 2.00 μg/ml for 2 h and further exposed to 0.03 mM of NaN₃ for 24 h, the cell viability was significantly increased (63, 85, and 106% of the control value, respectively) compared with the NaN₃ group (Figure 5D). The results indicated that 3HF conferred a protection against the NaN₃-induced cytotoxicity in PC12 cells.

Treatment of PC12 cells with 0.03 mM of NaN₃ for 24 h caused a significant increase in the Calcium ion [Ca²⁺]_i levels (Figure 5F, 189.31% of the control value) with a concomitant decrease in the mitochondrial membrane potential (Figure 5G, 46.31% of the control value). When the cells were pretreated with 3HF at the concentrations of 0.05, 1.00, and 1.50 μg/ml for 2 h and further exposed to 0.03 mM of NaN₃ for 24 h, the [Ca²⁺]_i levels were significantly reduced to 164.84, 130.26, and 103.16%, respectively, of the control value, while the mitochondrial membrane potential of the PC12 cells was significantly increased (66.84, 85.26, and 93.17% of the control value, respectively) compared with the NaN₃ group. In addition, the ROS levels indicated a similar pattern of change with that noted in the [Ca²⁺]_i levels (Figure 5E).

The mitochondria complexes I, V and ATP levels were markedly increased in the 1.00 and 1.50 μg/ml 3HF treated-groups, while the latter treatment of 3HF slightly increased complex I activity and ATP levels compared with the model groups (Figures 5H–J).

The activities of COX I, COX II, NF-κB, Caspase-3, and Caspase-9 proteins were detected using an ELISA method in order to clarify the protective mechanism of 3HF on the NaN₃-induced PC12 cells. The levels of COX I (Figure 5K) and COX II (Figure 5L) were significantly reduced when the cells were treated with 0.03 mM NaN₃ for 24 h, while the NF-κB (Figure 5M), caspase-3 (Figure 5N), and caspase-9 (Figure 5O) levels were significantly reduced. Following pretreatment of the cells with 3HF at the concentrations of 0.05, 1.00, and 1.50 μg/ml for 2 h and subsequent exposure to 0.03 mM of NaN₃, the protein (COX I, COX II, NF-κB, Caspase-3, and Caspase-9) expression was approximately reversed to the normal levels.

The morphology of the mitochondria was evaluated by microscopy (phase-contrast, fluorescence, and electron microscopy) following treatment of PC12 cells by 0.03 mM of NaN₃. The morphological assessment revealed swelling, shrinking cells and lower fluorescence intensity (38.19% of control) compared with the control samples, while in the 3HF-treated groups these effects were attenuated (Figures 6A,B), the fluorescence intensities were increased to 43.15, 61.27, and 86.78% of the control value, respectively. Furthermore, we used electron microscopy to determine the ultrastructural changes in the cells following NaN₃ treatment. The data indicated that the nucleolus disappeared and the condensed chromatin was localized to the inner side of an intact nuclear membrane (Figure 6C). The mitochondria exhibited blur appearance and the boundary was not clear with concomitant disintegration and lysis of the cristae in the NaN₃-treated PC12 cells compared with untreated control cells (Figure 6C). Based on the aforementioned observation, it was concluded that 3HF significantly alleviated the NaN₃-induced ultrastructural changes that were characteristic of cellular damage (Figure 6C).