All animal procedures were approved by the Animal Ethics Committee, UNSW, ethics number 13/25B. Five week old female C57BL6/J mice (n = 60) were purchased from Animal Resource Centre, Canning Vale, WA, Australia. Animals were housed (4 mice/cage) at 21°C ± 2°C (12:12 h light/dark) at the Biological Resources Centre facility, UNSW, Australia. Mice were ear punched 2 days after they arrived. A week later groups of mice with similar average body weight were assigned to either a control group (n = 24) that was fed standard rodent chow (11 kJ/g, maximum crude fat 4% total food weight from Gordon’s Stock Feeds, Yanderra, NSW, Australia) or an HFD group (n = 36). The HFD pellets were a semi-pure high fat diet formulation for laboratory rats and mice based on Research Diets D12451 bought from Specialty Feeds, Glen Forrest, WA, Australia (contains 23.5% of total weight is fat and 19MJ/kg digestible energy, Speciality Feeds SF 04-001). Five weeks after dietary intervention the difference in average body weight between chow and HFD groups was 23%. The mice were then distributed across five different groups; again mice were selected so that the average body weights of the different intervention and control subgroups were similar. The five groups were: Chow sedentary: CS; Chow exercise: CEX; HFD sedentary: HS; HFD NMN: HNMN; HFD exercise: HEX (12/group).

After 4 days of training from the age of 11 weeks, CEX and HEX mice underwent treadmill running 6 days (45 min/day) a week for 6 weeks using a Columbus Instruments Exer 3/6 Treadmill (0257-901M). Each session comprised a warm-up period of running at 3 m/min for 2 min then the speed was increased gradually to 15 m/min. In each session after 300 m, mice were rested by running slowly (6 m/min) for 3 min then returned to 15 m/min for another 20 min. Running of each mouse was confirmed visually and mice that stopped running by going on the stationary platform were gently pushed back onto the belt with a paper towel. Each exercise session was carried out an hour before the end of the light phase. All mice in the non-exercise groups experienced the treadmill with the belt turned off for 12 min, 5 days a week to control for environmental effects. NMN (Sigma N3501) was dissolved in PBS and injected i.p. daily 500 mg/kg body weight (Yoshino et al., 2011) for 17 days before sacrifice. Injection of NMN or vehicle (PBS) occurred daily at the end of the light phase. Exercised mice were rested a day before GTT and sacrifice.

At 17 weeks of age animals were weighed and fasted for 5 h (7 am–12 pm). After the establishment of a baseline glucose level (Accu-ChekH glucose meter; Roche Diagnostics, Nutley, USA) mice were challenged with an i.p. glucose bolus (2 g/kg body weight). Blood glucose concentrations were measured at 15, 30, 60, 90, 120, and 180 min after glucose administration. NMN was injected 4 h before the glucose injection.

During the GTT 5 μl of blood was taken before, 15 min after and 30 min after glucose injection. Blood was pipetted with Drummond 5 μl Microcapillary tubes (Sigma–Aldrich) into an Ultra-Sensitive Mouse Insulin ELISA Kit plate (Crystal Chem Inc.) and the assay performed using the standard protocol.

At 18 weeks of age, after 5 h fasting, mice were deeply anesthetized (ketamine/xylazine 200/20 mg/kg, i.p.). NMN or vehicle was injected 4 h before anesthetic. The exercise group had their final session the day before cull. After measurement of naso-anal (N-A) length, a blood sample was collected by cardiac puncture. Mice were then sacrificed by decapitation. Brown adipose tissue (BAT), white adipose tissue (gonadal fat, retroperitoneal fat, inguinal fat), muscle (quadriceps, tibialis, soleus) were dissected and weighed, as well as organs (heart, liver). All tissue was snap frozen using liquid N₂ and then stored at -80°C. Tissues were ground using a Tissue Pulverizer (Bessman) on dry ice and liquid N₂.

Ground liver tissue was homogenized in 1.5 ml of a chloroform–methanol (2:1) mixture using a Precellys 24 homogenizer (Bertin technologies, France) and transferred in a glass tube. Another 2.5 ml of chloroform-methanol mixture was added and samples were mixed for 20–22 h at room temperature on an electronic roller (BTR10-12V Ratek roller). After rolling, 2 mL of 0.6% NaCl was added; samples were vortexed and centrifuged (1,000 × g, 10 min, room temperature). The entire lower phase was transferred in to a new glass tube and evaporated under nitrogen gas in a heating block at 40°C for 40 min. The dried extract was dissolved in 150 μl of absolute ethanol. The triglyceride concentration was then measured using glycerol standard (Sigma, St. Louis, MO, USA). Liver triglyceride contents were determined using a colorimetric assay– TG reagent (Roche Diagnostics). Two hundred microliters of the reagent added with 10 μl of samples and standards in a 96 well plate. The plate was then incubated and gently shaken at 37°C for 6 min before reading with Bio-Rad iMark plate reader (Bio-Rad, Sydney, NSW, Australia).

Proteins levels were quantified by using a Protein Assay Dye Reagent Concentrate (Bio-Rad). A prediluted Protein Assay standard Bovine Serum Albumin (BSA) set (Thermo Scientific) was used to make the standard curve.

The assay was carried out according to the method described by Turner et al. (2007). Briefly, powdered tissue samples were homogenized 1:19 (wt/vol) in 50 mmol/l Tris-HCl, 1 mmol/l EDTA, and 0.1% Triton X-100, pH 7.2, using a polytron homogenizer (IKA T 10 Basic ultra-turrax, VWR instruments Pty Ltd) and were subjected to three freeze-thaw cycles with liquid N₂. Citrate synthase, was determined at 30°C, using a Bio-Rad Imark microplate reader. Enzyme activities are presented as units per mg of protein, where units are defined as micromoles per minute.

Levels of NAD⁺ and its reduced form NADH were measured as previously described with modifications (Zhu and Rand, 2012). First, samples were homogenized in extraction buffer (10 mmol/l Tris/HCl, 0.5% Triton X-100, 10 mmol/l Nicotinamide, pH 7.4) and then centrifuged (12,000 × g for 5 min at 4°C), after which an aliquot of supernatant was taken for protein quantification. After phenol:chloroform: isoamyl alcohol (25:24:1) and chloroform extractions the supernatant was separated in two aliquots. One was used to measure total NAD. The other aliquot was acidified with HCl then neutralized with NaOH on ice to quantify NAD⁺. On a 96 well plate samples were mixed with alcohol dehydrogenase (ADH) in separate wells at room temperature. Total NADH and NAD⁺ were quantified using a Bio-Rad Imark microplate reader; data are presented as pmol of NAD⁺ or NADH per mg of protein.

Protein was extracted as described previously Brandon et al. (2015). Approximately 30 mg of powdered tissue was homogenized in RIPA buffer (65 mmol/l Tris (pH 7.4), 150 mmol/l NaCl, 5 mmol/l EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 10% glycerol, 1 μg/ml aprotinin, 1 μg/ml leupeptin, 10 mmol/l sodium fluoride, 1 mmol/l sodium vanadate, 1 mmol/l PMSF, and 50 mmol/l nicotinamide) using a Precellys 24 (Bertin Technologies). After lysis and homogenization the samples were incubated (4°C) for 2–3 h, then centrifuged at 12,000 × g to remove any insoluble particles and protein concentration was determined.

Clarified lysates were then diluted with 2X Laemmli buffer and heated to 65°C for 15 min. BLUeye Prestained Protein Ladder was used as molecular weight ladder. Equal amounts of protein (20 ug/well) were electrophoresed through a 4–15% precast gel (Criterion TGX, Bio-Rad) for 45 min at 150 V in running buffer (25 mmol/l Tris base, 192 mmol/l glycine, and 1% SDS, pH 8.3). Proteins were transferred via a semi dry transfer process with a Trans Blot Turbo System (Bio-Rad) onto PVDF membranes (Bio-Rad). Membranes were then blocked in 4% BSA in TBS-Tween for 1 h, then incubated overnight at 4°C with primary antibodies used at 1:1000 dilution; Mitoprofile total OXPHOS rodent antibody cocktail (MitoScience); PGC-1α (3G6) Rabbit mAb (Cell Signaling). The membrane was subjected to three 10 min washes with TBS-Tween, and incubation with appropriate secondary antibody (Cell Signaling) in 2% skim milk blocking solution in TBS-Tween at room temperature for 1 h, followed by three 10 min washes with TBS-Tween. For detecting bands, membranes were exposed to Clarity Western ECL Substrate (Bio-Rad) and visualized on a Bio-Rad ChemiDoc XRS. Membranes were stripped using Reblot Plus (10X) (Millipore) for 10 min at room temperature. Membranes were re-blocked and overnight at 4°C with GAPDH antibody (14C10) Rabbit mAb (Cell Signaling). The subsequent steps with this housekeeper blot were the same as described above for the OXPHOS cocktail and PGC-1α blots.

Mitochondrial DNA copy number was measured by qPCR. DNA was extracted from muscle and liver. For this, 25–30 mg of tissue was subjected to lysis overnight (10 mmol/l Tris, 100 mmol/l NaCl, 10 mmol/l EDTA, 0.5% SDS pH8), containing proteinase K (1 μg/ul). The lysate was then mixed with phenol:chloroform and DNA extracted. Spectrophotometric quantification using Biospec-nano spectrophotometer (Shimadzu Biotech, Nakagyo-ku, Kyoto, Japan) determined DNA concentration and purity. A SYBR green Qpcr (SensiFAST SYBR, Bioline) was used to determine mitochondrial DNA copy number. Two primers were used, 36B4 (F = ACTGGTCTAGGACCCGAGAAG; R = TCAATGGTGCCTCTGGAGATT) for the nuclear genome (amplifies a region of the Rplp0 gene) and Cytb (F = CCCACCCCATATTAAACCCG; R = GAGGTATGAAGGAAAGGTATTAGGG) for the mitochondrial genome. Cytb and 36B4 levels were quantified with Roche LightCycler480 software, whereby standard curves were produced for each gene using templates generated by serial dilution of a sample made by combining an aliquot of DNA from each of the 60 samples. All sample PCRs were done in duplicate, normalization was done by dividing Cytb by 36B4.

By using Tri-reagent (Sigma, St. Louis, MO, USA), RNA was extracted from 30 to 32 mg of tissue and stored at -80°C. RNA concentration and purity was determined (Biospec-nano spectrophotometer Shimadzu Biotech, Nakagyo-ku, Kyoto, Japan). One microgram of RNA was treated with DNase I Amplification Grade (Invitrogen; Cat# 18068015) and reverse transcribed to cDNA using an Omniscript Reverse Transcription kit (Qiagen, Valencia, CA, USA) following manufacturer’s instructions, and stored at -30°C. Expression of the following target genes: Sirt1 (F = TGTGAAGTTACTGCAGGAGTGTAAA; R = GCATAGATACCGTCTCTTGATCTGAA), Sirt3 (F = GGTTGAAGCTTATGGA, R = AGGTTTTGAGGCAGGGA), PGC-1a (F = TATGGAGTGACATAGAGTGTGCT, R = CCACTTCAATCCACCCAGAAAG), Cytb (Same primers as used for mtDNA copy number) was measured using the Roche LightCycler480. Standard curves were produced for each gene using templates generated by serial dilution of a combined cDNA sample from each of the 60 samples. All sample PCRs were done in duplicate, and all genes of interest were normalized by dividing by the geometric mean of two control genes Gapdh (F = AGGTCGGTGTGAACGGATTTG, R = TGTAGACCATGTAGTTGAGGT) and Ywhaz (F = GAAAATGAAGGGTGACTACTAC, R = CTGATTTCAAATGCTTCTTG) which had been determined with Normfinder software (MOMA) to be the most stable of 4 tested control genes (Hprt and Tbp being the other genes). No difference in expression of housekeeper genes was observed across treatment groups.

Results are expressed as mean ± SEM. All data were analyzed using one-way ANOVA, followed by post hoc LSD tests using SPSS. If data were not normally distributed they were log transformed to achieve normality before they were analyzed. Different superscripts represent significant differences between the designated groups (*Diet Effect; ^XExercise effect; ^∧NMN effect). Significance levels are indicated; *p < 0.05, **p < 0.01, ***p < 0.001.

At 5 weeks of age, before separating the mice onto different diets (Chow or HFD), average body weight was 16.63 ± 0.12 g. A week later the mice selected for chow and HFD fed groups weighed 16.83 ± 0.81, and 16.71 ± 0.89 g, respectively. After 6 weeks of the diet, and before the exercise intervention started HFD fed animals were 23% heavier than chow-fed animals (21.94 ± 1.98 g vs. 17.90 ± 0.76 g). Increased weight gain by HFD fed animals continued until the end of the experiment (Figure 1; Table 1). We observed a slight (non-significant) reduction of the body weights of the exercised and NMN-treated mice (Table 1). There were no differences in tissue weights between the CS and CEX groups, either as net values or after correction for body weight. However, dissected fat pads, muscles and liver were significantly higher in HFD sedentary animals compared to those consuming chow. In those consuming HFD, both NMN and exercise interventions reduced net liver mass (Table 1) but this difference did not remain after correction for body weight. In the HEX group, exercise reduced net fat pad and liver mass compared to HS, and this was maintained for gonadal and inguinal pads when standardized by body weight. (Table 1). Quantitation of liver triglyceride revealed that the HFD increased liver triglyceride content by approximately 50%, and both exercise and NMN treatment significantly reduced liver triglyceride in the HFD-fed groups to around 20% above the level seen in mice consuming control diet (CS; Figure 2). This demonstrates that both interventions partially reversed the HFD-induced increases in liver triglyceride content. Exercise had no significant impact in chow fed mice (Figure 2).

Glucose tolerance test results shown in Figure 3 demonstrate that both interventions improved HFD-induced glucose intolerance. The basal glucose concentration and time taken to clear injected glucose was significantly higher in HFD sedentary animals compared to chow fed animals (Figure 3A). The HEX and HNMN groups had reductions in plasma glucose concentration compared to HS from 15 min after glucose injection until 180 min. However, there was no difference in the GTT between the CS and CEX groups. The beneficial effects of NMN and exercise in increasing the rate of glucose clearance from the blood of obese mice were also significant when the area under the curve was assessed (Figure 3B, both P < 0.01). To test insulin concentrations under fasting conditions or after a glucose bolus we measured plasma insulin during the GTT. High fat diet fed animals showed significantly higher plasma insulin concentrations than chow fed animals; neither exercise nor the NMN intervention had any impact on insulin concentrations during the GTT (Supplementary Figure S1). This may suggest that the insulin peak occurred prior to the 15 min time-point.

NAD⁺ levels were measured in both muscle and liver. Previously it was shown that 7 days of NMN injection increased NAD⁺ levels in livers of diabetic mice (Yoshino et al., 2011), and exercise increased NAD⁺ in rodent skeletal muscle (Cantó et al., 2010; Koltai et al., 2010). In our experiment there was a trend for a reduction in NAD⁺ by HFD but a significant increase by NMN injection in both tissues, with the greatest increase in liver (Figures 4A,B). Exercise also increased NAD⁺ levels in muscle but not in liver compared to the HFD sedentary group. In muscle and liver, NADH was significantly increased by HFD in both tissues, and this was ameliorated by exercise in both tissues (significantly in muscle; Figures 4C,D). In liver the HNMN group had a further significant increase of NADH (Figure 4D), possibly due to the extremely high levels of reduced and oxidized NAD in the tissue.

We measured citrate synthase activity in both muscle and liver (Figures 5A,B). In muscle, HFD consumption led to a reduction in citrate synthase activity, which was ameliorated by exercise but not by NMN. In liver, there was also a trend for reduced citrate synthase activity due to HFD associated obesity (P = 0.086) but both exercise and NMN led to significant increases relative to the HFD vehicle group (Figure 5B, both P < 0.001).

To investigate mitochondrial biogenesis, we measured mitochondrial DNA (mtDNA) copy number in muscle and liver (Figures 5C,D). Consumption of HFD significantly increased copy number in liver, and there was a similar trend in muscle (P = 0.087). There were contrasting effects of NMN treatment in muscle and liver of the HFD mice as mtDNA copy number was increased in the former and decreased in the latter.

Five different complexes are involved in oxidative phosphorylation in the mitochondria (Huss and Kelly, 2005). We measured the total levels of a representative protein from complexes I, II, III, and V. In muscle we found no changes in proteins from complexes I, II, and V due to HFD or the two interventions. However, complex I and II proteins were increased in CEX compared to CS mice (Supplementary Figure S2). In liver, there were no diet-induced changes in complexes I, II, III, and V. However, exercise in obese mice decreased the levels of complexes II and III proteins (Supplementary Figure S2). PGC-1α is a master regulator of mitochondrial function and biogenesis. However, we did not detect any differences in total level of the protein between groups (Supplementary Figure S2).

We also assayed mRNA levels of genes that are responsible for mitochondrial biogenesis, mitochondrial content and function. No HFD or exercise or NMN intervention-induced transcriptional changes were seen in Sirt1, Sirt3, PGC-1α or Cytb (Supplementary Figure S3).