The Animal Ethics Committee of the Institute of Chinese Medical Sciences, University of Macau approved this study (Ethical NO. ICMS-AEC-2015-20). All of the procedures performed on the animals were carried out in strict accordance with the ethical guidelines of Institute of Chinese Medical Sciences, University of Macau.

C57BL/6J mice aged 8–10 weeks were housed in standard cages (temperature: 21 ± 1°C; humidity: 60 ± 5%) with free access to food and water. The animal room was subjected to be 12-hour light/12-hour dark cycle (lights on at 08:00). All the mice were euthanized by rapidly cervical dislocation.

We maintained wild-type zebrafish according to the standard procedures described in the Zebrafish Handbook (Westerfield, 1995). The stocks were maintained at a temperature of 28.5 ± 1°C in a 14-hour light/10-hour dark cycle in embryo medium (13.7 mM NaCl, 540 μM KCl, 25 μM Na₂HPO₄, 44 μM KH₂PO₄, 300 μM CaCl₂, 100 μM MgSO₄, 420 μM NaHCO₃, pH 7.4). The zebrafish were euthanized with overdose of MS-222 (3-Aminobenzoic acid ethyl ester methanesulfonate) after locomotor behavioral monitoring.

We obtained primary cortical neurons from E16 mice embryos. Briefly, the cortical tissue was dissected from embryonic brain tissue in ice-cold DMEM/F12 medium and digested in 0.05% trypsin for 15 min at 37°C. The cell density was adjusted to 5 × 10⁵/mL. Next, the cells were planted in poly-L-lysine and Laminin (Sigma–Aldrich, St. Louis, MO, USA) coated culturing ware in neurobasal medium with 2% B-27 supplement, 0.5% GlutaMAX-I^TM supplement, and 1% penicillin-streptomycin (Gibco, USA). The culture medium was half replaced every 3 days.

Pentylenetetrazol was purchased from Sigma–Aldrich and freshly prepared prior to use. OtoN was isolated from C. otophyllum and identified by the Faculty of Life Science and Technology, Kunming University of Science and Technology (Kunming, China); its purity exceeded 98% (Figure 1).

We cultured the primary cells for 7 days in vitro (DIV) prior to treating them with isometric fresh medium, PTZ (30 mM), and PTZ (30 mM) + OtoN of different dosages.

The mice were injected intraperitoneally with phosphate buffer solution (PBS), PTZ (30 mg/kg), and PTZ (30 mg/kg) + OtoN of different dosages in corresponding groups. These injections were conducted between 09:00 and 10:00 every morning and repeated for 7 days.

Zebrafish larvae at 6 days post fertilization (dpf) were pretreated with fresh embryo medium with different dosages of OtoN for 24 h and then moved into medium or 10 mM PTZ diluted in medium.

The drug-treated neurons were fixed with 4% paraformaldehyde (Sigma–Aldrich) at room temperature. After three washes with PBS, the cells were permeabilized with blocking buffer (0.3% Triton X-100, 3% BSA, and 10% goat serum in PBS). The cells were then incubated with primary antibodies, including anti-MAP2 antibody (Novex, San Diego, CA, 1:500) or anti-β-Tubulin antibody (Invitrogen, CA, 1:500) and anti-GFAP antibody (Abcam, USA, 1:1000) at 4°C overnight, and followed with corresponding secondary antibodies for 1 h at room temperature in the dark. Finally, the cell nuclei were counterstained with 5 μg/ml of DAPI (Sigma–Aldrich) for 15 min. The samples were photographed using an InCell2000 Analyzer (GE Healthcare, USA).

Cell Counting Kit reagents (Beyotime, Shanghai, China) were added to the culturing medium (1:10) in each well of a 96-well plate. After incubating the mixture for 4 h at 37°C, the absorbance was measured using a FlexStation III microplate reader (Molecular Devices, USA) at a wavelength of 450 nm.

LDH enzyme activity was assayed using a Cytotoxicity Detection Kit (Roche Mannheim, Germany). 100 μL of the reaction mixture of the kit was added to the treated neurons in a 96-well plate followed by incubation at 37°C for 30 min in a dark environment. The absorbance was determined using a microplate reader (Molecular Devices) at a wavelength of 490 nm.

The cells were lysed in RIPA lysis buffer containing 1% protease inhibitor cocktail and 1% phenylmethanesulfonyl fluoride. For the in vivo study, the cerebral cortex tissues were gently dissected from the drug-treated mice and homogenized to suspension, and then followed the same lysis step as described above for the cells. We determined the protein concentration of the lysates using a BCATM Protein Assay Kit (Pierce, Rockford, IL, USA). The proteins were separated using SDS-PAGE and then transferred to polyvinylidene fluoride membranes, blocked with 5% non-fat milk for 2 h at room temperature. The immunoreactions were carried out using poly ADP-ribose polymerase (PARP), Bax and Bcl-2 antibodies (Abcam, 1:1000), and then the membranes were probed with the corresponding secondary antibodies for 1 h at room temperature. Specific protein bands were visualized using the ECL Select Western Blotting Detection Reagent (GE Healthcare, Buckinghamshire, UK). Equal protein loading was verified by probing with anti-GAPDH antibodies.

The zebrafish larvae were placed individually into 96-well microplates with 12 larvae in each group and habituated to their new environment for 30 min. The larvae were then treated with embryo medium or 10 mM PTZ in each well. After being pretreated with the indicated compound for 15 min in an incubator (28.5 ± 1°C), the plates were housed inside the Zebrabox and monitored using a ZebraLab video tracking system (Viewpoint Life Science, France). We recorded the swimming behaviors of the larvae for 30 min. In the pre-experiments, we defined three different velocity ranges: inaction (0–4 mm/s), small movement (4–20 mm/s), and large movement (above 20 mm/s).

Approximately 55 zebrafish larvae at 7 dpf in each group were homogenized for 5 min. Then, the total RNA was extracted from the tissues using the RNeasy Plus Mini Kit (Qiagen, Germany) in accordance with the manufacturer’s instructions. The RNA concentration and purity were measured using NanoVue Plus ROW (GE Healthcare). Then, the total RNA was reverse-transcribed to single-strand cDNA using a PrimeScript RT Reagent Kit (Perfect Real Time, Japan). Next, we carried out quantitative real-time (RT) PCR on a ViiA 7 RT PCR System (Life Technologies, Carlsbad, CA, USA) according to the SYBR assay. The following primer sequences were selected (Marques et al., 2008; Deng et al., 2009; Santos et al., 2014; Vanhauwaert et al., 2014) : zebrafish β-actin, ACGATGGATGGGAAGACA and AAATTGCCGCACTGGTT; zebrafish c-Fos, TTACCCGCTCAACCAGACTC and TGACAGTTGGCACGAAAGAG; zebrafish Bcl-2, TCACTCAGTTCAGACCCTCAT and ACGCTTTCCACGCACAT; zebrafish Bax, TCACTCAGTTCAGACCCTCAT and ACGCTTTCCACGCACAT. All of the oligonucleotide primers were synthesized by Invitrogen. Expressions of these genes were normalized to β-actin using the relative quantification method.

Data were expressed as mean ± standard deviation (SD). We analyzed the statistical significances using one-way analysis of variance (ANOVA) with the SPSS 17 software (Statistical Package for the Social Sciences, Chicago, IL, USA). ^∗/^ΔP < 0.05 and ^∗∗/^ΔΔP < 0.01 were regarded as being statistically significant.

Qualifying the purity of neuronal cells is crucial for follow-up research as well as for ensuring the reliability of the results obtained. We first performed the qualification test. In the immunocytochemistry studies, the cortical neurons were stained with anti-MAP2 antibody (green) while the presence of astrocytes was marked by anti-GFAP antibody (red). The nuclei were counter stained with DAPI (blue). As shown in Figure 2A, no astrocytes were found, which revealed that the purity of the neuronal cells was high enough (>95%) for our research.

Pentylenetetrazol is a well-demonstrated chemical inducer that mimics epileptic seizures. Exposure to PTZ (24 h) may result in toxicity to neuronal cells, such as an altered morphology, neurotransmission imbalance and cell death (Naseer et al., 2009). As shown in Figure 2B, after treatment of PTZ at concentrations of 7.5, 15, 30, and 60 mM, the cell morphologies were damaged in a dose-dependent manner. The cell survival rates were reduced to 83.06 ± 2.61, 55.69 ± 10.48, 30.68 ± 4.41, and 27.99 ± 3.91%, respectively (Figure 2C). Compared with cells treated with 7.5 and 15 mM PTZ, the group treated with 30 mM PTZ exhibited more visible injury and a lower cell survival rate. Moreover, we noted that 30 mM PTZ maintained basic cellular shape and yielded a similar survival rate of neurons as in the 60 mM group. Therefore, 30 mM was selected as the dose for inducing neurotoxicity in PTZ-treated neurons.

In the previous screening of pure compounds from C. otophyllum, we found that OtoN could remarkably improve PTZ-induced neurotoxicity. β-Tubulin is a major component of the eukaryotic cytoskeleton, and fluorescence images adequately illustrate the cell morphology. In this study, we immunostained the cells with neuronal β-Tubulin marker (green) and nuclear DAPI tag (blue). As indicated in Figure 3A, the majority of neurons in the PTZ group floated, and the existing cells were adherent loosely and became shrinkage. Moreover, the synapses of these cells were extremely injured as lysing in medium. OtoN (5, 10 μg/mL)-involved groups exhibited more neuronal cells that we preserved and denser maintained synapses than the PTZ group.

We conducted CCK-8 assays to evaluate cell viability. After drug administration, the two doses of OtoN attenuated PTZ-induced cell death by increasing the cell survival rates from 32.45 ± 5.53 to 54.41 ± 8.42 and 66.26 ± 7.58%, respectively (Figure 3B). In addition, leakage of LDH is a well-demonstrated sign of injury on cellular membrane (Mohamed et al., 2014), and our results revealed that the involvement of OtoN (5, 10 μg/mL) obviously decreased the intracellular LDH efflux level (1.86 ± 0.04, 1.53 ± 0.05 fold) caused by PTZ (3.30 ± 0.07 fold) (Figure 3C).

Since apoptosis is a common cell-death pathway, we tested the levels of several related proteins to verify whether PTZ induced apoptosis as well as the protective effects of OtoN. Western blot analysis of neuronal cells (Figure 4A) revealed that PTZ obviously induced the upregulation of the PARP cleaved fragment 3.10 ± 0.35 fold, indicating the induction of apoptosis. Meanwhile, the Bax/Bcl-2 ratio, an indicator that is generally regarded as determining the susceptibility of cells to the induced apoptosis, was also upregulated 2.31 ± 0.30 fold after treatment with PTZ. With OtoN exposure, the upregulation trends of the two indicators were significantly decreased (Figures 4C,D), indicating that OtoN decreased PTZ-induced cell apoptosis. c-Fos has been reported to be involved in response to neuronal activation. Our results revealed that c-Fos was also activated during PTZ treatment and that OtoN may decrease PTZ-induced cortical neuron activation (Figure 4B).

To confirm the results obtained from the primary neuronal cells, we further detected the expression levels of the proteins noted above in the mouse cerebral cortex in vivo. As shown in Figure 5, PTZ obviously induced the upregulation of PARP cleavage and Bax/Bcl-2 ratio, indicating the induction of apoptosis in the mouse cerebral cortex. Similarly, OtoN at concentrations of 2.5 and 5 μg/mL obviously abated PTZ-induced upregulation of PARP cleavage and decreased the Bax/Bcl-2 ratio (Figures 5C,D). Meanwhile, PTZ-induced c-Fos production was also decreased with co-treatment with OtoN (Figure 5B). These results are consistent with the outcomes on neurons in vitro.

In a locomotor assay, PTZ-treated zebrafish exhibited high-velocity epilepsy seizures that were significantly different from those of the control group. In this case, we presented the results according to large movements, which were visible as a red line in the tracking images. As shown in Figure 6A, the activities of the zebrafish in the PTZ group were significantly increased compared to those of the control group, and the OtoN treatment decreased the severe behaviors (the red line) on the contrary. OtoN (12, 25 and 50 μg/mL) reduced the fast swimming distance to 61.43 ± 10.09, 121.1 ± 13.65, 135.5 ± 22.36 mm from 222.2 ± 21.7 mm for the PTZ group (Figure 6B).

Beside behavior trial, we next tested gene expression in zebrafish to confirm the prior results of apoptosis and activation. According to the results of RT PCR, the PTZ model exhibited an obvious increase (10.77 ± 1.24 fold) of c-Fos compared with the control group (Figure 6C). OtoN (12, 25 and 50 μg/mL) pretreatment downregulated the elevated c-Fos expression (4.22 ± 0.07, 4.01 ± 0.71, and 3.48 ± 0.63 fold, respectively). In terms of the apoptotic aspect, the ratio of Bax/Bcl-2 was also significantly reduced by OtoN from 7.75 ± 0.45 fold in the PTZ group to 3.20 ± 0.56, 2.67 ± 0.70, and 2.86 ± 0.26 fold at concentrations of 12, 25 and 50 μg/mL, respectively (Figures 6D,E).