Albinism is a genetic disorder caused by mutations in specific genes related to pigment production, resulting in the lack of melanin (1). It is inherited in an autosomal recessive manner (1). The prevalence of albinism is 5–10 per 100,000 in the general population. The prevalence is as high as 1 in 1,400 in some African countries. In contrast, the prevalence of albinism in China is approximately 1 in 18,000 (2). Albinism represents a genetically heterogeneous group of disorders characterized by impaired melanin biosynthesis. Contemporary classification divides albinism into two broad categories: syndromic albinism, which involves multi-system manifestations [e.g., Hermansky-Pudlak syndrome [HPS] with bleeding diathesis and pulmonary fibrosis, and Chediak-Higashi syndrome [CHS] with immune dysfunction], and non-syndromic albinism, comprising oculocutaneous albinism (OCA1-8) and ocular albinism (OA), primarily affecting pigmentation in the eyes, skin, and hair (1, 3, 4). This refined classification underscores the molecular diversity and clinical complexity of albinism.

TOCA is divided into 8 subtypes (OCA1-8) based on the pathogenic genes (1). OCA2 is the most prevalent form worldwide (5). OCA2 exhibits variable clinical features, characterized by mild-to-moderate hypopigmentation of the hair, skin, and iris. Notably, pigmentation levels often increase with age; thus, OCA2 has been classified as incomplete albinism (6). This dynamic phenotypic progression underscores the unique molecular pathogenesis of OCA2, where residual melanin synthesis may persist over time despite underlying genetic defects. OCA2 is specifically caused by mutations in the OCA2 gene. There are different mutations of the OCA2, including missense, deletion, and frameshift mutations (7). In this study, WES was conducted on a newborn with suspected albinism. A novel mutation of the OCA2 was identified, confirming the diagnosis of OCA2.

Melanocytes are widely distributed in several organs, such as the skin and eyes. They can synthesize and release melanin to reduce ultraviolet damage. Melanin is synthesized in melanosomes, and its maturation occurs through four stages. Stages I and II are premelanosomes. Melanin synthesis and accumulation begin in stage III. Melanin accumulation will be complete in stage IV (8–10). Albinism is a group of hereditary disorders caused by mutations of genes involved in melanin synthesis, leading to the lack of melanin in the eyes, skin, and hair. Affected individuals have lighter or no color in the corresponding areas. The skin lacks pigment protection, making it sensitive to ultraviolet and prone to skin cancer. Patients with albinism suffer from photophobia but have normal night vision. They may also suffer from decreased visual acuity, have underdeveloped fovea, exhibit changes in the optic chiasma, and experience nystagmus. The OCA2 phenotype is caused by mutations of the OCA2 (also known as the P gene). It is located on chromosome 15q11.2-q12, and includes 25 exons and 24 introns, spanning 345 kb in length. The protein translation starts from the second exon, encoding a transmembrane protein composed of 838 amino acid residues with a molecular weight of 10 kDa, functioning as a transporter on the melanosome membrane (11). The OCA2 protein has 12 transmembrane domains (12) and 3 glycosylation sites (13), participating in the transportation of tyrosine within melanocytes. It is a precursor for melanin synthesis. The P protein can regulate the pH of melanosomes and control melanosome maturation, serving as a key checkpoint for determining human skin color (14–16). In this study, the mutation of the OCA2 occurred at EX8/CDS7, leading to a deletion mutation in the encoded protein (Met288_Leu295del). This mutation site has not been previously reported and represents a novel mutation site. Compared to the normal melanosome membrane protein, the mutant protein lacks 8 amino acids, and the harmfulness prediction suggested it was a harmful mutation. The site was highly conserved across species. Mutations at highly conserved sites also increase disease risk, leading to abnormal protein function, abnormal tyrosine transportation, inhibition of melanin formation, and albinism.

OCA2 is more common in Africans and African Americans, with an incidence of 1/37,000 in Caucasians, 1/3,900 in Bantu-speaking people in southern Africa, and 1/15,000 in African Americans (17). The clinical manifestations of OCA2 are relatively mild and affected individuals have light yellow hair at birth due to mild-to-moderate pigmentation, which may increase with age; however, skin pigmentation generally does not increase with sun exposure. The affected patients may also suffer from nystagmus, strabismus, and decreased visual sensitivity due to abnormalities in the visual nerve conduction pathway. The phenotypic variation of OCA2 is wide. Brown OCA may also occur, mainly in people of South African descent (18). A molecular epidemiological survey of 179 patients with albinism by Chinese scholars showed that OCA2 accounts for 11.7% of albinism in China (19). The OCA2 regulates eye color mainly via the upstream gene HERC2. The key site rs-12913832 directly affects the expression of P protein, thereby controlling melanin synthesis in the human eye and regulating eye color (20–23). This child was of Asian descent, with pinkish-white skin after birth, mild pigment deficiency, and golden yellow hair. It is difficult to diagnose albinism solely based on clinical presentation. A complete fundus examination indicated widespread lightening of iris pigment, retinal pigment, and macular pigment. Subsequent WES gene testing identified the mutation of the OCA2. Sanger validation of the mutation site in the parents of the proband showed that each parent had one chromosome with a deletion mutation, both heterozygous with no clinical phenotype. The proband inherited the mutated chromosome from both parents, becoming homozygous and suggesting that c.863_886del is pathogenic. It is also necessary to be vigilant for Prader-Willi syndrome (PWS) and Angelman syndrome (AS) when observing reduced pigmentation in the skin and hair of children. PWS is a complex genetic disorder affecting several systems. It is caused by the lack of expression of paternal genes in the 15q11.2-q13 region. PWS presents with typical facial features: narrow forehead, almond-shaped eyes, narrow nose, thin upper lip, and downturned corners of the mouth, difficulty feeding in infancy, obesity in childhood, delayed development, cognitive impairment, and poor gonadal development (24). The main cause of AS is the abnormality of maternal genes in the 15q11-13 region. The main clinical features of AS include intellectual disability, motor disorders, language delay, abnormal gait, happy behavior, microcephaly, hyperactivity, epilepsy, and abnormal electroencephalogram (25). The OCA2 is also located in the 15q11-q13 region. Studies have found that the OCA2 in patients with PWS or AS is hemizygous, and due to the loss of the missing segment of the OCA2, patients with PWS or AS usually exhibit hypopigmentation (26). Comorbidity occurs after the deletion of paternal or maternal alleles in the 15q11-q13 region of chromosome 15; therefore, some patients with PWS and AS exhibit the clinical manifestations of albinism (27). Albinism usually does not affect life expectancy, development, intelligence, and fertility, but photosensitivity limits the outdoor activities of patients. Treatment alleviates the symptoms, improves the quality of life, and decreases the risk of complications. This child had no specific facial features and was followed for 7 months after birth, showing normal development. It is necessary to be vigilant for other comorbidities among children with delayed development.

This study analyzed the mutation sites and phenotypes of OCA2 in the proband and her family. The novel OCA2 deletion mutation, NM_000275.2:c.863_886del TGAGCAGGACCTTTGAGGTACTGA(p.Met288_Leu295del), reported for the first time in this study, expanded the mutation spectrum of the OCA2. These findings provide a basis for future research on the role of OCA2 and genotype-phenotype correlations and strengthen clinicians’ understanding of the disease.