Free-living amoebae have more than 40 genera, but only four were found related to human diseases, including Acanthamoeba spp., Balamuthia mandrillaris, Naegleria fowleri (N. fowleri), and Sappinia dialoidea (1). Thereinto, the infection of N. fowleri is known to cause an acute and deadly central nervous system disease-primary amoebic meningoencephalitis (PAM), which was first reported in 1965 (2). In the past 55 years, the comprehensive understanding of N. fowleri such as its ecology, pathogenesis, epidemiology, and clinical management have been reviewed by numerous researchers (3, 4). However, there still lacks effective diagnosis methods to discriminate PAM from bacterial meningoencephalitis and no drugs are found aimed at this infection (5). Making matters worse, increasing novel cases were reported in more areas worldwide, including Asia (6).

Since 1993, only a few cases have been diagnosed as PAM caused by N. fowleri in East Asia (7). In 2011, an N. fowleri infection case was reported in Taiwan, and one thermal spring was found contaminated by N. fowleri in their later detection (8). In the Chinese mainland, there are three cases suspected as PAM based on amoebic trophozoites in the cerebrospinal fluid (CSF) or brain tissue after death, which is reported in a Chinese journal without an English citation version. However, due to a lack of other potent evidence, a precise diagnosis of N. fowleri infection was not put forward. Until August 2016, a 42-year-old male was first diagnosed as PAM with N. fowleri infection in the Chinese mainland and unfortunately passed away 14 days after symptoms occurred (9, 10). Later in 2020, reports showed two children (a 2-year-old in Lanzhou and a 13-year-old in shanghai) diagnosed as Granulomatous amoebic encephalitis (GAE) caused by Balamuthia mandrillaris (11, 12). According to our retrieval, no other related cases were reported in mainland China. Here, we report the first pediatric N. fowleri infection case with an extremely acute disease course in the Chinese mainland. Besides, this study also summarizes 16 Naegleria infection cases, including their clinical indicators and diagnosis methods, which can assist doctors in identifying this rare and emerging infection in time.

On August 17, 2020, a 9-year-old boy with fever (T_max 40.2°C) was admitted to the Third Xiangya Hospital, Changsha, China. His disease broke out on the 16th with fever and vomiting. Upon admission, the blood test showed leukocytosis of 18.24 × 10⁹/L (92.1% neutrophils). He was treated with Ibuprofen and piperacillin-tazobactam, but the condition did not improve. At 12:00 that day, the child appeared with a headache and vague consciousness and was transferred into the pediatric intensive care unit (PICU) for further treatment immediately. Besides, the child exhibited repetitive high fever, hypertension (149/86 mm Hg), relatively slow heart rate (62/min), positive meningeal irritation signs, and neck stiffness. No positive findings were found in his personal history and contact history of infectious diseases. Therefore, the initial diagnosis was intracranial infection with intracranial hypertension. To ascertain the infection causes, several examinations were adopted, including CSF examination, head computed tomography (CT), and routine blood test. A lumbar puncture discovered that the CSF was purulent in appearance, and the CSF pressure was higher than 300 mmH₂O. Elevated levels of white blood cells (WBCs 3.25 × 10⁹/L, 70% multi-nucleus), the protein concentration of 2,606 mg/dL, glucose concentration of 0.9 mg/dL in the CSF, and the blood glucose was 127.8 mg/dL at the same time. MRI showed unremarkable T2 flair and T1 enhancement of the boy's brain leptomeningeal linear enhancement in the occipital lobe (Figure 1). The results of routine blood checks, CRP, PCT, and ESR after admission are shown in Supplementary Table S1. Furthermore, hepatic function, renal function, electrolyte results, and respiratory virus examination were all normal.

Based on these results and clinical experience, the diagnosis of acute bacterial meningitis was considered. Targeted actions including “Ceftriaxone + vancomycin” anti-infection, “mannitol” to reduce intracranial pressure, “methylprednisolone” for anti-inflammatory purpose, “human immunoglobulin” to improve the body's passive immunity, and limit fluid volume were carried out. However, instead of improvement, at 23:00 on 18th, the child's blood pressure and heart rate suddenly decreased with mydriasis appearance and autonomous respiration arrest. The patient was judged to develop a cerebral hernia. Although the heart rate and blood pressure were stabilized shortly after treatment, the pupillary light reflex and autonomous respiration did not return. The patient's family decided to cease treatment. After removing the life support apparatus, the patient was pronounced dead on 19th. The entire process is briefly exhibited in Figure 2.

According to the patient's symptoms and examinations, a reasonable diagnosis of “acute bacterial meningitis” could be given. However, the disease progressed quickly and did not respond well to our treatment. Moreover, the CSF and blood culture were all negative. Besides, no significant inflammation in the mastoid, paranasal sinuses, and middle ear were found by both rhinoscopy and CT. There was also no skin infection lesion or skull defect by re-examination. So, the pathogen and its infection pathway remained unknown.

The CSF and blood samples were sent for further detection using metagenomic next-generation sequencing (mNGS) in Hugo-Biotech Company, Beijing. The DNA was extracted and purified from 200 uL CSF supernatant and 200 uL blood plasma according to the manufacturer's instruction of TIANGEN kit with DNA library constructed using QIAseq^TM Ultra low input library kit. Qualified libraries with different barcode labeling were pooled together and then NGS was conducted on the Illumina Nextseq platform. In the CSF and blood sample, when the human genome was excluded, the NGS identified 42,899 (out of 44,706) and 1,337 (out of 3025) specific sequence reads belonging to N. fowleri genome, respectively (Figure 3). As N. fowleri DNA sequences occupied 95.96 and 44.2% of the whole microbe genome in the CSF and blood sample, it was reasonable to consider PAM as the diagnosis. To verify the results, PCR detection of N. fowleri and Sanger sequencing were adopted. Using the specific primers CAAACACCGTTATGACAGGG and CTGGTTTCCCTCACCTTACG covering ribosomal 5.8S ribosomal RNA gene and internal transcribed spacer 2 gene, the electrophoresis result indicated the specific band was about 183 bp, which was the positive band of N. fowleri infection in the CSF and blood sample. Besides, the brightness of the PCR amplification band was consistent with the difference in the number of reads detected by NGS (Figure 4a). As for the NCBI blast, the nucleotide sequence in 183 bp showed 99% homology with the reference sequence, indicating N. fowleri infection in high confidence (Figure 4b). Moreover, dead amoebae were also found by microscopic observation after smearing the CSF through Wright-Giemsa-stained CSF slides (Figure 4c). In addition, patient history collected from his family showed that the child went to a public swimming pool for recreation and was choked 6 days before the disease occurred. Then, the child was deemed to have sinusitis, but an ear-nose-throat (ENT) examination showed no evidence. Furthermore, the fishy and odorous secretions in the oral and nasal cavity were found during intubation, but unfortunately these secretions were not sent for pathological examination the first time. The patient was finally diagnosed as primary amoebic meningoencephalitis by N. fowleri.

In this study, we reported the first pediatric N. fowleri infection case in the Chinese mainland. The child was misdiagnosed as “acute bacterial meningoencephalitis” until the NGS results came out. Patients with N. fowleri infection also experienced a 1–7 day disease latency period, and then initial symptoms occurred such as fever, headache, and vomiting, which is not distinctive from bacterial meningitis (13). The misdiagnosis as “bacterial meningitis” frequently happens, which is one of the factors leading to its high mortality. Therefore, we summarize and discuss how to differentiate N. fowleri related primary amoebic meningoencephalitis from bacterial meningoencephalitis, which may help the early diagnosis.

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author/s.

The studies involving human participants were reviewed and approved by the Ethical Review Committee of Third Xiangya Hospital. Written informed consent to participate in this study was provided by the participants' legal guardian/next of kin. Written informed consent was obtained from the individual(s), and minor(s)' legal guardian/next of kin, for the publication of any potentially identifiable images or data included in this article.

WZ and YO designed and wrote the report. SL and HL participated in drafting and revising the manuscript. CC and LZ reviewed the manuscript for its intellectual content and revised the entire work. All authors approved the final manuscript as submitted and agreed to be accountable for all aspects of the work.

This study was funded by the Project for Xiangya famous doctor in Central South University (2014 [68]).

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.