Circular titanium discs with diameters of 4, 8, 15, and 20 mm and thicknesses of 1 and 2 mm were mechanically ground and polished using silicon carbide sandpaper (grit size: 800–2,000). Subsequently, the samples underwent sequential ultrasonic cleaning in acetone, absolute ethanol, and deionized water for 15 min per solvent. After drying at 60°C for 1 h in a vacuum oven, all specimens were sterilized via autoclaving at 121°C under 15 psi pressure for 20 min.

Lysozyme and TCEP solution were mixed at a 1:1 molar ratio and applied dropwise onto titanium disc surfaces, followed by gentle agitation for homogeneous distribution (11). To mitigate solvent evaporation during incubation, the samples were placed in a humidified chamber containing deionized water and maintained at room temperature for 2 h. Subsequently, the substrates were thoroughly rinsed with HEPES buffer (10 mM, pH 7.4), air-dried under laminar flow, and stored in sterile Petri dishes at 4°C. These functionally modified specimens were designated as Ti-PTL (Figure 1c).

The Ti-PTL samples were immersed in a hyaluronic acid (HA) solution (1 mg/ml) for 30 min, followed by thorough rinsing with 0.14 M sodium chloride (NaCl) solution. After drying under nitrogen flow, the treated substrates were incubated in a hyperbranched polylysine (HBPL) solution (3 mg/ml) for 30 min to form a positively charged polyelectrolyte film, completing one coating assembly cycle (12). The resultant specimens were designated as Ti-PTL-HA/HBPL (abbreviated HA/HB). This cycle was repeated three times to construct multilayered polyelectrolyte composite coatings (Figure 1c), with the final samples labeled Ti-PTL-[HA/HBPL]₃ [abbreviated (HA/HB)₃].

Zeta potential measurements of the nanoparticle suspensions were conducted using a Malvern Zetasizer Nano ZS instrument (Malvern Instruments, UK). The prepared electrolyte solutions were adjusted to pH 7.0, and 1 ml aliquots were loaded into disposable zeta potential cuvettes. Measurements were performed at a scattering angle of 173° (backscatter detection mode) with strict temperature control maintained at 25.0 ± 0.1°C using a Peltier thermal regulation system.

Congo red dye, known for its specific binding affinity toward amyloid-like structures, was employed to evaluate protein conformational changes. Titanium specimens were immersed in 1 mg/ml Congo red solution (Sigma-Aldrich) for 10 h under dark conditions. Following incubation, samples were meticulously rinsed with sterile deionized water for 10 h using a peristaltic washing system (50 ml/min flow rate), air-dried in a Class 100 clean bench, and visually inspected for structural coloration.

x-ray photoelectron spectroscopy (XPS, Shimadzu AXIS Supra+, Japan) equipped with a monochromatic Al Kα x-ray source (1,486.6 eV, 15 mA emission current) was utilized to analyze the near-surface chemical composition. All spectra were charge-corrected using adventitious carbon (C 1s = 284.8 eV) as an internal reference. Critical point drying (Leica EM CPD300) was performed prior to sputter-coating samples with a 5 nm gold layer (Quorum Q150T ES, 35 s coating time) to enhance surface conductivity.

Field emission scanning electron microscopy (FE-SEM, ZEISS Sigma 500, Germany) coupled with energy-dispersive x-ray spectroscopy (EDS, Oxford X-MaxN 80) was employed for topographical imaging and elemental mapping at 5 kV accelerating voltage. Atomic force microscopy (AFM, Bruker Dimension Icon, Germany) operated in PeakForce Tapping™ mode (ScanAsyst-Air probes, 0.7 N/m spring constant) provided nanoscale roughness quantification and coating thickness measurements through cross-sectional analysis (n = 9 scans per sample).

The hydrophilic properties of modified titanium substrates were evaluated using a dynamic contact angle measurement system (OCA25, Xiamen Chongda Technology Co., Ltd., China) under ambient conditions (25 ± 0.5°C). Deionized water droplets (3 μl) were dispensed onto specimen surfaces via a precision microsyringe. Following droplet stabilization (30 s equilibration time), baseline calibration and contact angle measurements were performed using sessile drop methodology. Three distinct locations were selected per sample for triplicate measurements, with mean contact angles calculated to ±0.1° precision. High-resolution droplet profiles were captured in real-time using integrated optical imaging (1,920 × 1,080 pixel resolution) and analyzed via dedicated image analysis software (Attension Theta v5.0) to quantify wettability parameters, with all raw data archived for precise angle quantification.

The drug release kinetics of experimental specimens [Ti-PTL-(HA/HBPL)₃ and Ti-PTL-HA/HBPL] were evaluated using a standardized elution protocol. Samples were immersed in phosphate-buffered saline (PBS, pH 7.4) within 24-well plates and incubated under gentle agitation (50 rpm) in a thermostatic orbital shaker (37 ± 0.2°C). At predetermined intervals (6 h, 12 h, 1 d, 3 d, 7 d, 10 d, and 14 d), 200 μl aliquots were extracted for quantitative analysis via bicinchoninic acid (BCA) protein assay (Pierce™, Thermo Scientific), with absorbance measured at 562 nm using an M200 Pro microplate reader (Tecan Group Ltd., Switzerland). The release medium was replenished with fresh PBS after each sampling to maintain sink conditions. Cumulative protein release was calculated against a six-point calibration curve (R² > 0.995) and plotted as mean ± SD (n = 3 independent replicates).

Test specimens [Ti, PTL, HA/HBPL, and (HA/HBPL)₃] were precision-cut into discs (10 mm diameter) using laser ablation, sequentially sterilized in absolute ethanol, sonicated in deionized water for 10 min, and vacuum-dried at 80°C for 2 h prior to autoclave sterilization. Streptococcus gordonii and S. sanguinis were cultured in brain-heart infusion (BHI) broth at 37°C under microaerophilic conditions (5% CO₂) for 18 h to mid-log phase. Bacterial suspensions were adjusted to 1 × 10⁶ CFU/ml using sterile saline (0.9% NaCl) with optical density calibration at 600 nm (OD₆₀₀ = 0.1). Sterile cotton swabs were used to evenly inoculate Mueller-Hinton agar plates with 100 μl bacterial suspension. Specimens were aseptically placed onto inoculated agar surfaces, ensuring full material-agar contact via sterile forceps. Plates were incubated at 37°C for 48 h under controlled humidity. Post-incubation, inhibition zones were documented using a calibrated imaging system under uniform LED illumination. Colony counting was performed using automated image analysis software (ImageJ v1.53t) with morphological filtering to differentiate inhibition halos from background colonies.

Sterilized specimens were aseptically transferred into 24-well cell culture plates and inoculated with 1 ml of bacterial suspension. Following 24 h incubation at 37°C under 5% CO₂, the culture medium was aspirated, and specimens underwent three PBS washing cycles with gentle orbital shaking. A fluorescent viability stain cocktail was prepared by mixing SYTO 9 and propidium iodide (PI) at a 1:1 volumetric ratio. Each well received 200 μl of staining solution and was incubated protected from light at ambient temperature for 15 min. Excess dye was removed through three additional PBS rinses under dark conditions.Samples were immediately imaged using a confocal laser scanning microscope. Fluorescence quantification was executed via ZEN 3.4 software, with live bacteria (SYTO 9) and dead bacteria (PI) populations calculated from thresholded binarized images (13).

The four experimental materials were individually placed in 24-well culture plates and inoculated with 1 ml suspensions of Streptococcus gordonii and S. sanguinis at a 1:1 ratio (1 × 10⁶ CFU/ml total). Biofilms were cultivated microaerophilically (37°C, 5% CO₂) for 24 h. Specimens were gently rinsed thrice with PBS under orbital agitation and fixed in 2.5% glutaraldehyde at 4°C for 4 h. A graded ethanol dehydration series (50%, 70%, 80%, 90%, 100% v/v, 15 min per step) was performed using an automated tissue processor. Critical point drying preceded sputter-coating with 5 nm gold-palladium (Quorum Q150T ES, 30 mA, 120 s) to enhance surface conductivity. High-resolution imaging was conducted via field-emission scanning electron microscopy at 5 kV accelerating voltage (14). Bacterial adhesion density, morphological alterations, and spatial distribution patterns were quantified across 10 random fields using SmartSEM v6.0 image analysis suite, with biofilm coverage calculated via threshold-based binarization.

Murine pre-osteoblastic MC3T3-E1 cells were cultured in high-glucose Dulbecco's Modified Eagle Medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, HyClone) and 1% penicillin/streptomycin (P/S, Sigma-Aldrich) under standard conditions (37°C, 5% CO₂, 100% humidity). Rat bone marrow-derived mesenchymal stem cells (BMSCs) were maintained in DMEM/F-12 medium (Corning) containing 10% FBS and 1% P/S within a humidified tri-gas incubator (Thermo Scientific Forma Series II) with identical atmospheric parameters.

Confluent MC3T3-E1 cells were trypsinized (0.25% Trypsin-EDTA), centrifuged (300 ×g, 5 min), and resuspended in complete medium to achieve 4 × 10⁴ cells/ml. Sterilized titanium specimens (n = 3 technical replicates per group) were aseptically placed in 24-well plates, followed by addition of 1 ml cell suspension per well. Cells were cultured under standard conditions (37°C, 5% CO₂, 95% humidity) for 24 h.Post-incubation, cells were lysed using RIPA buffersupplemented with protease inhibitors. Lysates were sonicated on ice and centrifuged to obtain clarified supernatants. LDH activity was quantified using the CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega) according to manufacturer protocols (15). Absorbance at 490 nm was measured with correction at 650 nm using a multimode plate reader.

Cellular proliferation kinetics were assessed daily (Days 1–6) by supplementing cultures with 10% CCK-8 reagent (Dojindo Molecular Technologies) relative to total medium volume. Following 4 h incubation under standard conditions (37°C, 5% CO₂, 95% humidity), absorbance was quantified at 450 nm (reference wavelength: 650 nm) using a multimode microplate reader. Triplicate technical replicates per group were analyzed at each timepoint, with background subtraction using cell-free control wells.

ALP activity was determined using a microplate-based Alkaline Phosphatase Assay Kit according to the manufacturer's instructions. The optical density was measured at 405 nm using a microplate reader.

Surface-modified titanium specimens (n = 3 technical replicates per group) were aseptically transferred into 24-well plates and incubated with 1 ml DMEM medium supplemented with 10% fetal bovine serum (FBS, HyClone) under standardized culture conditions for 4 h. Following incubation, specimens were gently transferred to fresh plates using sterile forceps and subjected to three PBS washing cycles with orbital shaking (50 rpm, 5 min/wash). Adsorbed proteins were desorbed using 0.5 ml of 1% sodium dodecyl sulfate (SDS, Sigma-Aldrich) solution under constant agitation (200 rpm) at 25 ± 0.5°C for 1 h. Protein concentrations were determined via Pierce™ BCA Protein Assay Kit (Thermo Scientific) following manufacturer protocols, with absorbance measured at 562 nm using a SpectraMax i3x microplate reader.

Cells were fixed with 4% paraformaldehyde (PFA) in PBS (pH 7.4) for 15 min at 25°C. After aspirating the fixative, specimens were triple-rinsed with deionized water. A 0.2% Alizarin Red S (ARS) solution (Sigma-Aldrich, pH 8.3 adjusted with 0.1 M Tris-HCl) was slowly applied to cover cell layers, followed by incubation in dark conditions for 30 min. Excess dye was removed via brief rinsing (3 × 10 s) with deionized water to prevent calcium mineral dissolution. Stained specimens were imaged under phase-contrast microscopy with consistent illumination parameters.

Total cellular RNA was extracted using chloroform-based phase separation, followed by reverse transcription into complementary DNA (cDNA) using the PrimeScript™ RT Reagent Kit according to the manufacturer's protocol. Quantitative real-time PCR amplification of target genes and endogenous controls was performed with SYBR™ Premix Ex Taq™ on a StepOnePlus™ Real-Time PCR System (Applied Biosystems). Primer sequences for the target and reference genes are listed below:

OCN: F: TTGGCTTCTGACTGGGTGTC, R: GCCGGAGTCTGTTCACTACC;

Proteins were extracted in RIPA lysis buffer (CW2333s, CWBIO, Shanghai) supplemented with Phosphatase Inhibitor Cocktail (CW2200S, CWBIO, Shanghai) and Phenylmethylsulfonyl fluoride (PMSF) (Sigma). Then, centrifugation at 12,000 rpm for 30 min was performed to remove cell fragments. After centrifugation, protein concentrations of the supernatant were determined with the Bradford assay and the extract boiled in Laemmli buffer. After quantified, protein samples (10–20 μg) were separated by 10% SDS–PAGE for electrophoresis and then transferred to PVDF membranes. After blocking with 5% skimmed milk for 1 h, the membranes were incubated with indicated primary antibodies overnight at 4°C. Then, after washing with TBST for three times, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Weiao Biological Company, China) at room temperature for 1 h. Protein bands were visualized using enhanced chemiluminescence (ECL) reagent (Cat:AP34L015-B, Life-iLab, Shanghai) with the Tanon 5,200 imaging system. The band intensities were analyzed by ImageJ (version 1.52a, NIH).

This investigation utilized 12-week-old male Sprague-Dawley rats (Beijing HFK Bioscience Co., Ltd.), with all procedures strictly adhering to the National Institutes of Health (NIH) Guidelines for the Care and Use of Laboratory Animals. The protocol was approved by the Animal Ethics Committee of Tianjin Fifth Central Hospital (AEWC-2023-018). Animals were housed in individually ventilated cages under controlled environmental conditions (25°C, 55% humidity, 12 h light/dark cycle) with ad libitum access to autoclaved water and feed.

Bone marrow-derived mesenchymal stem cells (BMSCs) were cultured on HA/HBPL₃ and bare titanium (Blank Ti) substrates for 7 days, with cellular morphology, distribution, and adhesion characterized via phase-contrast microscopy (Nikon Eclipse Ts2, 20×). Following intraperitoneal anesthesia (pentobarbital sodium, 50 mg/kg), a 0.5 cm longitudinal incision was aseptically created 2 cm caudal to the auricular region. A subcutaneous pocket was surgically prepared using blunt dissection, into which pre-sterilized titanium specimens (n = 8 rats/group) were implanted. Wound closure was achieved with 5-0 polypropylene sutures, and postoperative analgesia (meloxicam, 1 mg/kg) was administered for 72 h.

At 4 and 8 weeks post-implantation, dorsal tissue specimens containing titanium implants and surrounding tissues were harvested. Samples were fixed in 4% neutral buffered formalin (Sigma-Aldrich) for 48 h, followed by dehydration in graded ethanol series (70% to 100%), xylene clearing, and paraffin embedding (Leica EG1160). Serial sections (5 μm thickness) were prepared using a rotary microtome (Leica RM2235).

Deparaffinization was performed through sequential immersion in xylene (3 × 5 min) and rehydration via graded ethanol (100% to 70%). Tissue sections were stained using a commercial H&E kit (Abcam, ab245880) according to manufacturer protocols: hematoxylin incubation (5 min), differentiation in 1% acid alcohol (30 s), bluing in 0.2% ammonium hydroxide (1 min), and eosin counterstaining (2 min). Stained slides were dehydrated (95% and 100% ethanol, 2 min each), cleared in xylene, and mounted with neutral balsam (Sigma-Aldrich).

Histological evaluation was conducted under bright-field microscopy at 100× and 400× magnifications. Morphometric analysis of tissue integration and inflammatory response was performed using NIS-Elements BR 5.30 software, with semi-quantitative scoring based on ISO 10993-6:2016 criteria (8 animals/group).

Data collected from at least triplicate experiments are presented as means ± standard deviation (SD) and analyzed with GraphPad Prism 9.0.0 via the one-way analysis of variance (ANOVA). The confidence levels were set as 95% (p* < 0.05), 99% (p** < 0.01), (p*** < 0.001) and (p**** < 0.0001).

Zeta potential measurements revealed that HA exhibited a surface charge of −52.47 ± 1.02 mV at pH 7, indicating strong negative charge density conducive to colloidal stability in aqueous solutions. Conversely, HBPL demonstrated a positive zeta potential of +26.80 ± 0.87 mV, attributed to protonated amine groups within its dendritic architecture, which enhanced its dispersibility and interfacial stability (Figure 1a). The complementary electrostatic profiles of HA and HBPL facilitated the formation of stable polyelectrolyte complexes via charge-driven self-assembly. Congo red staining, which selectively binds β-sheet-rich protein conformations, uniformly colored PTL-modified titanium surfaces (Figure 1b), confirming the retention of amyloid-like structural motifs. Untreated titanium substrates displayed smooth, metallic surfaces with characteristic silver-gray luster. PTL functionalization introduced an opaque white proteinaceous layer, while subsequent HA treatment yielded a duller appearance with reduced reflectivity, indicative of surface charge modulation for electrostatic assembly. Sequential HBPL deposition and cyclic coating procedures produced darker hues without macroscopic morphological alterations, suggesting progressive optimization of coating thickness and homogeneity (Figure 1d).

Scanning electron microscopy (SEM) elucidated the morphological evolution of titanium surfaces under distinct modification protocols (Figure 1e). The Ti-PTL surface exhibited uniformly distributed globular nanostructures, while HA deposition yielded a smoother topography compared to pristine PTL-modified surfaces. Multilayered LbL-assembled coatings [Ti-PTL-(HA/HB)₃] demonstrated enhanced surface homogeneity and reduced roughness relative to monolayer counterparts [Ti-PTL-(HA/HB)], indicative of progressive structural optimization.XPS survey spectra revealed elemental distribution profiles across modified surfaces (Figures 2a,b), calibrated using the adventitious carbon C 1s peak (284.8 eV). Untreated titanium displayed characteristic Ti 2p₃/₂ (458.4 eV) and O 1s (532 eV) peaks. PTL-functionalized surfaces exhibited emergent S 2p (168.2 eV) and P 2p (132.2 eV) signatures originating from tris(2-carboxyethyl)phosphine (TCEP), concurrent with the disappearance of Ti 2p₃/₂ signals, confirming complete surface coverage by phase-transitioned lysozyme. Subsequent HA deposition introduced a Na 1s peak (1,071 eV), verifying successful anionic polymer immobilization. Layer-by-layer HBPL assembly generated a prominent N 1s peak (400 eV), attributable to amine and amide functionalities, validating cationic polyelectrolyte incorporation. These results convincingly demonstrate the feasibility of constructing stable LbL architectures on titanium substrates, culminating in the successful fabrication of self-assembled Ti-[HA/HBPL]₃ antimicrobial coatings.

Atomic force microscopy (AFM) revealed distinct surface topographies across modified titanium groups (Figure 3a). The Ti-PTL group exhibited significantly increased surface roughness compared to pristine titanium (Ra: 85.3 ± 12.1 nm vs. 22.4 ± 3.5 nm). Subsequent LbL assembly of HA and HBPL reduced surface roughness (Ra: 48.7 ± 6.9 nm), effectively masking the PTL underlayer. Progressive LbL cycles further optimized coating uniformity, culminating in a smooth, densely packed multilayer structure with a total thickness of 1.0 ± 0.1 μm (Figure 3b). Water contact angle measurements demonstrated dynamic wettability evolution during coating fabrication (Figure 3c). Untreated titanium exhibited inherent hydrophobicity (113.18 ± 1.02°), while PTL functionalization dramatically enhanced hydrophilicity (13.97 ± 3.80°), attributable to surface enrichment of polar groups (amino, hydroxyl, carboxyl) from denatured lysozyme. HA deposition moderately increased contact angles to 40.77 ± 1.58°, likely due to steric reorganization of hydrophilic domains. Subsequent HBPL assembly stabilized wettability (39.6 ± 3.32°), with terminal amine groups compensating for HA's spatial effects. Final LbL-optimized coatings [(HA/HBPL)₃] maintained balanced hydrophilicity (54.00 ± 0.44°), representing a 52% improvement over untreated titanium.

Additionally, the cumulative release of HBPL from the modified titanium in PBS solution exhibited a time-dependent increase in both experimental groups, characterized by an initial rapid release phase followed by gradual attenuation (Figure 3d).

The agar diffusion assay revealed distinct bactericidal effects across experimental groups. Pure Ti substrates demonstrated the highest colonization density for both Streptococcus gordonii and S. sanguinis, with confluent biofilm formation nearly covering the entire agar surface (Figures 4a,b). PTL-modified surfaces exhibited a moderate reduction in colony counts (approximately 30% decrease vs. Ti), though bacterial distribution remained uniform. HA/HBPL coatings significantly suppressed S. gordonii growth (70% reduction) while nearly eliminating S. sanguinis colonization (99% inhibition). Remarkably, the HA/HBPL₃ group showed near-complete bactericidal efficacy (99.93 ± 0.09% inhibition), with only sporadic colonies observed.

Live/dead fluorescence imaging corroborated these findings (Figures 4c,d). Pure Ti surfaces displayed dense populations of viable bacteria. PTL modification reduced viable counts by 40%, though bacterial vitality remained high. HA/HBPL surfaces exhibited membrane-compromised S. gordonii and near-complete eradication of S. sanguinis. The HA/HBPL₃ group demonstrated exceptional antimicrobial performance, with minimal viable bacteria detected (<1% survival).

High-resolution SEM imaging revealed mechanistic insights (Figures 5a,b). Pure Ti surfaces hosted intact S. gordonii (red pseudocolor) with preserved cellular morphology and dense colonization. HA/HBPL surfaces showed reduced adhesion density and partial membrane disruption (white arrows). HA/HBPL₃ coatings induced catastrophic membrane damage (green arrows), characterized by cytoplasmic leakage and cell lysis. Similar trends were observed for S. sanguinis (green pseudocolor), with HA/HBPL₃ surfaces achieving complete membrane disintegration (white/red arrows).

The HA/HBPL₃ group demonstrated the lowest lactate dehydrogenase (LDH) activity, showing statistically significant differences compared to the Ti group. A sequential reduction in LDH activity was observed across Ti-PTL, Ti-PTL-HA, HA/HBPL, and HA/HBPL₃ groups. Notably, Ti-PTL and Ti-PTL-HA exhibited elevated LDH activity relative to pure Ti (Figure 6a), suggesting transient metabolic stress during early-stage cell adaptation. These results confirm the minimal cytotoxicity of the composite coatings.

To evaluate osteogenic differentiation, ALP activity was quantified at days 7 and 14. The HA/HBPL₃ group showed significantly enhanced ALP activity at both timepoints (2.3-fold increase vs. Ti at day 14), indicating sustained promotion of osteoblastic differentiation (Figure 6b).

Proliferation kinetics of rat bone marrow-derived mesenchymal stem cells (BMSCs) and murine pre-osteoblastic MC3T3-E1 cells were assessed. For BMSCs, the HA/HBPL₃ group exhibited higher optical density (OD) values than Ti at day 3, with a slight reduction by day 7. Ti-PTL and Ti-PTL-HA showed no significant impact on BMSC proliferation (Figure 6c). In contrast, HA/HBPL₃ significantly enhanced MC3T3-E1 proliferation at both days 3 and 7 compared to HA/HBPL and Ti-PTL-HA groups (p < 0.01, Figure 6d), demonstrating cell lineage-dependent bioactivity.

Protein adsorption capacity, indicative of surface bioactivity, was highest in the HA/HBPL₃ group (2.8 ± 0.3 μg/cm²), significantly exceeding Ti (1.1 ± 0.2 μg/cm²) and HA/HBPL (1.9 ± 0.2 μg/cm²). Ti-PTL-HA showed reduced adsorption (0.8 ± 0.1 μg/cm²) compared to Ti, while Ti-PTL exhibited comparable levels to Ti (1.0 ± 0.2 μg/cm²) (Figure 6e).

Alizarin Red S staining demonstrated time-dependent mineralization capacity across groups (Figures 7a–c). The Ti group exhibited faint red staining, indicative of minimal calcium deposition. Gradual intensification of staining was observed in PTL, HA, and HA/HBPL groups, with the HA/HBPL₃ group showing the most robust red coloration at both 14 and 21 days. HA/HBPL₃ substrates displayed densely distributed, uniform mineralized nodules with 2.3-fold higher calcium content compared to Ti, confirming enhanced osteogenic mineralization.

Phalloidin/DAPI staining revealed superior cellular integrity on HA/HBPL₃ surfaces (Figure 7d). At 6 and 12 h post-seeding, HA/HBPL₃-supported cells exhibited well-defined actin filaments and organized nuclear architecture, with a 40% increase in cell spreading area vs. Ti. In contrast, Ti, PTL, and HA/HBPL groups showed dispersed cytoskeletal networks and irregular nuclear arrangements, suggesting HA/HBPL₃'s protective effects on cellular homeostasis.

To evaluate the effects of different treatment conditions on bone metabolism-related genes, the expression levels of COL I, OPN, OCN, and RUNX2 genes were detected using RT-qPCR under different treatment conditions. The results showed that the HA/HBPL3 group exhibited better expression effects in all tested genes, significantly higher than the Ti group, particularly in the expression of OPN and RUNX2, which showed significant increases. This indicates that the HA/HBPL3 treatment significantly promotes the differentiation and bone matrix synthesis of mesenchymal stem cells, potentially through the activation of related signaling pathways, thereby enhancing bone formation. In contrast, the expression levels of the genes in the Ti, PTL, HA, and HA/HBPL groups were relatively stable. Therefore, the HA/HBPL3 group may have a stronger potential in promoting bone generation (Figure 8a). The protein expression levels of COL I, OPN, OCN, and RUNX2 were also detected using WB technology in different treatment groups. The results showed that the HA/HBPL3 group exhibited significant upregulation in all target proteins, particularly COL I and OCN, whose expression levels were significantly higher than those in other groups. Additionally, OPN and RUNX2 proteins in the HA/HBPL3 group also showed increases, indicating that this group of treatment conditions exhibited the strongest effects in promoting the synthesis of related bone proteins. This suggests that the HA/HBPL3 group may enhance the synthesis of bone proteins through certain signaling pathways or molecular mechanisms, thereby promoting the differentiation and maturation of mesenchymal stem cells (Figures 8b,c).

In addition, to comprehensively evaluate the bone-forming ability and biocompatibility of HA/HBPL3, we implanted the modified titanium plates into the back of mice to observe whether HA/HBPL3 could influence tissue healing or promote the formation of anomalous bone tissue under the complex physiological conditions of the body. The results showed that at 4 weeks, fibrous tissue surrounding the HA/HBPL3-modified titanium plates appeared, indicating that HA/HBPL3 could not induce anomalous bone formation without bone scaffold materials or natural bone structures. The wounds of the mice healed well, and no obvious inflammatory cells were observed under the microscope, suggesting that the modified coating had good biocompatibility (Figure 8d).