<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3-mathml3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="1.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Oncol.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Oncology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Oncol.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">2234-943X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fonc.2025.1750297</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>OLFML2A mediates cell cycle regulation in triple-negative breast cancer via EZH2</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Ding</surname><given-names>Haining</given-names></name>
<uri xlink:href="https://loop.frontiersin.org/people/3081151/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Chen</surname><given-names>Yian</given-names></name>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Yu</surname><given-names>Qinghong</given-names></name>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="software" vocab-term-identifier="https://credit.niso.org/contributor-roles/software/">Software</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Jiang</surname><given-names>Wanzhi</given-names></name>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Gao</surname><given-names>Xiufei</given-names></name>
<xref ref-type="corresp" rid="c001"><sup>*</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/1740687/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
</contrib-group>
<aff id="aff1"><institution>The First Affiliated Hospital of Zhejiang Chinese Medical University</institution>, <city>Hangzhou</city>,&#xa0;<country country="cn">China</country></aff>
<author-notes>
<corresp id="c001"><label>*</label>Correspondence: Xiufei Gao, <email xlink:href="mailto:gaoxiufei@zcmu.edu.cn">gaoxiufei@zcmu.edu.cn</email></corresp>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2026-01-13">
<day>13</day>
<month>01</month>
<year>2026</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2025</year>
</pub-date>
<volume>15</volume>
<elocation-id>1750297</elocation-id>
<history>
<date date-type="received">
<day>20</day>
<month>11</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>23</day>
<month>12</month>
<year>2025</year>
</date>
<date date-type="rev-recd">
<day>18</day>
<month>12</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2026 Ding, Chen, Yu, Jiang and Gao.</copyright-statement>
<copyright-year>2026</copyright-year>
<copyright-holder>Ding, Chen, Yu, Jiang and Gao</copyright-holder>
<license>
<ali:license_ref start_date="2026-01-13">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>Triple-negative breast cancer (TNBC) is recognized as one of the most aggressive and prognostically adverse subtypes of breast cancer. The lack of effective therapeutic targets presents substantial challenges, including impediments in early diagnosis, restricted treatment options, and a pronounced tendency for drug resistance. Despite recent advancements in the diagnosis and management of TNBC, the overall survival rate for patients remains suboptimal. Consequently, gaining a more profound understanding of its biological mechanisms and developing novel therapeutic strategies are imperative scientific priorities in this domain.</p>
</sec>
<sec>
<title>Methods</title>
<p>OLFML2A was identified as a potential therapeutic target in TNBC through analyses of the Human Protein Atlas and Kaplan-Meier databases. Its functional role was investigated using OLFML2A knockout (KO) and overexpression (OE) models in MDA-MB-231 cells. Effects on proliferation, cell cycle, and apoptosis were assessed by EdU assays, flow cytometry, RT-qPCR, western blotting, and immunofluorescence. Tumor growth and body weight were monitored <italic>in vivo</italic>, and tumor tissues were examined by H&amp;E staining, RT-qPCR, and western blotting. Proteomic profiling integrated with literature mining identified EZH2 as a key downstream candidate. Their interaction was validated by co-immunoprecipitation, and EZH2 expression and localization under different OLFML2A conditions were analyzed. Rescue experiments using the EZH2 inhibitor GSK126 assessed the functional output of the OLFML2A-EZH2 axis via CCK-8, EdU assays.</p>
</sec>
<sec>
<title>Results</title>
<p>OLFML2A acts as an oncogenic gene in triple-negative breast cancer. The silencing of OLFML2A markedly reduced the proliferation of MDA-MB-231 cells, induced cell cycle arrest at the G1 phase, and inhibited tumor growth. In contrast, overexpression of OLFML2A reversed these effects. Comprehensive proteomic and molecular biology analyses further indicated that OLFML2A may play a role in cell cycle regulation through the modulation of EZH2.</p>
</sec>
<sec>
<title>Conclusions</title>
<p>Our findings suggest that OLFML2A may facilitate cell cycle progression by regulating EZH2, implicating it as a potential therapeutic target for triple-negative breast cancer.</p>
</sec>
</abstract>
<kwd-group>
<kwd>cell cycle</kwd>
<kwd>EZH2</kwd>
<kwd>OLFML2A</kwd>
<kwd>TNBC</kwd>
<kwd>triple-negative breast cancer</kwd>
</kwd-group>
<funding-group>
<funding-statement>The author(s) declared that financial support was received for this work and/or its publication. This study was supported by the National Natural Science Foundation of China (No. 82374447,82074438).</funding-statement>
</funding-group>
<counts>
<fig-count count="6"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="15"/>
<page-count count="12"/>
<word-count count="4992"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Cancer Molecular Targets and Therapeutics</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>In 2022, female breast cancer emerged as the second most prevalent cancer worldwide, with an estimated 2.3 million new cases, representing 11.6% of all cancer diagnoses. It also ranked as the fourth leading cause of cancer-related mortality globally, accounting for 666,000 deaths, which correspond to 6.9% of all cancer fatalities (<xref ref-type="bibr" rid="B1">1</xref>). Research suggests that the pathogenesis of breast cancer is potentially influenced by a variety of factors. The Global Burden of Disease (GBD) 2019 dataset identifies specific behavioral risks&#x2014;such as tobacco and alcohol consumption, dietary habits, and insufficient physical activity&#x2014;as well as metabolic risks, including elevated fasting plasma glucose levels and high body mass index, which merit further investigation (<xref ref-type="bibr" rid="B2">2</xref>). On a mechanistic level, breast cancer develops from cumulative molecular alterations that disrupt critical cell cycle checkpoints, resulting in abnormal cell proliferation and genomic instability (<xref ref-type="bibr" rid="B3">3</xref>). The disruption of cell cycle regulation is a well-established characteristic of cancer, enabling uncontrolled cellular proliferation. Cyclin-dependent kinases (CDKs) play a crucial role in this regulatory framework, and their aberrant activity is associated with the advancement of malignancies, such as breast cancer. Together with their cyclin partners, CDKs form vital regulatory complexes that promote tumor cell proliferation and metastasis (<xref ref-type="bibr" rid="B4">4</xref>). As a result, understanding this complex regulatory network and identifying its key components has become a significant focus in current research endeavors.</p>
<p>EZH2 is localized in the nucleus of breast cancer cells and plays a crucial role in modulating the tumor microenvironment and regulating the cell cycle. It has been implicated in the promotion of epithelial-mesenchymal transition (EMT) by facilitating this process. Specifically, EZH2 can repress the transcription of E-cadherin, resulting in reduced intercellular adhesion (<xref ref-type="bibr" rid="B5">5</xref>). Numerous studies have elucidated the complex role of EZH2 in the pathogenesis of breast cancer. Biswas et&#xa0;al. (<xref ref-type="bibr" rid="B6">6</xref>) identified that EZH2 regulates genes associated with the cell cycle in breast cancer. Chien et&#xa0;al. (<xref ref-type="bibr" rid="B7">7</xref>) demonstrated that EZH2 enhances the migration and invasion of triple-negative breast cancer cells by modulating the TIMP2-MMP-2/-9 pathway. Zhang et&#xa0;al. (<xref ref-type="bibr" rid="B8">8</xref>) revealed that EZH2 interacts with TGF-&#x3b2; signaling to promote bone metastasis in breast cancer via integrin &#x3b2;1-FAK activation. Additionally, the same research group discovered that EZH2-directed PROTACs concurrently target oncogenic nodes associated with EZH2 and FOXM1, thereby inhibiting breast cancer growth. Moreover, Mao et&#xa0;al. (<xref ref-type="bibr" rid="B9">9</xref>) confirmed that the CRISPR/Cas9-mediated knockout of EZH2 reduces the proliferation and migration of triple-negative breast cancer cells. Based on these findings, we propose that EZH2 likely acts as a key driver in the pathogenesis and progression of triple-negative breast cancer by modulating cell cycle progression.</p>
<p>Olfactomedin-like (OLFML) proteins belong to the family of secreted glycoproteins characterized by the presence of an olfactomedin domain, with OLFML2A and OLFML2B being particularly prominent members. These proteins play a vital role in the development and functional organization of neural and retinal tissues (<xref ref-type="bibr" rid="B10">10</xref>). Emerging evidence indicates that OLFML2A may contribute to the pathogenesis of various diseases. For instance, Lu et&#xa0;al. demonstrated an association between elevated OLFML2A expression and specific clinical features in acute myeloid leukemia (<xref ref-type="bibr" rid="B11">11</xref>). Similarly, Zhao et&#xa0;al. reported a correlation between increased OLFML2A levels and poor prognosis in triple-negative breast cancer (<xref ref-type="bibr" rid="B12">12</xref>). Consistent with these observations, our preliminary gene expression microarray analysis has identified OLFML2A as a potential therapeutic target in TNBC cells (<xref ref-type="bibr" rid="B13">13</xref>). However, the regulatory mechanisms governing OLFML2A in TNBC remain inadequately understood. This research aims to identify molecular targets that interact with OLFML2A and to elucidate the mechanisms by which it influences the tumor cell cycle. By clarifying the role of OLFML2A in promoting tumor progression, particularly through cell cycle modulation, we seek to identify novel therapeutic targets for TNBC. Our findings have the potential to contribute to the development of more effective and less toxic treatment strategies, ultimately enhancing patient prognosis and quality of life for individuals affected by this aggressive malignancy.</p>
</sec>
<sec id="s2">
<label>2</label>
<title>Methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Main reagents and kits</title>
<p>Cell Cycle and Apoptosis Analysis Kit (C1052) were purchased from Beyotime Biotech Inc, Annexin V-APC/PI Apoptosis Kit (E-CK-A217) were purchased from Elabscience Biotechnology Co.,Ltd., Click-iT EdU Cell Proliferation Kit with Alexa Fluor 488 (BL915A) were purchased from Labgic Technology Co., Ltd. Antibodies CDK4 (ab199728), CDK6 (ab241554), Cyclin D1 (ab134175), Cyclin D2 (ab308258), Cyclin D3 (ab289546), Rb (ab181616), p-Rb (ab184796), E2F1 (ab317385) were purchased from Abcam. Antibodies EZH2 (5246T) were purchased from Cell Signaling Technology. Antibodies OLFML2A (DF5039) was purchased from Affinity Biosciences Research Center Co., Ltd., Antibodies &#x3b2;-Actin (ET1702-67) were purchased from Hangzhou HUABIO Biotechnology Co., Ltd., TRIzol reagent (AG21101) was used for total RNA extraction and was obtained from Accurate Biology. Rabbit IgG Nanoselector Magnetic beads (025-101-003) were purchased from Chengdu Critical Point Biotechnology Co., Ltd. CCK8 (BS350B) kit were purchased from Labgic Technology Co., Ltd. GSK126 (S7061) were purchased from Selleckchem.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Cell culture</title>
<p>The MDA-MB-231 human breast cancer cell line utilized in this study was procured from Guangzhou Yuanjing Biotechnology Co., Ltd. The cells were cultured in high-glucose Dulbecco&#x2019;s Modified Eagle Medium (DMEM) obtained from Jinyuan, Shanghai, which was supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin to facilitate cell proliferation. The cell cultures were maintained under standard conditions at 37&#xb0;C in a humidified atmosphere with 5% CO<sub>2</sub>.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Lentiviral transduction of cells</title>
<p>The MDA-MB-231 triple-negative breast cancer cell line used in this study was obtained from Guangzhou Yuanjing Biotechnology Co., Ltd. To ensure phenotypic specificity, we generated a panel of isogenic cell models via lentiviral transduction using a pre-engineered MDA-MB-231-Cas9 stable cell line (Guangzhou Yuanjing Biotechnology Co., Ltd. Catalog No. YC-D005-Cas9-H) as the parental line. This Cas9-expressing line carries a hygromycin resistance marker based on the YCas-LV002 backbone (non-fluorescent). Using this platform, we established three genetically defined models: (1) an Empty Vector Control (Control-OE), created by transducing cells with the lentiviral backbone vector without the OLFML2A insert to control for transduction and selection artifacts; (2) an OLFML2A Knockout (OLFML2A-KO) model, generated by infecting cells with a lentiviral sgRNA vector (based on the Source Bioscience backbone YKO-001) targeting OLFML2A; and (3) an OLFML2A Overexpression (OLFML2A-OE) model, produced by transducing cells with a lentiviral vector containing the full-length OLFML2A coding sequence.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Flow cytometric analysis of cell cycle</title>
<p>Flow cytometric analysis was performed to assess the cell cycle distribution of MDA-MB-231 cells. The cells were harvested, washed with phosphate-buffered saline (PBS), and subsequently fixed in 70% ethanol at 4&#xb0;C overnight. Prior to analysis, the fixed cells were stained in the dark at 37&#xb0;C for 30 minutes with a solution containing propidium iodide (PI) and RNase A. Fluorescence emission was collected after excitation at 488 nm, and the proportion of cells in each phase of the cell cycle was determined based on DNA content.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Flow cytometric analysis of apoptosis</title>
<p>The apoptotic rate of MDA-MB-231 cells was assessed via flow cytometry utilizing dual staining with Annexin V-APC and propidium iodide. In summary, harvested cells underwent washing with phosphate-buffered saline and were subsequently resuspended in 500 &#x3bc;L of 1&#xd7; binding buffer. The cell suspension was then stained with 5 &#x3bc;L of both Annexin V-APC and PI, followed by a 15-minute incubation at room temperature under dark conditions. Flow cytometric analysis was conducted immediately following the incubation period.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>EDU assay</title>
<p>Cell proliferation was assessed utilizing a 5-ethynyl-2&#x2032;-deoxyuridine (EdU) labeling kit, in accordance with the manufacturer&#x2019;s instructions. Following cell plating, the EdU incorporation procedure was performed, which encompassed fixation and permeabilization steps. Fluorescence images were subsequently acquired using an EVOS M7000 imaging system (Thermo USA). For the purpose of analysis, the proliferation rate was quantified as the ratio of EdU-positive nuclei to the total number of nuclei counted.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>RT-qPCR analysis</title>
<p>Total RNA was isolated utilizing the TRIzol reagent (Accurate Biology, China) following the protocol provided by the manufacturer. Subsequently, the isolated RNA was reverse-transcribed into complementary DNA (cDNA), and quantitative reverse transcription PCR (RT-qPCR) was conducted using SYBR Green (Accurate Biology, China) to assess the transcript levels of CDK4, CDK6, Cyclin D1, Cyclin D2, Cyclin D3, RB, E2F1, and EZH2. The specific sequences of primers used for amplification are presented in <xref ref-type="table" rid="T1"><bold>Table&#xa0;1</bold></xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>The list of primers used in RT-qPCR for mRNA expression.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Gene</th>
<th valign="middle" align="left">Forward Primer</th>
<th valign="middle" align="left">Reverse Primer</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left">CDK4</td>
<td valign="middle" align="left">TGGAAACTCTGAAGCCGACC</td>
<td valign="middle" align="left">AAAGTCAGCATTTCCAGCAGC</td>
</tr>
<tr>
<td valign="middle" align="left">CDK6</td>
<td valign="middle" align="left">CTTGCTCCAGTCCAGCTACG</td>
<td valign="middle" align="left">AGGGCAACATCTCTAGGCCA</td>
</tr>
<tr>
<td valign="middle" align="left">Cyclin D1</td>
<td valign="middle" align="left">GTGCATCTACACCGACAACTCC</td>
<td valign="middle" align="left">GTTCCACTTGAGCTTGTTCACC</td>
</tr>
<tr>
<td valign="middle" align="left">Cyclin D2</td>
<td valign="middle" align="left">TACACCGACAACTCCATCAAGC</td>
<td valign="middle" align="left">TGCCAGGTTCCACTTCAACTT</td>
</tr>
<tr>
<td valign="middle" align="left">Cyclin D3</td>
<td valign="middle" align="left">CCTGGGGGCTCTCATGTTTT</td>
<td valign="middle" align="left">CAGCACGGACTACATAGGGG</td>
</tr>
<tr>
<td valign="middle" align="left">RB</td>
<td valign="middle" align="left">GAGGACCTGCCTCTCGTCA</td>
<td valign="middle" align="left">TTAACCAAGCTCTCTCTCTGACAT</td>
</tr>
<tr>
<td valign="middle" align="left">E2F1</td>
<td valign="middle" align="left">ATGGTGATCAAAGCCCCTCC</td>
<td valign="middle" align="left">AAACATCGATCGGGCCTTGT</td>
</tr>
<tr>
<td valign="middle" align="left">EZH2</td>
<td valign="middle" align="left">ACAGTTCGTGCCCTTGTGTGATA</td>
<td valign="middle" align="left">CACACTCTCGGACAGCCAGGTA</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Western blotting analysis</title>
<p>Tissue samples were homogenized in ice-cold lysis buffer with protease and phosphatase inhibitors. After centrifugation at 4&#xb0;C, supernatants were collected for protein quantification. Samples were boiled, resolved on SDS-PAGE gels, and transferred to PVDF membranes. These were blocked for 30 minutes, then probed with primary antibodies overnight at 4&#xb0;C. After TBST washes, secondary antibodies were applied for 1 hour at room temperature. Immunoreactive bands were visualized using enhanced chemiluminescence and quantified with a digital imaging system.</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Immunofluorescence</title>
<p>The study investigated the localization and expression of CDK4, Cyclin D1, p-RB, RB, E2F1, EZH2 and OLFML2A in MDA-MB-231 cells using immunofluorescence techniques. The cultured cells underwent fixation with 4% paraformaldehyde, permeabilization with 0.1% Triton X-100, and blocking with 5% bovine serum albumin (BSA). Subsequently, the fixed samples were incubated with specific primary antibodies at 4&#xb0;C, and the nuclei were counterstained with DAPI. Imaging was performed using an inverted fluorescence microscope (EVOS M7000, Thermo Fisher Scientific, USA).</p>
</sec>
<sec id="s2_10">
<label>2.10</label>
<title>CCK8 assay</title>
<p>For the CCK&#x2212;8 assay, logarithmically growing cells were seeded in 96&#x2212;well plates and allowed to adhere for 24h. After replacing the medium with fresh medium containing a concentration gradient of GSK126, cells were incubated for an additional 24h. The medium was then aspirated and replaced with 100 &#x3bc;L of fresh medium containing 10% CCK&#x2212;8 reagent. Following gentle mixing, the plates were incubated for 2 h, and absorbance was read at 450 nm on a microplate reader.</p>
</sec>
<sec id="s2_11">
<label>2.11</label>
<title>Co-immunoprecipitation</title>
<p>Following cell lysis, a portion of the lysate was reserved as the Input control. The remaining sample was incubated with either an anti-OLFML2A antibody or a control IgG, together with Protein A/G magnetic beads, at 4&#xb0;C for 2 to 4 hours. The beads were subsequently isolated by centrifugation and washed three to four times with ice-cold lysis buffer. Bound proteins were eluted by boiling the beads for 10 minutes in 2&#xd7; SDS loading buffer, followed by separation via SDS-PAGE and analysis through Western blotting.</p>
</sec>
<sec id="s2_12">
<label>2.12</label>
<title>Animals</title>
<p>Following an acclimation period of approximately one week, the mice were randomly allocated into three experimental groups. Cells from the KO, C-OE, and OE lines, each labeled with EGFP, were cultured until reaching the logarithmic growth phase. Subsequently, each BALB/c-nu mouse was administered a subcutaneous injection of 100 &#x3bc;L containing 1&#xd7;10<sup>7</sup> cells into the axillary region. Tumor progression and potential metastasis were systematically monitored after the establishment of the xenografts.</p>
</sec>
<sec id="s2_13">
<label>2.13</label>
<title>H&amp;E staining</title>
<p>After dissection, the mouse tumor samples were fixed in 4% paraformaldehyde and subsequently processed for paraffin embedding. Histological analysis was conducted on tissue sections stained with hematoxylin and eosin (H&amp;E), utilizing a Pannoramic MIDI light microscope for examination.</p>
</sec>
<sec id="s2_14">
<label>2.14</label>
<title>Proteomic analysis</title>
<p>Cellular proteomic alterations were examined utilizing label-free quantitative proteomics facilitated by data-independent acquisition (DIA) mass spectrometry. Following cell harvesting, lysis was performed, and proteins were alkylated with iodoacetamide (IAM) in the absence of light for one hour at ambient temperature (22 &#xb1; 2&#xb0;C). Subsequently, proteins underwent digestion, desalting, and analysis via liquid chromatography&#x2013;tandem mass spectrometry (LC-MS/MS) operating in DIA mode. The resulting mass spectrometry data were processed and analyzed through bioinformatic methodologies.</p>
</sec>
<sec id="s2_15">
<label>2.15</label>
<title>Statistical analysis</title>
<p>The data are expressed as mean &#xb1; standard deviation (SD). All statistical analyses were conducted using GraphPad Prism software (version 9.0). For the purpose of group comparisons, a one-way analysis of variance (ANOVA) was utilized. A p-value of less than 0.05 was deemed statistically significant, with specific significance levels indicated as *<italic>p</italic> &lt; 0.05 and **<italic>p</italic> &lt; 0.01.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Clinical relevance of OLFML2A in TNBC</title>
<p>To explore the expression pattern of OLFML2A across various cancer types, we interrogated the Human Protein Atlas database (<ext-link ext-link-type="uri" xlink:href="https://www.proteinatlas.org/">https://www.proteinatlas.org/</ext-link>). Immunohistochemistry results using the antibody HPA021180 (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1A</bold></xref>) revealed that OLFML2A exhibits a cancer type-specific expression profile, with notably high cytoplasmic staining in several solid malignancies. Elevated protein levels were consistently observed in colorectal, breast, liver, and pancreatic carcinomas. In contrast, minimal to no OLFML2A expression was detected in cancers such as lymphoma and glioma. This distinct expression pattern suggests a potential tissue- or lineage-specific role for OLFML2A in human oncogenesis. We then evaluated the correlation between OLFML2A expression and the prognosis of TNBC patients using the Kaplan-Meier database (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1B</bold></xref>). The results showed that high expression of OLFML2A was potentially associated with an increased risk of recurrence in TNBC patients, although this trend did not reach statistical significance (<italic>p</italic> &gt; 0.05). Importantly, high levels of OLFML2A expression were linked to worse overall survival, with the high-expression group having a significantly lower chance of survival compared to the low-expression group (<italic>P</italic> &lt; 0.05). These findings suggest that OLFML2A expression levels could be a potential prognostic indicator for TNBC.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Clinical relevance of OLFML2A in TNBC. <bold>(A)</bold> OLFML2A expression in multiple cancers (Human Protein Atlas). <bold>(B)</bold> Survival analysis of TNBC patients: relapse-free survival (RFS) and overall survival (OS) based on OLFML2A expression (Kaplan&#x2013;Meier Plotter).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-15-1750297-g001.tif">
<alt-text content-type="machine-generated">Panel A is a bar graph showing the percentage of patients with various cancers, with colorectal cancer having the highest percentage and lymphoma the lowest. Panel B consists of two Kaplan-Meier survival curves for OLFM2A expression levels, displaying recurrence-free survival (RFS) and overall survival (OS). The left chart compares low versus high expression for RFS, while the right chart compares the same for OS, showing significant differences with respective hazard ratios and p-values.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>OLFML2A promotes proliferation and suppresses apoptosis in MDA-MB-231 cells</title>
<p>To elucidate the biological function of OLFML2A in triple-negative breast cancer cells, we engineered MDA-MB-231 cell line variants with either knockout (KO) or overexpression (OE) of OLFML2A. Flow cytometry was employed to analyze cell cycle distribution and apoptosis. The findings revealed that OLFML2A depletion resulted in a marked accumulation of cells in the G1 phase and an elevated rate of apoptosis. Conversely, OLFML2A overexpression facilitated cell cycle progression and diminished apoptotic activity (<xref ref-type="fig" rid="f2"><bold>Figures&#xa0;2A, B</bold></xref>). These results were corroborated by the EdU incorporation assay, which demonstrated that OLFML2A knockout reduced proliferative capacity, whereas OLFML2A overexpression enhanced it relative to control cells (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2C</bold></xref>). Collectively, these data suggest that OLFML2A plays a critical role in promoting cell proliferation and inhibiting apoptosis in MDA-MB-231 cells, underscoring its potential significance in sustaining tumor cell viability.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>OLFML2A promotes proliferation and suppresses apoptosis in MDA-MB-231 cells. <bold>(A)</bold> Cell cycle analysis by flow cytometry. <bold>(B)</bold> Apoptosis detection by flow cytometry. <bold>(C)</bold> Assessment of cell proliferation capacity via EdU assay. *<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-15-1750297-g002.tif">
<alt-text content-type="machine-generated">Flow cytometry analysis of cell cycle, apoptosis, and proliferation. (A) Histograms show cell cycle distribution in KO, C-OE, and OE groups with corresponding bar graph depicting cell cycle phase percentages. (B) Dot plots display apoptosis rates with a bar graph comparing KO, C-OE, and OE groups. (C) Fluorescence microscopy images show DAPI and EDU staining in each group with merged images, accompanied by a bar graph illustrating EDU proportion. Statistical significance is indicated with asterisks.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>OLFML2A induces G1 phase arrest in TNBC</title>
<p>To elucidate the molecular mechanisms by which OLFML2A induces G1 phase arrest in MDA-MB-231 cells, we conducted an analysis of the expression levels of pivotal regulators involved in the G1/S phase transition. Employing RT-qPCR and western blotting techniques, we evaluated the expression of CDK4, CDK6, Cyclins D1&#x2013;D3, RB, and E2F1 in both OLFML2A-knockout and control cell lines. The knockout of OLFML2A resulted in a significant reduction in the mRNA and protein levels of CDK4, CDK6, Cyclins D1&#x2013;D3, and E2F1. Importantly, although the total RB protein expression remained constant, there was a notable decrease in RB phosphorylation (<xref ref-type="fig" rid="f3"><bold>Figures&#xa0;3A, B</bold></xref>). These observations were further substantiated by immunofluorescence staining, which visually confirmed the downregulation of these cell-cycle regulators following OLFML2A depletion (<xref ref-type="fig" rid="f4"><bold>Figures&#xa0;4A, B</bold></xref>). Taken together, these findings suggest that OLFML2A facilitates G1/S phase progression by modulating the expression and phosphorylation of critical cell-cycle proteins.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>OLFML2A induces G1 phase arrest in MDA-MB-231 cells. <bold>(A)</bold> Representative western blots showing protein expression of G1/S phase transition regulators. <bold>(B)</bold> mRNA expression levels of cell cycle regulatory genes measured by RT-qPCR. *<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-15-1750297-g003.tif">
<alt-text content-type="machine-generated">Western blot and bar graphs analyze protein and mRNA levels in knockout (KO), control-overexpression (C-OE), and overexpression (OE) groups for CDK4, CDK6, E2F1, Cyclin D1, D2, D3, P-RB, and RB. The densitometry graphs depict relative expression levels normalized to β-actin, with annotations indicating statistical significance.</alt-text>
</graphic></fig>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Immunofluorescence analysis of G1 phase-associated biomarkers in MDA-MB-231 cells. <bold>(A)</bold> Quantitative analysis of relative fluorescence intensity for G1 phase regulators. <bold>(B)</bold> Representative immunofluorescence images showing cellular localization of G1 phase markers. *<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-15-1750297-g004.tif">
<alt-text content-type="machine-generated">A composite image with two sections: A) Four bar graphs showing relative fluorescence intensities for CDK4, Cyclin D1, RB, E2F1, and OLFML2A under KO, C-OE, and OE conditions. B) Six sets of fluorescence microscopy images, each divided into four panels: DAPI, EGFP, protein of interest, and merge. Proteins include CDK4, Cyclin D1, p-RB, RB, E2F1, and OLFML2A, across KO, C-OE, and OE conditions. Bars and symbols indicate statistical significance.</alt-text>
</graphic></fig>
<p>To elucidate the role of OLFML2A in the regulation of the tumor cell cycle <italic>in vivo</italic>, we developed a xenograft model of triple-negative breast cancer in mice. All experimental groups exhibited palpable tumors, albeit with distinct growth patterns. Compared to the control group (C-OE), the knockout of OLFML2A resulted in significantly slower tumor growth and reduced final tumor volume, whereas overexpression of OLFML2A led to accelerated tumor progression and increased tumor sizes (<xref ref-type="fig" rid="f5"><bold>Figures&#xa0;5A&#x2013;D</bold></xref>). To investigate the underlying molecular mechanisms, we conducted RT-qPCR and western blot analyses on the tumor tissues. The results indicated that OLFML2A modulates the expression of key regulators of the G1/S transition, including CDK4, CDK6, Cyclin D isoforms, and E2F1, corroborating our previous <italic>in vitro</italic> findings (<xref ref-type="fig" rid="f5"><bold>Figures&#xa0;5E, F</bold></xref>). Based on these data, we propose that the depletion of OLFML2A induces G1 phase arrest by inhibiting the CDK4/6&#x2013;Cyclin D complex, leading to reduced phosphorylation of RB and subsequent suppression of E2F1-mediated transcriptional activation. This pathway likely contributes to the observed inhibition of proliferation and increased apoptosis in breast cancer cells.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>OLFML2A induces G1 phase arrest in a TNBC xenograft mouse model. <bold>(A)</bold> Schematic diagram of the triple-negative breast cancer xenograft model establishment. <bold>(B)</bold> Representative images of excised tumors from each experimental group. <bold>(C)</bold> Body weight and tumor volumn. <bold>(D)</bold> H&amp;E staining of tumor tissues from different treatment groups. <bold>(E)</bold> Protein expression levels of G1 phase-related regulators in tumor tissues. <bold>(F)</bold> mRNA expression of G1 phase-associated markers in tumor tissues. *<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-15-1750297-g005.tif">
<alt-text content-type="machine-generated">Diagram and data showing tumor growth in mice. Panel A depicts the experimental process from cell collection to tumor transplantation. Panel B presents images of excised tumors from different groups: KO, C-OE, and OE. Panel C includes graphs showing body weight and tumor volume changes over time. Panel D displays histological images illustrating differences in tumor tissue among groups. Panel E showcases protein expression analysis with Western blot images and accompanying bar graphs for various proteins. Panel F presents bar graphs of mRNA expression levels for multiple genes.</alt-text>
</graphic></fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>OLFML2A interacts with EZH2 to regulate biological processes in TNBC</title>
<p>To elucidate the functional role of OLFML2A in TNBC, we employed the STRING database (<ext-link ext-link-type="uri" xlink:href="https://cn.string-db.org/">https://cn.string-db.org/</ext-link>) to construct a protein&#x2013;protein interaction (PPI) network. This approach enabled a systematic analysis of potential interaction partners and helped clarify the biological pathways associated with OLFML2A in TNBC. Differentially expressed proteins (DEPs) were identified based on screening criteria of FDR &#x2264; 0.05, FC &#x2265; 2, and <italic>p</italic> &#x2264; 0.05. Comparison between the OE and KO groups revealed a total of 1,383 DEPs, of which 1,026 were up-regulated and 357 were down-regulated. From these, the top 45 proteins ranked by p-value were selected for PPI network analysis (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6A</bold></xref>). By integrating the proteomic results with literature evidence, we identified EZH2 as one of the key interactors of OLFML2A in TNBC, showing a positive correlation with OLFML2A expression. To elucidate the functional roles of the DEPs, we performed Gene Ontology (GO) enrichment analysis using GOatools (<ext-link ext-link-type="uri" xlink:href="https://github.com/tanghaibao/GOatools">https://github.com/tanghaibao/GOatools</ext-link>) (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6B</bold></xref>). Enrichment significance was assessed based on Fisher&#x2019;s exact test, and p-values were adjusted for multiple testing using FDR correction. GO terms with an adjusted p&#x2264; 0.05 were considered significantly enriched. Key enriched biological processes included&#x201d;immune response&#x201d;and&#x201d;immune system process,&#x201d;while molecular functions such as &#x201c;signaling receptor activity&#x201d; and &#x201c;molecular transducer activity&#x201d;were highlighted, along with cellular components such as&#x201d;myosin complex.&#x201d;Subsequently, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed on the DEPs (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6C</bold></xref>), revealing significant associations with pathways related to immune and infectious diseases, metabolism, cancer and other diseases, as well as cellular structure and signaling.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>OLFML2A interacts with EZH2 to regulate biological processes in MDA-MB-231 cells. <bold>(A)</bold> Protein-protein interaction (PPI) network and related biological processes revealed by proteomic analysis of KO versus OE groups. <bold>(B)</bold> GO enrichment analysis of the KO versus OE groups. <bold>(C)</bold> KEGG pathway analysis of the KO versus OE groups. <bold>(D)</bold> Validation of EZH2 interaction by co-immunoprecipitation assay <italic>in vitro</italic>. <bold>(E)</bold> Relative fluorescence intensity of EZH2 across experimental groups. <bold>(F)</bold> mRNA expression levels of EZH2 in different cell groups. <bold>(G)</bold> Protein expression of EZH2 among experimental groups. <bold>(H)</bold> CCK&#x2212;8 assay of OE cell viability following treatment with increasing concentrations of the EZH2 inhibitor GSK126. <bold>(I)</bold> EdU proliferation assay comparing OE cells with OE cells treated with GSK126. *<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-15-1750297-g006.tif">
<alt-text content-type="machine-generated">Diagram A shows a network of protein interactions with color-coded nodes. Charts B and C depict pathways with dot sizes and colors indicating significance levels. Panel D presents a Western blot for OLFM2A and EZH2 across different conditions. Panel E shows fluorescence microscopy of cells with DAPI, EGFP, and EZH2 staining, and their merge under KO, C-OE, and OE conditions. Graphs F and H display bar charts comparing EZH2 mRNA levels and cell viability, respectively. Panel G contains a Western blot and corresponding graph for EZH2 and beta-actin. Panel I and E (right) show the EDU assay results under OE and OE+GSK126 conditions.</alt-text>
</graphic></fig>
<p>To validate the interaction between OLFML2A and EZH2, we performed Co-IP assays in MDA-MB-231 cells: KO, C-OE, and OE. Cell lysates were immunoprecipitated using an anti-OLFML2A antibody, followed by immunoblotting with an anti-EZH2 antibody. As shown in <xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6D</bold></xref>, EZH2 was readily co-precipitated with OLFML2A in both C-OE and OE cells, whereas the interaction signal was nearly undetectable in KO cells. These results indicate a specific and OLFML2A dependent association between OLFML2A and EZH2 in TNBC cells. Immunofluorescence staining further demonstrated that knockout of OLFML2A significantly diminished EZH2 intensity, whereas overexpression of OLFML2A augmented EZH2 fluorescence signals relative to controls (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6E</bold></xref>). In alignment with these findings, both mRNA and protein levels of EZH2 were downregulated upon OLFML2A depletion and upregulated following OLFML2A overexpression, as confirmed by RT-qPCR (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6F</bold></xref>) and western blot analysis (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6G</bold></xref>). Collectively, these results establish EZH2 as a downstream interacting partner of OLFML2A and suggest that its expression is positively regulated by OLFML2A in triple-negative breast cancer (TNBC) cells.</p>
<p>To investigate the functional role of EZH2 downstream of OLFML2A, we employed the EZH2-specific inhibitor GSK126. First, an appropriate working concentration of GSK126 was determined via CCK-8 assay (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6H</bold></xref>). Treatment with 3 &#x3bc;M GSK126 resulted in approximately 60% relative viability in OLFML2A-OE cells, indicating effective EZH2 inhibition while preserving basic cellular metabolic activity. At this concentration, EdU proliferation assays were performed (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6I</bold></xref>). The results demonstrated that GSK126 treatment significantly reduced the percentage of EdU&#x2212;positive cells compared with untreated OE controls, suggesting that EZH2 inhibition effectively reverses the enhanced proliferative capacity driven by OLFML2A overexpression. Together, these data further support that EZH2 acts downstream of OLFML2A and mediates its pro&#x2212;proliferative function.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>In conclusion, this study elucidates the role of OLFML2A as an upstream regulator that facilitates cell cycle progression in TNBC by enhancing EZH2 expression. The knockdown of OLFML2A resulted in a decrease in both mRNA and protein levels of EZH2, which subsequently induced G1 phase arrest and led to the downregulation of critical cell cycle regulators, including CDK4, CDK6, Cyclins D1&#x2013;D3, phosphorylated RB, and E2F1. In contrast, overexpression of OLFML2A increased EZH2 expression and promoted the G1/S transition, thereby restoring these regulatory factors. These findings delineate a functional axis in which OLFML2A-mediated upregulation of EZH2 expression supports cell cycle progression, underscoring its potential as a therapeutic target in TNBC.</p>
<p>The initial research team found that microarray analysis revealed OLFML2A-KO significantly altered the expression of 1,140 genes, with 428 genes being upregulated and 712 genes being downregulated. Functional enrichment analysis indicated that these differentially expressed genes are involved in critical biological processes, including DNA synthesis, chromosome alignment, microtubule and cytoskeleton organization, cell motility, cell cycle regulation, and cell necrosis (<xref ref-type="bibr" rid="B13">13</xref>). OLFML2A knockdown has been shown to suppress proliferation and induce apoptosis in glioma cells. Mechanistically, OLFML2A downregulation inhibits the Wnt/&#x3b2;-catenin signaling pathway through an increase in amyloid precursor protein (APP) expression and a consequent decrease in stabilized &#x3b2;-catenin. This attenuation of Wnt signaling leads to the reduced expression of key downstream oncogenic targets, including MYC, CD44, and CCND2. The functional significance of this axis was further confirmed <italic>in vivo</italic>, where OLFML2A knockdown suppressed tumor growth in both subcutaneous and intracranial glioma xenograft models by impairing Wnt/&#x3b2;-catenin-dependent proliferatio (<xref ref-type="bibr" rid="B14">14</xref>). To investigate the potential molecular mechanisms underlying OLFML2A, we conducted proteomic screening, which led to the identification of EZH2 as an interacting partner. This interaction was subsequently validated through co-immunoprecipitation assays. Further experimental analyses, including quantitative PCR, western blotting, and immunofluorescence, confirmed that EZH2 functions as a downstream effector of OLFML2A. EZH2, known as a catalytic subunit of the Polycomb Repressive Complex 2 (PRC2), facilitates tumorigenesis via both its catalytic and non-catalytic activities. Its overexpression or gain-of-function mutations are closely associated with increased tumor cell proliferation in TNBC (<xref ref-type="bibr" rid="B15">15</xref>). These findings indicate that the OLFML2A&#x2013;EZH2&#x2013;CDK4 axis may serve as a potential therapeutic target for TNBC.</p>
<p>This study underscores the potential of OLFML2A as a therapeutic target for triple-negative breast cancer; however, several limitations must be acknowledged. Firstly, although we have demonstrated through various experimental approaches that OLFML2A influences tumor cell cycle progression and suppresses apoptosis via the regulation of EZH2, the upstream regulatory networks and detailed molecular mechanisms remain insufficiently understood. Future research should aim to elucidate the precise molecular mechanism through which OLFML2A regulates EZH2. Key questions include whether OLFML2A influences EZH2 ubiquitination, phosphorylation, or protein-protein interactions that affect its stability, which represents an important avenue for further investigation. Secondly, While our <italic>in vitro</italic> and <italic>in vivo</italic> findings support the tumor-promoting roles of OLFML2A and EZH2 in TNBC progression, future large-scale clinical studies are needed to definitively correlate their expression with patient outcomes. Such validation will be essential for fully understanding the biological functions of OLFML2A and for guiding targeted therapeutic development. A critical next step will be to perform direct IHC co-expression analysis of OLFML2A and EZH2 in large, well-annotated TNBC patient cohorts to confirm our findings at the protein level in a clinical context.</p>
<p>Our mechanistic understanding of the OLFML2A&#x2212;EZH2 axis is primarily based on studies conducted in the representative TNBC model MDA&#x2212;MB&#x2212;231. Future research should validate these findings using additional TNBC cell lines that represent distinct molecular subtypes, such as luminal androgen receptor&#x2212;positive and mesenchymal subtypes, as well as in non&#x2212;tumorigenic mammary epithelial cells. This expanded validation will help establish the broader relevance of this signaling axis across the heterogeneous spectrum of TNBC and clarify its specificity to malignant progression. Furthermore, studies utilizing orthotopic implantation or metastatic models will be crucial to evaluate the role of OLFML2A&#x2212;EZH2 signaling in local invasion, distant colonization, and within the native mammary tissue microenvironment. Collectively, such efforts would elucidate the context&#x2212;dependent functions of OLFML2A and strengthen the preclinical rationale for targeting this axis within a precision oncology framework.</p>
<p>Our study elucidates the molecular mechanism by which OLFML2A facilitates cell cycle progression in TNBC through the transcriptional upregulation of EZH2, thereby promoting the transition from the G1 phase to the S phase. This discovery enhances current understanding in two significant ways: Theoretically, it identifies the OLFML2A&#x2013;EZH2 axis as a pivotal regulator of the G1 checkpoint within the cell cycle network of TNBC. From a translational standpoint, it not only offers novel mechanistic insights into the aberrant proliferation observed in TNBC but also establishes a robust experimental foundation for the development of targeted therapies aimed at the OLFML2A&#x2013;EZH2 signaling pathway.</p>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.</p></sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was approved by Our animal studies were conducted in strict accordance with the zhejiang Chinese Medical University Laboratory Animal Research Center and Use Committee guidelines (Approval No. IACUC-202504-23). The study was conducted in accordance with the local legislation and institutional requirements.</p></sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>HD: Investigation, Methodology, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. YC: Data curation, Investigation, Validation, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. QY: Conceptualization, Investigation, Software, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. WJ: Data curation, Methodology, Validation, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. XG: Funding acquisition, Methodology, Supervision, Visualization, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing.</p></sec>
<ack>
<title>Acknowledgments</title>
<p>The authors express their gratitude to the participants for their invaluable support in this research.</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p></sec>
<sec id="s10" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declared that generative AI was not used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p></sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p></sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Bray</surname> <given-names>F</given-names></name>
<name><surname>Laversanne</surname> <given-names>M</given-names></name>
<name><surname>Sung</surname> <given-names>H</given-names></name>
<name><surname>Ferlay</surname> <given-names>J</given-names></name>
<name><surname>Siegel</surname> <given-names>RL</given-names></name>
<name><surname>Soerjomataram</surname> <given-names>I</given-names></name>
<etal/>
</person-group>. 
<article-title>Global cancer statistics 2022: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries</article-title>. <source>CA Cancer J Clin</source>. (<year>2024</year>) <volume>74</volume>:<page-range>229&#x2013;63</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3322/caac.21834</pub-id>, PMID: <pub-id pub-id-type="pmid">38572751</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<label>2</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Xu</surname> <given-names>Y</given-names></name>
<name><surname>Gong</surname> <given-names>M</given-names></name>
<name><surname>Wang</surname> <given-names>Y</given-names></name>
<name><surname>Yang</surname> <given-names>Y</given-names></name>
<name><surname>Liu</surname> <given-names>S</given-names></name>
<name><surname>Zeng</surname> <given-names>Q</given-names></name>
</person-group>. 
<article-title>Global trends and forecasts of breast cancer incidence and deaths</article-title>. <source>Sci Data</source>. (<year>2023</year>) <volume>10</volume>:<fpage>334</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41597-023-02253-5</pub-id>, PMID: <pub-id pub-id-type="pmid">37244901</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<label>3</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Fuentes-Antr&#xe1;s</surname> <given-names>J</given-names></name>
<name><surname>Bedard</surname> <given-names>PL</given-names></name>
<name><surname>Cescon</surname> <given-names>DW</given-names></name>
</person-group>. 
<article-title>Seize the engine: emerging cell cycle targets in breast cancer</article-title>. <source>Clin Transl Med</source>. (<year>2024</year>) <volume>14</volume>:<fpage>e1544</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/ctm2.1544</pub-id>, PMID: <pub-id pub-id-type="pmid">38264947</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<label>4</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Sofi</surname> <given-names>S</given-names></name>
<name><surname>Mehraj</surname> <given-names>U</given-names></name>
<name><surname>Qayoom</surname> <given-names>H</given-names></name>
<name><surname>Aisha</surname> <given-names>S</given-names></name>
<name><surname>Asdaq</surname> <given-names>SMB</given-names></name>
<name><surname>Almilaibary</surname> <given-names>A</given-names></name>
<etal/>
</person-group>. 
<article-title>Cyclin-dependent kinases in breast cancer: expression pattern and therapeutic implications</article-title>. <source>Med Oncol</source>. (<year>2022</year>) <volume>39</volume>:<fpage>106</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12032-022-01731-x</pub-id>, PMID: <pub-id pub-id-type="pmid">35486263</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<label>5</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Chen</surname> <given-names>Y</given-names></name>
<name><surname>Zhu</surname> <given-names>H</given-names></name>
<name><surname>Luo</surname> <given-names>Y</given-names></name>
<name><surname>Tong</surname> <given-names>S</given-names></name>
<name><surname>Liu</surname> <given-names>Y</given-names></name>
</person-group>. 
<article-title>Ezh2: the roles in targeted therapy and mechanisms of resistance in breast cancer</article-title>. <source>BioMed Pharmacother</source>. (<year>2024</year>) <volume>175</volume>:<elocation-id>116624</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.biopha.2024.116624</pub-id>, PMID: <pub-id pub-id-type="pmid">38670045</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<label>6</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Biswas</surname> <given-names>A</given-names></name>
<name><surname>Mukherjee</surname> <given-names>G</given-names></name>
<name><surname>Kondaiah</surname> <given-names>P</given-names></name>
<name><surname>Desai</surname> <given-names>KV</given-names></name>
</person-group>. 
<article-title>Both ezh2 and jmjd6 regulate cell cycle genes in breast cancer</article-title>. <source>BMC Cancer</source>. (<year>2020</year>) <volume>20</volume>:<fpage>1159</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12885-020-07531-8</pub-id>, PMID: <pub-id pub-id-type="pmid">33246425</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<label>7</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Chien</surname> <given-names>YC</given-names></name>
<name><surname>Liu</surname> <given-names>LC</given-names></name>
<name><surname>Ye</surname> <given-names>HY</given-names></name>
<name><surname>Wu</surname> <given-names>JY</given-names></name>
<name><surname>Yu</surname> <given-names>YL</given-names></name>
</person-group>. 
<article-title>Ezh2 promotes migration and invasion of triple-negative breast cancer cells via regulating timp2-mmp-2/-9 pathway</article-title>. <source>Am J Cancer Res</source>. (<year>2018</year>) <volume>8</volume>:<page-range>422&#x2013;34</page-range>. <uri xlink:href="https://pmc.ncbi.nlm.nih.gov/articles/PMC5883093/pdf/ajcr0008-0422.pdf">https://pmc.ncbi.nlm.nih.gov/articles/PMC5883093/pdf/ajcr0008-0422.pdf</uri>, PMID: <pub-id pub-id-type="pmid">29636998</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<label>8</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Corbin</surname> <given-names>J</given-names></name>
<name><surname>Yu</surname> <given-names>X</given-names></name>
<name><surname>Jin</surname> <given-names>J</given-names></name>
<name><surname>Cai</surname> <given-names>L</given-names></name>
<name><surname>Wang</surname> <given-names>GG</given-names></name>
</person-group>. 
<article-title>Ezh2 protacs target ezh2- and foxm1-associated oncogenic nodes, suppressing breast cancer cell growth</article-title>. <source>Oncogene</source>. (<year>2024</year>) <volume>43</volume>:<page-range>2722&#x2013;36</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41388-024-03119-9</pub-id>, PMID: <pub-id pub-id-type="pmid">39112519</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<label>9</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Mao</surname> <given-names>Q</given-names></name>
<name><surname>Wu</surname> <given-names>P</given-names></name>
<name><surname>Li</surname> <given-names>H</given-names></name>
<name><surname>Fu</surname> <given-names>X</given-names></name>
<name><surname>Gao</surname> <given-names>X</given-names></name>
<name><surname>Yang</surname> <given-names>L</given-names></name>
</person-group>. 
<article-title>Crispr/cas9&#x2212;Mediated ezh2 knockout suppresses the proliferation and migration of triple&#x2212;Negative breast cancer cells</article-title>. <source>Oncol Lett</source>. (<year>2023</year>) <volume>26</volume>:<fpage>343</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3892/ol.2023.13929</pub-id>, PMID: <pub-id pub-id-type="pmid">37427349</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<label>10</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Garza-Rodr&#xed;guez</surname> <given-names>ML</given-names></name>
<name><surname>Gonz&#xe1;lez-&#xc1;lvarez</surname> <given-names>R</given-names></name>
<name><surname>Mendoza Alfaro</surname> <given-names>RE</given-names></name>
<name><surname>P&#xe9;rez-Ibave</surname> <given-names>DC</given-names></name>
<name><surname>Perez-Maya</surname> <given-names>AA</given-names></name>
<name><surname>Luna-Mu&#xf1;oz</surname> <given-names>M</given-names></name>
<etal/>
</person-group>. 
<article-title>Olfactomedin-like 2 a and B (Olfml2a and olfml2b) profile expression in the retina of spotted gar (Lepisosteus oculatus) and bioinformatics mining</article-title>. <source>Fish Physiol Biochem</source>. (<year>2019</year>) <volume>45</volume>:<page-range>1575&#x2013;87</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10695-019-00647-0</pub-id>, PMID: <pub-id pub-id-type="pmid">31111317</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<label>11</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Lu</surname> <given-names>X</given-names></name>
<name><surname>Li</surname> <given-names>Y</given-names></name>
<name><surname>Yang</surname> <given-names>Y</given-names></name>
<name><surname>Zhuang</surname> <given-names>W</given-names></name>
<name><surname>Chai</surname> <given-names>X</given-names></name>
<name><surname>Gong</surname> <given-names>C</given-names></name>
</person-group>. 
<article-title>Olfml2a overexpression predicts an unfavorable prognosis in patients with aml</article-title>. <source>J Oncol</source>. (<year>2023</year>) <volume>2023</volume>:<elocation-id>6017852</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1155/2023/6017852</pub-id>, PMID: <pub-id pub-id-type="pmid">36873740</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<label>12</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Zhao</surname> <given-names>Q</given-names></name>
<name><surname>Zhang</surname> <given-names>K</given-names></name>
<name><surname>Li</surname> <given-names>Y</given-names></name>
<name><surname>Ren</surname> <given-names>Y</given-names></name>
<name><surname>Shi</surname> <given-names>J</given-names></name>
<name><surname>Gu</surname> <given-names>Y</given-names></name>
<etal/>
</person-group>. 
<article-title>Olfml2a is necessary for anti-triple negative breast cancer effect of selective activator protein-1 inhibitor T-5224</article-title>. <source>Transl Oncol</source>. (<year>2021</year>) <volume>14</volume>:<elocation-id>101100</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tranon.2021.101100</pub-id>, PMID: <pub-id pub-id-type="pmid">33993098</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<label>13</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Gao</surname> <given-names>X</given-names></name>
<name><surname>Yang</surname> <given-names>Z</given-names></name>
<name><surname>Xu</surname> <given-names>C</given-names></name>
<name><surname>Yu</surname> <given-names>Q</given-names></name>
<name><surname>Wang</surname> <given-names>M</given-names></name>
<name><surname>Song</surname> <given-names>J</given-names></name>
<etal/>
</person-group>. 
<article-title>Genechip expression profiling identified olfml2a as a potential therapeutic target in tnbc cells</article-title>. <source>Ann Transl Med</source>. (<year>2022</year>) <volume>10</volume>:<fpage>274</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.21037/atm-22-757</pub-id>, PMID: <pub-id pub-id-type="pmid">35433966</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<label>14</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Ma</surname> <given-names>S</given-names></name>
<name><surname>Duan</surname> <given-names>L</given-names></name>
<name><surname>Dong</surname> <given-names>H</given-names></name>
<name><surname>Ma</surname> <given-names>X</given-names></name>
<name><surname>Guo</surname> <given-names>X</given-names></name>
<name><surname>Liu</surname> <given-names>J</given-names></name>
<etal/>
</person-group>. 
<article-title>Olfml2a downregulation inhibits glioma proliferation through suppression of wnt/&#x3b2;-catenin signaling</article-title>. <source>Front Oncol</source>. (<year>2021</year>) <volume>11</volume>:<elocation-id>717917</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fonc.2021.717917</pub-id>, PMID: <pub-id pub-id-type="pmid">34650914</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<label>15</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Mei</surname> <given-names>H</given-names></name>
<name><surname>Wu</surname> <given-names>H</given-names></name>
<name><surname>Yang</surname> <given-names>J</given-names></name>
<name><surname>Zhou</surname> <given-names>B</given-names></name>
<name><surname>Wang</surname> <given-names>A</given-names></name>
<name><surname>Hu</surname> <given-names>C</given-names></name>
<etal/>
</person-group>. 
<article-title>Discovery of ihmt-337 as a potent irreversible ezh2 inhibitor targeting cdk4 transcription for Malignancies</article-title>. <source>Signal Transduct Target Ther</source>. (<year>2023</year>) <volume>8</volume>:<fpage>18</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41392-022-01240-3</pub-id>, PMID: <pub-id pub-id-type="pmid">36642705</pub-id>
</mixed-citation>
</ref>
</ref-list>
<fn-group>
<fn id="n1" fn-type="custom" custom-type="edited-by">
<p>Edited by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1608548">Yuhao Xie</ext-link>, St. John&#x2019;s University, United States</p></fn>
<fn id="n2" fn-type="custom" custom-type="reviewed-by">
<p>Reviewed by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1562153">Jing Ju</ext-link>, Virginia Tech, United States</p>
<p><ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/3212941">Zihan Xu</ext-link>, The Rockefeller University, United States</p></fn>
</fn-group>
</back>
</article>