A comprehensive literature search was conducted using the Web of Science Core Collection (WOSCC) database to systematically review studies on HMCN1 in the field of oncology. The following Boolean search strategy was employed: [(HMCN1 OR Hemicentin-1 OR “Hemicentin 1” OR FIBL-6 OR FIBL6 OR FBLN6 OR ARMD1) AND (cancer* OR carcinoma* OR tumor* OR tumour* OR neoplas* OR malignan* OR oncolog*)]. The search was limited to articles published between January 1, 2000, and September 1, 2025. The article types included were research articles and reviews. Comments, letters, conference abstracts, and retracted publications were excluded, and only English-language documents considered. Visualizations were generated to highlight trends in keywords and their expansions within the HMCN1 research theme (19).

Transcriptomic data and corresponding clinical information, including overall survival (OS), progression-free interval (PFI), disease-free interval (DFI), and disease-specific survival (DSS), were retrieved from TCGA. To compare HMCN1 expression between tumor and normal tissues, we also obtained matched normal tissue data from the GTEx project and integrated the cancer and normal datasets. Specifically, we utilized the TPM (transcripts per million) expression data from the UCSC Xena database (datasets: tcga_RSEM_gene_tpm and gtex_RSEM_gene_tpm). To ensure accuracy and account for anatomical factors, only primary tumor tissues from TCGA were paired with GTEx data. The expression data were then standardized by converting them into a unitless Z-score for each cancer type using the formula (x-μ)/σ. Outliers, defined as Z-scores less than -3 or greater than 3, were removed. A cancer type was included in the subsequent analysis only if at least three normal samples remained after outlier removal. Samples with incomplete clinical data, poor sequencing quality, or undetectable HMCN1 expression were excluded to ensure data integrity and comparability. Using the integrated TCGA and GTEx dataset, we systematically compared differences in HMCN1 expression between normal and malignant tissues across various cancer types.

Protein-level expression of HMCN1 was assessed using the Human Protein Atlas platform, and three-dimensional structural information was retrieved from Protein Data Bank. Gene dependency or essentiality was assessed using CRISPR screening data from the DepMap portal. Gene essentiality was quantified using the Chronos score: a score <0 indicates that HMCN1 knockdown is detrimental to cell survival and is suggestive of its potential role in tumorigenesis (20, 21). Pan-cancer single-cell RNA sequencing data were obtained from the TISCH database (http://tisch.compbio.cn/home/). Using the pheatmap R package, we generated a pan-cancer single-cell expression heatmap. Euclidean distance was used as the similarity metric, and Ward’s minimum variance method was employed for hierarchical clustering to investigate conserved patterns of gene expression origin. Further dimensionality reduction and visualization of the high-dimensional data were performed using the Uniform Manifold Approximation and Projection method (22).

Spatial transcriptomics data were sourced from the Sparkle database [with sample identifiers as previously described (23)]. For the spatial transcriptomics analysis, we first identified each microregion characterized by a dominant cell type and detected its gene expression profile. After Z-score normalization, the data were visualized using the pheatmap package. Next, the spatial distribution of major cell types across microregions was computed and visualized using the SpatialPlot function of the Seurat package. Finally, Spearman correlation analysis was used to determine the correlation between cellular composition and gene expression data across all the detected spots with the linkET package, and the results were visualized to illustrate correlation patterns.

The diagnostic utility of HMCN1 was evaluated by constructing receiver operating characteristic (ROC) curves using the pROC package, and its prognostic value was assessed through Kaplan-Meier survival analysis (survival and survminer packages) and univariate/multivariate Cox regression analyses (forestplot package). The restricted cubic spline (RCS) method was employed to analyze potential non-linear relationships between variables. This statistical approach flexibly captures complex relationships between a continuous independent variable (HMCN1 expression in this case) and a dependent variable (survival time in this case) by fitting cubic polynomials at multiple knots and connecting them smoothly. In this study, RCS was incorporated into the Cox proportional hazards model to test for non-linear associations between HMCN1 expression and the hazard ratio (HR). The significance of any non-linear effect was assessed via hypothesis testing to enhance model accuracy and interpretability (24).

Based on data extracted from the TIDE database, the association of HMCN1 expression levels with response to immunotherapy and prognosis was analyzed to evaluate its potential as a predictor of immunotherapy response. The association of HMCN1 with immunotherapy response was assessed using data from the TIDE web platform. This analysis integrated transcriptomic and clinical data from a pan-cancer cohort (comprising non-small cell lung cancer, melanoma, and bladder cancer) who received anti-PD-1 or anti-CTLA-4 therapy. Patient response was defined based on the objective response rate according to RECIST criteria, as pre-computed by the TIDE framework.

Single nucleotide variation (SNV) data for 33 cancer types were collected from TCGA. The analyzed mutation types were Missense_Mutation, Silent, 5’ Flank, 3’ UTR, RNA, In_Frame_Del, Nonsense_Mutation, Splice_Site, Intron, 5’ UTR, In_Frame_Ins, Frame_Shift_Del, Nonstop_Mutation, 3’ Flank, Frame_Shift_Ins, and Translation_Start_Site. The SNV mutation frequency (expressed as a percentage) for each gene coding region was calculated using the following formula: (number of mutated samples/total number of samples for that cancer type) (25). Somatic copy number alterations for HMCN1 were analyzed using GISTIC 2.0 (26) on data from the TCGA pan-cancer cohort, with thresholds set as previously described (|G-score| > 0.1) (27). Data on structural variations (SVs) were obtained from the pre-computed TCGA which aggregates calls from established algorithms. Mutation spectrum oncoplots and lollipop plots were generated utilizing the cBioPortal database and the maftools R package, respectively, with protein domain information sourced from the PFAM database (https://www.ebi.ac.uk/interpro/). To further investigate the correlation between different gene sets and HMCN1 expression across the pan-cancer datasets, Spearman correlation analysis was employed. The resulting correlation coefficients and their corresponding statistical significance were visualized using radar plots (28, 29).

To systematically investigate the role of HMCN1 in the TME and its clinical implications, we integrated multi-dimensional analytical approaches. Samples were stratified into high- and low-HMCN1 groups based on the median expression level. The association between these groups and the six established immune subtypes (C1–C6) was then assessed using a Chi-square test. Subsequently, to more precisely delineate the relationship between HMCN1 expression gradients and immune features, patients were further stratified into four quartiles (Q1–Q4, where Q1 represents the highest 25% and Q4, the lowest 25%) based on HMCN1 expression levels. The average values of various immune scoring metrics were calculated for each quartile (with missing values ignored), and the expression patterns of immune features were visualized using the pheatmap package to comprehensively display the continuous trends between HMCN1 expression levels and the immune status of the TME (25). By leveraging the TIMER2.0 database, Spearman correlations between HMCN1 and different immune-infiltrating cells were computed using multiple algorithms, and the results were intuitively presented in a heatmap.

To explore potential therapeutic strategies targeting HMCN1-mediated tumor promotion, we performed a Connectivity Map (CMAP) analysis. By comparing patients with high versus low HMCN1 expression, we identified the 150 most significantly upregulated and 150 most significantly downregulated genes to construct an HMCN1-related gene signature. This signature was then matched against the perturbation profiles of 1,288 compounds in the CMAP database. Similarity scores were calculated using the XSum (eXtreme Sum) algorithm, and compounds with lower scores were considered potential candidates for reversing the HMCN1-mediated pro-tumor phenotype (30).

This study utilized the CancerSEA database, a resource that systematically integrates single-cell transcriptomic data reflecting 14 distinct functional states of cancer cells. The comprehensive score for each functional state was calculated using the z-score method from the Gene Set Variation Analysis (GSVA) R package. After standardization, this score was defined as the respective gene set activity index. Subsequently, the Pearson correlation between individual gene expression and these gene set activity scores was analyzed (31). Protein expression data were obtained from The Cancer Proteome Atlas. Patients were stratified into high and low HMCN1 protein expression groups based on the median expression level. Differences in pathway activity scores between these two groups were compared using the Wilcoxon test. Additionally, Gene Set Enrichment Analysis (GSEA) was performed using the clusterProfiler R package to further investigate the underlying biological mechanisms (32).

Human osteosarcoma (Saos-2, MG63, HOS, U-2OS, 143B) and osteoblastic (HOB) cell lines were obtained from the Cell Bank, Chinese Academy of Sciences (all certified) and cultured in Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin at 37°C in a 5% CO₂ atmosphere.

The mRNA expression level of HMCN1 in cells was determined by real-time quantitative PCR (RT-qPCR). Total RNA was extracted from cells using the TRIzol reagent (Vazyme Biotech, Nanjing, China, Cat# R401-01). cDNA was synthesized from 1 µg of total RNA using the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit (Vazyme Biotech, Cat# R323-01) according to the manufacturer’s instructions. RT-qPCR amplification was performed on a QuantStudio 5 Real-Time PCR System (Applied Biosystems, USA) using the ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech, Cat# Q711-02). The reaction conditions were as follows: initial denaturation at 95°C for 30 s, followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. GAPDH served as the internal reference gene. The relative gene expression levels were calculated and analyzed using the 2^–ΔΔCt method. All primers utilized in this study were synthesized by Wuhan Servicebio Technology Co. Ltd. The primer sequences were as follows: HMCN1 (NM_031935.3) forward: ACTGATGCTCGGTCCAAAGATTA, reverse: CTTGACCAGAACTTGTAGAGGCA (amplicon: 163 bp); GAPDH (NM_002046.7) forward: GGAAGCTTGTCATCAATGGAAATC, reverse: TGATGACCCTTTTGGCTCCC (amplicon: 168 bp).

Total proteins were extracted from a panel of osteosarcoma cell lines (Saos-2, MG63, HOS, U-2OS, 143B) and a human osteoblast cell line (HOB) as a control. Cells were washed with cold PBS and lysed on ice using RIPA Lysis Buffer (Beyotime Biotechnology, Shanghai, China, Cat# P0013B) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF, Beyotime, Cat# ST506) and a protease inhibitor cocktail (MedChemExpress, China, Cat# HY-K0010). The lysates were centrifuged at 12,000 × g for 15 min at 4°C, and the supernatants were collected. To manipulate HMCN1 expression, cells were transfected with three distinct HMCN1-specific siRNAs (si-HMCN1-1, si-HMCN1-2, si-HMCN1-3) designed and synthesized by GWuhan Servicebio Technology Co. Ltd (China) or an HMCN1 overexpression construct (OE-HMCN1), using non-targeting siRNA and an empty vector as negative controls. The siRNA sequences were as follows: si-HMCN1-1: 5’-GCAUCAAGAUUACCGUUUATT-3’; si-HMCN1-2: 5’-CCUGUACAAGAGGACCAUUTT-3’; si-HMCN1-3: 5’-GGAGAAGUUCUACAACAAATT-3’. The protein concentration of all lysates was quantified using a bicinchoninic acid (BCA) assay kit (Beyotime, Cat# P0012). Subsequently, equal amounts of protein (10-30 µg per lane) were separated by 8-12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electrophoretically transferred onto polyvinylidene difluoride membranes (Millipore, USA) under a constant current of 300 mA. The membranes were blocked with 5% non-fat milk for 2 h at room temperature and then incubated overnight at 4°C with specific primary antibodies diluted in TBST containing 5% bovine serum albumin. The primary antibodies and their dilutions were as follows: anti-HMCN1 (1:1000, Thermo Fisher Scientific, Cat# PA5-149932), anti-E-cadherin (1:2000, CST, #3195), anti-N-cadherin (1:1500, Proteintech, 22018-1-AP), anti-Vimentin (1:1000, CST, #5741), anti-Snail (1:1000, CST, #3879), and anti-GAPDH (1:5000, Proteintech, 60004-1-Ig), as previously described (33). After thorough washing, the membranes were incubated with appropriate horseradish peroxide-conjugated secondary antibodies (1:5000, Abbkine, China). Protein bands were visualized using an enhanced chemiluminescence (ECL) detection kit (New Cell & Molecular Biotech, Suzhou, China, Cat# P10300) and the band intensity was quantified with the ImageJ software (National Institutes of Health, USA). GAPDH was used as an internal loading control for normalization.

For the wound healing assay, 5 × 10⁵ cells were seeded per well in 6-well plates. Once the cells reached 100% confluence, uniform scratches were created across pre-marked lines using a sterile 200 µL pipette tip. The plates were washed with phosphate-buffered saline to remove detached cells and then replaced with serum-free medium to minimize cell proliferation. Images of the same fields were captured at 0 h and 24 h using an inverted microscope (Olympus, Japan). The wound closure area was quantified using ImageJ software. For the Transwell invasion assay, Transwell chambers (Corning, USA, Cat# 3422) with 8-µm pores were pre-coated with Matrigel (Corning, Cat# 356234) diluted 1:8 in serum-free medium, and solidified at 37°C for 4 hours. Serum-free medium containing 1 × 10⁵ cells was added to the upper chamber, while the lower chamber was filled with medium supplemented with 20% fetal bovine serum as a chemoattractant. Following 24 h of incubation, non-invading cells on the upper surface were carefully removed with a cotton swab. The cells that had invaded through the Matrigel were fixed with 4% paraformaldehyde for 30 minutes, stained with 0.1% crystal violet for 20 minutes, and subsequently quantified by counting cells in five random fields under the microscope. The migration assay was performed similarly but without Matrigel coating. All assays were performed in triplicate and repeated three times independently.

All statistical analyses were conducted using the R 4.4.1 software and GraphPad Prism 8.4.0. Group comparisons were performed as follows: Student’s t-test for parametric data, Wilcoxon test for non-parametric data, Chi-square or Fisher’s exact test for categorical variables, and one-way ANOVA or Kruskal-Wallis test for comparison of multiple groups. Correlations were assessed using Pearson’s (normal distribution) or Spearman’s (non-normal distribution) methods. Survival was analyzed using Cox proportional hazards regression and log-rank tests. In the meta-analysis, heterogeneity was quantified with Cochran’s Q and I². I² >50% was considered to indicate significant heterogeneity (p < 0.05), in which case a random-effects model was applied. In case of I² <50%, a fixed-effects model was used. Statistical significance was defined as p < 0.05.

Bibliometric analysis indicated that HMCN1 oncological research remains nascent, even though it has recently gained traction. Moreover, the published literature largely focuses on prognosis, mutation, and therapy (Supplementary Figures 1A, B). Accurate identification of the subcellular localization of HMCN1 is crucial for a deeper understanding of its biological significance, as gene function is dependent on its subcellular localization (34). Localization analysis based on the UniProt database indicated that HMCN1 is primarily distributed in the Golgi apparatus and cytoplasm, which is consistent with its biosynthesis and secretion pathway as a large extracellular matrix glycoprotein. Its functional deposition into the extracellular matrix and basement membrane is well-established, as demonstrated in models of skin and tendon junctions (12). Concurrently, we obtained three-dimensional structural information of this protein from Protein Data Bank (Figures 1A, B), and this was used as a structural basis for further functional investigations, which is critical to note that this model is not experimentally verified and covers only a portion of the full-length protein. Structural information should be regarded as a putative visual guide rather than a definitive structural basis.

Next, the mRNA expression level of HMCN1 was compared between various tumor tissues and corresponding normal tissues using data from the TCGA and GTEx databases. The results showed that HMCN1 mRNA expression was significantly elevated in cancers such as glioblastoma multiforme (GBM), skin cutaneous melanoma (SKCM), and kidney renal clear cell carcinoma (KIRC) (Figure 1C). Furthermore, paired analysis using data from the TCGA pan-cancer dataset consistently demonstrated that HMCN1 mRNA expression was markedly upregulated in most tumor tissues compared to adjacent normal tissues (Figure 1D). To determine whether this genetic dysregulation also manifests at the protein level, we integrated and analyzed pan-cancer proteomics data from CPTAC (https://pdc.cancer.gov/pdc/browse). The results revealed that although HMCN1 protein expression showed an upward trend in most cancer types, this dysregulation was statistically significant only in a few cases (Figure 1E). To further clarify its expression characteristics at the protein level, we performed supplementary validation using the Human Protein Atlas dataset. The results suggested that HMCN1 expression was highest in bone cancer cell lines (Figure 1F). This explains the lack of significant results in the CPTAC dataset. Analysis using Chronos loss-of-function scores indicated that HMCN1 plays important functional roles in various malignancies, including osteosarcoma (Figure 1G). These findings indicate its potential involvement in carcinogenesis as a tumor-associated gene.

Multi-omics technologies, particularly the application of single-cell sequencing, have significantly enhanced the precision of detecting gene expression patterns (35). Therefore, we applied this technology to determine the expression of HMCN1 in specific cell types by analyzing pan-cancer single-cell RNA sequencing data from the TISCH database. The results showed that HMCN1 is primarily expressed in fibroblasts, endothelial cells, and a subset of tumor cells (Supplementary Figure 1C). To further validate this expression pattern and confirm it spatially, we integrated and analyzed pan-cancer spatial transcriptomics data. The results confirmed significant HMCN1 expression in the aforementioned cell types (Supplementary Figure 1D).

Building on the above results, we investigated the spatial distribution heterogeneity of HMCN1 within the TME. Using spatial transcriptomics data from GBM, SKCM, and KIRC, we categorized tissue regions into three types based on the proportion of malignant cells within each microregion (spot): regions with a malignant cell proportion of 1 were defined as malignant regions; those with a proportion of 0, as normal regions; and the rest, as mixed malignant regions (23). The SpatialPlot function of the Seurat package was used to visualize the major cell types and HMCN1 expression distribution across these microregions (36). The results demonstrated that HMCN1 expression levels were significantly higher in malignant regions than in normal and mixed regions. Further, Spearman correlation analysis of the correlation between cellular composition and HMCN1 expression levels across all microregions, performed using the linkET package, revealed a significant positive correlation between HMCN1 expression and malignant cell content in tumor cell-enriched areas (Supplementary Figure 2). In summary, HMCN1 exhibits an overexpression pattern in various cancer tissues, and its expression is spatially concentrated in malignant areas in a way that is highly consistent with the distribution of tumor cells. This suggests that HMCN1 holds potential as a clinical diagnostic biomarker, a possibility that was explored in the following experiments.

Using data from the TCGA database, we first assessed the association between HMCN1 expression and tumor status using univariate logistic regression analysis. The results showed that in multiple cancer types, including GBM, SKCM, and KIRC, the odds ratios were all greater than 1. This indicates that elevated HMCN1 expression is significantly associated with the tumor state, reflecting its differential expression between malignant and normal tissues. (Table 1). Subsequently, OS, DSS, PFI, and DFI were analyzed using Cox proportional hazards regression models and the log-rank test. OS analysis indicated that high HMCN1 expression was significantly associated with shortened OS in patients with BLCA, KIRP, MESO, OV, and stomach adenocarcinoma (STAD). Furthermore, HMCN1 was also a significant risk factor for worsened DFI in these cancers. With regard to PFI, high HMCN1 expression was an independent risk factor for COAD and KIRP (Figure 2A). To further validate the prognostic value of HMCN1, we performed validation in multiple independent external datasets. The results consistently demonstrated that HMCN1 is a significant unfavorable prognostic factor in various cancers. However, in KIRC, despite upregulated HMCN1 expression across multiple datasets, it exhibited a protective prognostic effect (Figure 2B). This paradoxical association might reflect tissue-specific biological functions of HMCN1, potentially related to its role in maintaining structural integrity in renal tissues, though the precise mechanisms warrant further investigation.

The potential non-linear relationship between HMCN1 expression levels and OS was thoroughly investigated with the flexible RCS method (24). The results showed that in cancers such as BLCA, STAD, KIRP, and PAAD, the effect of HMCN1 expression on survival risk followed a linear trend. The red solid line in the figure indicates that the HR increases linearly with rising HMCN1 expression, with a statistically significant overall association observed (P-overall < 0.05) (Figure 2C). The result of the non-linearity test was not significant (P-non-linear > 0.05); thus, there was no apparent non-linear effect of this gene in the aforementioned cancers. This finding suggests a stable and consistent exposure-response relationship between HMCN1 expression levels and patient prognosis in the case of these cancers. Its impact pattern demonstrates good interpretability and predictability and supports its use as a reliable linear prognostic indicator for subsequent research and clinical risk modeling (Figure 2C).

Previous studies have indicated that in STAD, the phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha (PIK3CA) and HMCN1 co-mutation significantly reduced patient mortality risk. When this combination further co-occurred with low-density lipoprotein receptor-related protein 1B (LRP1B) or AHNAK nucleoprotein 2 (AHNAK2) mutations, distinct survival curves were observed. The survival results implied that HMCN1 mutation might exert a protective effect by influencing signaling pathways or microenvironment stability in the context of synergistic mutations. However, the role of HMCN1 alone remained unclear in the previous study (37). Therefore, this study used a comprehensive supplementary analysis to investigate further the role of HMCN1 in STAD. Analysis based on the GSE13861, GSE15459, and GSE26901 datasets revealed that high HMCN1 expression was significantly associated with higher mortality (Supplementary Figure 3A). A meta-analysis further confirmed that high HMCN1 expression was significantly correlated with poorer overall survival in patients with STAD (pooled HR = 1.23, 95% confidence interval [CI] = 1.16–1.30, p < 0.01; Supplementary Figure 3B). Multivariate Cox regression analysis showed that after adjusting for multiple clinical variables, high HMCN1 expression remained significantly associated with adverse prognosis (HR > 1, p < 0.05); thus, it could serve as an independent prognostic factor in STAD (Supplementary Figure 3C). Finally, ROC curve analysis confirmed that HMCN1 has high accuracy in distinguishing tumor from normal tissue and is applicable to most cancer types (Figure 2D). Overall, these findings demonstrate that HMCN1 holds diagnostic and prognostic value across different cancer types.

We first mapped the mutation spectrum of HMCN1 across pan-cancer datasets by color coding the circles corresponding to each mutation type in the plot (Figure 3A). Further analysis based on the cBioPortal database revealed differential mutation frequencies of HMCN1 across various cancer types. Specifically, HMCN1 gene amplification was primarily observed in cholangiocarcinoma, while deep deletions and structural variants were more prevalent in sarcoma (Figure 3B). Analysis of SNV data from the TCGA database indicated that HMCN1 exhibits a moderate mutation frequency in several cancers, with the frequency being particularly high in SKCM (Figure 3C). A mutation landscape generated by the maftools package revealed that missense mutations constitute the predominant mutation type for HMCN1 (Figure 3D). Furthermore, Spearman correlation analysis revealed a significant positive association between HMCN1 expression levels and various genomic instability scores across multiple cancers. It is important to note that this observed association could be confounded by underlying factors such as tumor purity and proliferation rate. Nonetheless, this pan-cancer pattern suggests a potential link between HMCN1 expression and a genomic context characterized by higher chromosomal instability. These associations were intuitively presented via a radar chart, which highlighted the potential value of HMCN1 as a therapeutic target (Figure 3E).

Analysis of the relationship between HMCN1 expression levels and the distribution of immune subtypes revealed that in tumors with high HMCN1 expression, the proportion of the C3 subtype (an inflammatory subtype, characterized by high expression of Th17- and Th1-related genes and typically associated with weaker tumor proliferation inhibition) was significantly increased, whereas the proportion of the C5 subtype (an immunologically quiet subtype) was lower (Figure 4A) (25). This distribution pattern, combined with the poor prognosis of HMCN1-high patients, led us to hypothesize that this immune-infiltrated microenvironment is functionally impaired. To test this, we assessed the relationship between HMCN1 and markers of T-cell exhaustion. We found that HMCN1 expression was significantly positively correlated with the levels of key immune checkpoint and exhaustion genes, including PDCD1 (PD-1) and CTLA4 (Supplementary Figure 4). This indicates that the HMCN1-high TME is not one of effective anti-tumor immunity, but rather a state of T-cell dysfunction and exhaustion, which facilitates immune evasion and explains the associated poor outcomes.

Previous studies have emphasized the crucial role of the TME in tumor progression and treatment response (38). Based on this, we employed multiple algorithms to further evaluate the correlation between HMCN1 and the abundance of various cell types in the tumor microenvironment. The results showed that HMCN1 had significant positive correlations with the infiltration levels of multiple immune cell types as well as stromal cells, such as endothelial cells, across the pan-cancer datasets (Figure 4B). By integrating this information with the aforementioned immune subtype characteristics, we hypothesize that this inflammatory microenvironment might represent a “dysfunctional” or “ineffective immune activation” state. That is, the substantial immune cell infiltration does not lead to effective killing of tumor cells but, instead, indirectly promotes tumor progression through sustained pro-inflammatory signaling. To systematically validate this hypothesis, we analyzed the association between HMCN1, genomic status, and immune infiltration patterns based on immunogenicity scores, DNA damage scores, and HMCN1 expression quartiles, and the results further supported the above observations (Figure 4C).

Our analysis revealed that patients who did not respond to immunotherapy exhibited high HMCN1 expression and were associated with a worse prognosis (Figures 4D, E). This observation suggests that high HMCN1 expression might be linked to immunotherapy resistance. Conversely, patients with low HMCN1 expression showed the highest rate of effective response to immunotherapy. This finding implies that targeted inhibition of HMCN1 could represent a novel sensitization strategy. Thus, HMCN1 could be regarded as a potential combination target for immunotherapy and offers a new direction for pan-cancer immunotherapy strategies. Following this, we conducted predictive screening for HMCN1-specific drugs with tumor sensitivity. Pan-cancer analysis indicated that arachidonyltrifluoromethane (also known as Arachidonyl trifluoromethyl ketone, AACOCF3; CAS# 149301-79-1) had the highest sensitivity across multiple cancers and might have potential as a targeted intervention drug (Figure 4F). This compound is a recognized inhibitor of cytosolic phospholipase A2 (cPLA2), with a known mechanism involving the blockade of arachidonic acid release. It is critical to clarify that this identification stems from a computational analysis of the Connectivity Map (CMAP) database, and the precise connectivity score and false discovery rate (FDR) for this specific prediction are unavailable. Most importantly, this prediction has not been experimentally validated and thus remains a hypothesis-generating finding for future research.

Analysis based on protein expression data from The Cancer Proteome Atlas and pathway activity scores revealed that in the vast majority of cancer types, the high HMCN1 expression groups showed significant enrichment in EMT-related pathways, while cell cycle pathway activity was relatively lower (Figure 5A). This suggests that high HMCN1 expression is associated with malignant tumor progression and is linked to the EMT process rather than directly by driving cell proliferation during cancer advancement. Further enrichment analysis indicated that multiple oncogenic signaling pathways were significantly enriched in the high HMCN1 expression group, whereas cell cycle-related pathways were more active in the low expression group, consistent with the above findings (Figure 5B). To delve deeper into its functional states, we analyzed the activity of 14 cancer functional states using the CancerSEA database. Detection via GSVA and the z-score-based algorithm confirmed that HMCN1 expression was positively correlated with pro-tumor processes such as EMT, angiogenesis, invasion, and metastasis, while simultaneously confirming its negative correlation with cell cycle activity (Figure 5C).

Previous studies have shown that the ECM can drive EMT through various mechanisms, thereby promoting tumor progression and metastasis, and indicate that ECM remodeling is a key driver of the EMT process in the TME. To investigate the role of HMCN1 in this process, we further analyzed the correlation between its expression levels and EMT scores across 33 cancers. The results demonstrated that, except in the case of uveal melanoma, HMCN1 showed a positive correlation with EMT scores in all the other cancer types examined. This suggests that HMCN1 expression is a highly conserved indicator of EMT activity across cancer types. (Figure 5D).

No studies have yet investigated HMCN1 expression in osteosarcoma or its impact on patient prognosis. Therefore, we focused our analysis on its mechanism of action in this tumor. We integrated mRNA expression profiles from 10 data platforms comprising a total of 540 cases, including 414 osteosarcoma and 126 non-osteosarcoma cases, and the results showed that HMCN1 mRNA expression was significantly higher in the osteosarcoma group than in the non-osteo-sarcoma group (standardized mean difference = 0.80, 95% CI: 0.47–1.14; p = 0.024) (Figure 6A). Further, prognostic analysis indicated that high HMCN1 expression was significantly associated with poor prognosis in patients with osteosarcoma (Figure 6B).

Next, we investigated the cellular heterogeneity of osteosarcoma and distribution of HMCN1 expression across cell types through single-cell transcriptome sequencing analysis. The results revealed that HMCN1 expression was the highest in malignant osteosarcoma cells (Figure 6C). We further identified all cell subpopulations and classified them into HMCN1-positive and HMCN1-negative groups based on HMCN1 expression levels. We then calculated the proportion of each cell subpopulation within these two groups to identify the primary cell types contributing to HMCN1 expression. Malignant cells constituted a significantly higher proportion of HMCN1-positive cell populations (48.1%) than HMCN1-negative cell populations (18.5%); this implies that malignant cells are probably the primary source of HMCN1 expression (Figure 6D). These results provide important cellular-level evidence for further investigating the role of HMCN1 in osteosarcoma development and progression.

We note that the RPPA platform employed by TCPA utilizes a predefined antibody panel, whose coverage for specific EMT-related phospho-proteins may be limited. Therefore, to more directly and definitively test the relationship between HMCN1 and EMT, we turned to functional validation. Our preliminary findings suggest that HMCN1 might drive tumor progression primarily by promoting the EMT process rather than directly regulating cell proliferation. To validate this mechanism in the context of osteosarcoma, we utilized the GSE146773 dataset. We sorted 1,152 U2OS FUCCI cells via fluorescence-activated cell sorting and performed single-cell RNA sequencing using the SMART-seq2 technology to simultaneously obtain gene expression profiles and cell cycle phase information for individual cells (39). The results showed that there was no significant variation in HMCN1 expression levels across different cell cycle phases (Figure 6E), indicating that its expression is not regulated by the cell cycle. Furthermore, in both the GSE39055 and GSE21257 datasets, HMCN1 expression showed significant positive correlations with EMT functional state scores (Figure 6F). This strongly supporting a potential role for HMCN1 in the EMT process during osteosarcoma progression (as observed from the pan-cancer data analysis).

To functionally validate the role of HMCN1 in driving malignancy via regulation of EMT in osteosarcoma, we conducted a series of in vitro experiments. We first confirmed that HMCN1 was significantly overexpressed at both the mRNA and protein levels in osteosarcoma cell lines using RT-qPCR and western blot analysis: MG63 and Saos-2 cells showed the most prominent upregulation of HMCN1 in comparison to cells (Figures 7A, B). Based on this finding, we constructed three distinct HMCN1-targeting siRNAs and one overexpression vector. si-HMCN1–2 demonstrated the most potent knockdown efficiency at the HMCN1 protein level and was, therefore, selected for all subsequent functional experiments (Figure 7C). Wound healing and Transwell assay results indicated that knocking down HMCN1 significantly inhibited the migration and invasion capabilities of osteosarcoma cells, whereas its overexpression produced the opposite, promotive effect (Figures 7D–F). To further explore the underlying mechanism, we examined the impact of HMCN1 on key EMT markers and found that HMCN1 overexpression significantly upregulated the expression of N-cadherin, vimentin, and Snail, while downregulating E-cadherin. Conversely, HMCN1 knockdown had the opposite effect. These functional gains and losses, coupled with the consistent shifts in EMT marker expression, demonstrate that HMCN1 promotes osteosarcoma cell invasion and migration by regulating the EMT process (Figure 8).