<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Oncol.</journal-id>
<journal-title>Frontiers in Oncology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Oncol.</abbrev-journal-title>
<issn pub-type="epub">2234-943X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fonc.2023.1213678</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Oncology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Structural characterization of human <italic>de novo</italic> protein NCYM and its complex with a newly identified DNA aptamer using atomic force microscopy and small-angle X-ray scattering</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Yamamoto</surname>
<given-names>Seigi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kono</surname>
<given-names>Fumiaki</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/875267"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Nakatani</surname>
<given-names>Kazuma</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2339616"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Hirose</surname>
<given-names>Miwako</given-names>
</name>
<xref ref-type="aff" rid="aff6">
<sup>6</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2406011"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Horii</surname>
<given-names>Katsunori</given-names>
</name>
<xref ref-type="aff" rid="aff6">
<sup>6</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Hippo</surname>
<given-names>Yoshitaka</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="aff" rid="aff7">
<sup>7</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/871164"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tamada</surname>
<given-names>Taro</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff8">
<sup>8</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1403925"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Suenaga</surname>
<given-names>Yusuke</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1457107"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Matsuo</surname>
<given-names>Tatsuhito</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1441563"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Laboratory of Evolutionary Oncology, Chiba Cancer Center Research Institute</institution>, <addr-line>Chiba</addr-line>, <country>Japan</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Institute for Quantum Life Science, National Institutes for Quantum Science and Technology</institution>, <addr-line>Chiba</addr-line>, <country>Japan</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Graduate School of Medical and Pharmaceutical Sciences, Chiba University</institution>, <addr-line>Chiba</addr-line>, <country>Japan</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Innovative Medicine CHIBA Doctoral WISE Program, Chiba University</institution>, <addr-line>Chiba</addr-line>, <country>Japan</country>
</aff>
<aff id="aff5">
<sup>5</sup>
<institution>All Directional Innovation Creator Ph.D. Project, Chiba University</institution>, <addr-line>Chiba</addr-line>, <country>Japan</country>
</aff>
<aff id="aff6">
<sup>6</sup>
<institution>Digital Healthcare Business Development Office, NEC Solution Innovators, Ltd.</institution>, <addr-line>Tokyo</addr-line>, <country>Japan</country>
</aff>
<aff id="aff7">
<sup>7</sup>
<institution>Laboratory of Precision Tumor Model Systems, Chiba Cancer Center Research Institute</institution>, <addr-line>Chiba</addr-line>, <country>Japan</country>
</aff>
<aff id="aff8">
<sup>8</sup>
<institution>Graduate School of Science, Chiba University</institution>, <addr-line>Chiba</addr-line>, <country>Japan</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Tao Liu, University of New South Wales, Australia</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Bruce A. Shapiro, National Cancer Institute at Frederick (NIH), United States; Takeru Hayashi, Institute of Microbial Chemistry (IMC), Japan</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Yusuke Suenaga, <email xlink:href="mailto:ysuenaga@chiba-cc.jp">ysuenaga@chiba-cc.jp</email>;  Tatsuhito Matsuo, <email xlink:href="mailto:matsuo.tatsuhito@qst.go.jp">matsuo.tatsuhito@qst.go.jp</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>23</day>
<month>11</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>13</volume>
<elocation-id>1213678</elocation-id>
<history>
<date date-type="received">
<day>28</day>
<month>04</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>03</day>
<month>11</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Yamamoto, Kono, Nakatani, Hirose, Horii, Hippo, Tamada, Suenaga and Matsuo</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Yamamoto, Kono, Nakatani, Hirose, Horii, Hippo, Tamada, Suenaga and Matsuo</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>NCYM, a Homininae-specific oncoprotein, is the first <italic>de novo</italic> gene product experimentally shown to have oncogenic functions. NCYM stabilizes MYCN and &#x3b2;-catenin via direct binding and inhibition of GSK3&#x3b2; and promotes cancer progression in various tumors. Thus, the identification of compounds that binds to NCYM and structural characterization of the complex of such compounds with NCYM are required to deepen our understanding of the molecular mechanism of NCYM function and eventually to develop anticancer drugs against NCYM. In this study, the DNA aptamer that specifically binds to NCYM and enhances interaction between NCYM and GSK3&#x3b2; were identified for the first time using systematic evolution of ligands by exponential enrichment (SELEX). The structural properties of the complex of the aptamer and NCYM were investigated using atomic force microscopy (AFM) in combination with truncation and mutation of DNA sequence, pointing to the regions on the aptamer required for NCYM binding. Further analysis was carried out by small-angle X-ray scattering (SAXS). Structural modeling based on SAXS data revealed that when isolated, NCYM shows high flexibility, though not as a random coil, while the DNA aptamer exists as a dimer in solution. In the complex state, models in which NCYM was bound to a region close to an edge of the aptamer reproduced the SAXS data. Therefore, using a combination of SELEX, AFM, and SAXS, the present study revealed the structural properties of NCYM in its functionally active form, thus providing useful information for the possible future design of novel anti-cancer drugs targeting NCYM.</p>
</abstract>
<kwd-group>
<kwd>
<italic>de novo</italic> protein</kwd>
<kwd>NCYM</kwd>
<kwd>DNA aptamer</kwd>
<kwd>solution structure</kwd>
<kwd>AFM</kwd>
<kwd>SAXS</kwd>
</kwd-group>
<counts>
<fig-count count="7"/>
<table-count count="1"/>
<equation-count count="3"/>
<ref-count count="58"/>
<page-count count="14"/>
<word-count count="7565"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Molecular and Cellular Oncology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>
<italic>NCYM</italic>, a <italic>cis</italic>-antisense gene of <italic>MYCN</italic>, encodes a Homininae-specific oncoprotein (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B2">2</xref>). In human neuroblastomas, <italic>NCYM</italic> is always co-amplified with <italic>MYCN</italic>, and its expression level is associated with poor prognosis (<xref ref-type="bibr" rid="B1">1</xref>). NCYM stabilizes MYCN via inhibition of GSK3&#x3b2;, whereas MYCN stimulates both <italic>MYCN</italic> and <italic>NCYM</italic> transcription (<xref ref-type="bibr" rid="B1">1</xref>). This feedback loop contributes to the maintenance of high levels of both MYCN and NCYM expressions in <italic>MYCN</italic>-amplified neuroblastomas (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B2">2</xref>). NCYM enhances the metastasis of neuroblastomas (<xref ref-type="bibr" rid="B1">1</xref>) possibly via inhibition of apoptotic cell death (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B3">3</xref>, <xref ref-type="bibr" rid="B4">4</xref>) and/or regulation of stemness (<xref ref-type="bibr" rid="B5">5</xref>, <xref ref-type="bibr" rid="B6">6</xref>). Furthermore, NCYM has been shown to be associated with progression of adult cancers (<xref ref-type="bibr" rid="B2">2</xref>, <xref ref-type="bibr" rid="B7">7</xref>). Therefore, NCYM is a promising target protein for anti-cancer therapy. However, the difficulty in determining its structure hinders drug design (<xref ref-type="bibr" rid="B8">8</xref>).</p>
<p>
<italic>NCYM</italic> is a newly evolved coding gene that originated from <italic>MYCN</italic> promoter region during the evolution of the Homininae (<xref ref-type="bibr" rid="B1">1</xref>, <xref ref-type="bibr" rid="B2">2</xref>). New genes originating from non-genic regions are known as <italic>de novo</italic> gene birth (<xref ref-type="bibr" rid="B9">9</xref>&#x2013;<xref ref-type="bibr" rid="B11">11</xref>), and NCYM is the first <italic>de novo</italic> gene product experimentally shown to have oncogenic functions. Owing to their <italic>de novo</italic> emergence, <italic>de novo</italic> proteins show no homology to known genes and do not have any domains or motifs. The amino acid sequence of <italic>de novo</italic> proteins is similar to a random sequence (<xref ref-type="bibr" rid="B12">12</xref>), although a recent report identified the difference between <italic>de novo</italic> proteins and unevolved random-sequence counterparts in that <italic>de novo</italic> proteins exhibit moderately higher solubility in cells (<xref ref-type="bibr" rid="B13">13</xref>). Four <italic>de novo</italic> proteins have been structurally characterized to date: Bsc4 (<xref ref-type="bibr" rid="B14">14</xref>), NCYM (<xref ref-type="bibr" rid="B8">8</xref>), Goddard (<xref ref-type="bibr" rid="B15">15</xref>), and AFGP8 (<xref ref-type="bibr" rid="B16">16</xref>); however, mainly because of their highly disordered nature, none of the complete structures have been determined. Upon binding to the ice surface, the local structure of the antifreeze glycoprotein AFGP8 make a transition from a disordered to an ordered state (<xref ref-type="bibr" rid="B16">16</xref>), indicating the possibility of significant ordering of <italic>de novo</italic> proteins via complex formation with binding partners. Consistent with an earlier prediction that NCYM binds to DNA (<xref ref-type="bibr" rid="B17">17</xref>), we have previously found that benzonase treatment significantly improves the solubility of NCYM (<xref ref-type="bibr" rid="B8">8</xref>). These observations led us to identify DNA aptamers that bind specifically to NCYM and to consider that analysis of the complex of NCYM and DNA aptamers may contribute to the characterization of the structural dynamics of NCYM.</p>
<p>Here, three types of DNA aptamers were identified by systematic evolution of ligands by exponential enrichment (SELEX) and their interactions with NCYM were characterized by atomic force microscopy (AFM). Moreover, the structure of the NCYM-DNA complex of a representative DNA aptamer (named &#x201c;No. 1&#x201d;), which enhances interaction between NCYM and GSK3&#x3b2;, was analyzed using small-angle X-ray scattering (SAXS).</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Aptamer selection procedure</title>
<p>SELEX was performed as previously reported with some modifications (<xref ref-type="bibr" rid="B18">18</xref>, <xref ref-type="bibr" rid="B19">19</xref>). Dynabeads&#x2122; MyOne&#x2122; Carboxylic Acid (CA) magnetic beads (Invitrogen, Waltham, MA) were used for NCYM solidification to segregate NCYM-binding DNA molecules from the non-binding molecules. The target beads were prepared by an amine coupling reaction using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC; Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer&#x2019;s instructions and washed with the selection buffer [SB; 40 mM HEPES (pH 7.5), 125 mM NaCl, 5 mM KCl, 1 mM MgCl<sub>2</sub>, and 0.01% Tween 20]. Briefly, the CA magnetic beads were washed twice with 500 &#x3bc;l of 100 mM 2-Morpholinoethanesulfonic acid mono hydrate (MES) buffer at pH 6.0. After added 50 &#x3bc;l of 100 mM MES buffer and 50 &#x3bc;l of EDC, and the mixture was incubated for 30 minutes at room temperature. The mixture was then mixed with 200 &#x3bc;g of NCYM in 100 mM MES buffer and incubated over night at room temperature to react with the amino group of NCYM and the carboxylic acid of the CA magnetic beads. Next, they were washed twice with 500 &#x3bc;l of PBST (0.1% Tween20 in phosphate buffered saline, PBS) and 500 &#x3bc;l of PBST-BSA (0.1% bovine serum albumin in PBST) was added. Before using the target beads, they were washed twice with 1&#xa0;ml of SB.</p>
<p>An initial single-stranded DNA (ssDNA) pool, 5&#x2032;-GGAATGTGGTCCCTCGCAATAAATC-(N30)- GAAATGAGCCCTTTGACCCTGTAC-3&#x2032;, containing 30 random nucleotides between forward (Fw) and revers (Rv) primer region was purchased from Integrated DNA Technologies (Tokyo, Japan). The selection of aptamers was performed starting from 4.5 nmol of DNAs (~10<sup>15</sup> molecules) in 100 &#x3bc;l of SB. The pool was mixed for 15 minutes with 250 &#x3bc;g of target beads at 25&#xb0;C. The beads were then washed with SB, and the bound ssDNA was eluted with 7 M urea. After recovery of the eluted ssDNA using Rv primer beads, polymerase chain reaction (PCR) was performed with KOD Dash DNA polymerase (Toyobo, Osaka, Japan), a forward (Fw) primer (5&#x2019;-GGAATGTGGTCCCTCGCAATAAATC-3&#x2019;) and a reverse (Rv) primer (5&#x2019;-GTACAGGGTCAAAGGGCTCATTTC-3&#x2019;) with modification by the 5&#x2019;-biotin. Next, the amplified double stranded DNA (dsDNA) was bound to MyOne SA C1 magnetic beads, and the Fw chain (ssDNA) was eluted with 0.02M NaOH. The ssDNA was used for the next round.</p>
<p>After eight rounds of selection, the frequency of ssDNA sequences was determined by next-generation sequencing (NGS) from rounds 3 to 8 of SELEX using a MiniSeq System (Illumina, San Diego, CA, USA). Sequencing data were preprocessed by using the program of PRINSEQ++ (<xref ref-type="bibr" rid="B20">20</xref>) and adopted above 99.9% of the base calling accuracy (Q score of 30 and above).</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Bio-layer interferometry</title>
<p>All the Bio-Layer Interferometry (BLI) measurements were performed at 25&#xb0;C using an Octet&#xae; RED96e system (Sartorius AG, Goettingen, Germany). All the samples were placed in a 96 well microplate and the sample volume was 200 &#x3bc;l/well. The microplate was shaked at 1,000 rpm during the measurement. As a ligand, each aptamer with 5&#x2019;-biotin modification was immobilized on an Octet&#xae; SA biosensor chip (Sartorius). For kinetics analysis, different concentrations of NCYM (25-400nM) were used. The dissociation constants between the aptamer and NCYM were calculated using a simple 1:1 biomolecular interaction model according to the manufacturer&#x2019;s instructions.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Construction of DNA frame structures and introduction of aptamers for AFM imaging</title>
<p>To gain insights into the mechanism of interactions between NCYM and the aptamers obtained by SELEX, NCYM-aptamer binding was studied at the single molecule level using AFM. Scaffolds prepared using the DNA origami method were used for this purpose. The DNA origami method allows the creation of structures of any shape and the introduction of functional molecules anywhere in the structure. Therefore, single-molecule observation using DNA origami structures is suitable for evaluating biomolecules and has been used to observe various molecules (<xref ref-type="bibr" rid="B21">21</xref>&#x2013;<xref ref-type="bibr" rid="B29">29</xref>). In this study, we used a DNA frame structure (<xref ref-type="bibr" rid="B21">21</xref>). The DNA frame contains a space inside, and dsDNA can be introduced into any sequence.</p>
<p>DNA frames were prepared as previously described (<xref ref-type="bibr" rid="B21">21</xref>). A solution containing 10 nM M13mp18 ssDNA (tilibit nanosystems GmbH, Germany), 25 nM staples (2.5 eq), 20 mM Tris-HCl (pH 7.4), 10 mM MgCl<sub>2</sub>, 1mM EDTA was prepared and annealed at a rate of -1&#xb0;C per minute from 85&#xb0;C to 15&#xb0;C.</p>
<p>Aptamers and DNA oligos for the DNA frame were purchased from Eurofins Genomics K.K. (Tokyo, Japan) and used without further purification. In this study, three types of aptamers, which showed high affinity among the aptamers obtained by SELEX, were employed, and the sequences of which for AFM observation are as follows:</p>
<list list-type="simple">
<list-item>
<p>No. 1: 5&#x2019;-GGAATGTGGTCCCTCGCAATAAATCTATGTACGTTATTCCCCTTTGACC</p>
</list-item>
<list-item>
<p>AATGCTGAAATGAGCCCTTTGACCCTGTAC <bold>TTTT</bold>
<underline>TTTCCAGCGGGACTAGCGCGTTGCTCCTCACT</underline>-3&#x2019;</p>
</list-item>
<list-item>
<p>No. 2: 5&#x2019;-GGAATGTGGTCCCTCGCAATAAATCGGGGAGGGAGGGTGGGGGCGGT</p>
</list-item>
<list-item>
<p>GGGAGGTGGAAATGAGCCCTTTGACCCTGTAC<bold>TTTT</bold>
<underline>TTTCCAGCGGGACTAGCGCGTTGCTCCTCACT</underline>-3&#x2019;</p>
</list-item>
<list-item>
<p>No. 3: 5&#x2019;-GGAATGTGGTCCCTCGCAATAAATCGGGCGTTGTGGAGGGGGCGGTG</p>
</list-item>
<list-item>
<p>GGTGGGGGGAAATGAGCCCTTTGACCCTGTAC<bold>TTTT</bold>
<underline>TTTCCAGCGGGACTAGCGCGTTGCTCCTCACT</underline>-3&#x2019;</p>
</list-item>
</list>
<p>All aptamers had a dsDNA complement sequence (underlined) added via a TTTT sequence (bold) at the 3&#x2019; end for introduction into the DNA frame.</p>
<p>The secondary structures of the aptamers were predicted using RNAfold [<ext-link ext-link-type="uri" xlink:href="http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi">http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi</ext-link>]. We used the default settings: minimum free energy (MFE) and partition function, yes; avoid isolated base pairs, yes; incorporate G-Quadruplex formation into the structure prediction algorithm, yes; dangling end options, dangling energies on both sides of a helix in any case; energy parameters, DNA parameters (Mathews model, 2004) at 25 or 38&#xb0;C with a salt concentration of 1.021M.</p>
<p>The resultant dsDNAs were incorporated into the frame structures described above and observed in the presence of NCYM (<xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S1</bold>
</xref>), which was purified according to a previous method (<xref ref-type="bibr" rid="B1">1</xref>).</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Truncation and mutation of the DNA aptamer No. 1</title>
<p>To identify where the aptamers interact with NCYM, we prepared three analogs (short 1, short 2, and short 3) of the No. 1 aptamer based on the secondary structure prediction by RNAfold. The sequences used are as follows:</p>
<list list-type="simple">
<list-item>
<p>short 1: 5&#x2019;-TGGTCCCTCGCAATAAATCTATGTACGTTATTCCCCTTTGACCAATGC</p>
</list-item>
<list-item>
<p>TGAAATGAGC<bold>TTTT</bold>
<underline>TTTCCAGCGGGACTAGCGCGTTGCTCCTCACT</underline>-3&#x2019;</p>
</list-item>
<list-item>
<p>short 2: 5&#x2019;-GGAATGTGGTCCCTCGCAATAAATCTATGTACGTTATTCCCCTTTGAC</p>
</list-item>
<list-item>
<p>CAATGCCCTTTGACCCTGTAC<bold>TTTT</bold>
<underline>TTTCCAGCGGGACTAGCGCGTTGCTCCTCACT</underline>-3&#x2019;</p>
</list-item>
<list-item>
<p>short 3: 5&#x2019;-GGAATGTGGTCCCTCGCATCCCCTTTGACCAATGCTGAAATGAGCCCT</p>
</list-item>
<list-item>
<p>TTGACCCTGTAC<bold>TTTT</bold>
<underline>TTTCCAGCGGGACTAGCGCGTTGCTCCTCACT</underline>-3&#x2019;</p>
</list-item>
</list>
<p>short 1, short 2, and short 3 lack the 5&#x2019; end and 3&#x2019; end side (named &#x201c;5&#x2019;-3&#x2019;-end&#x201d; herein), the 3&#x2019; end stem loop, and the central stem loop of the No. 1 aptamer, respectively.</p>
<p>In addition, mutations were introduced into aptamer No.1 without changing its secondary structure. The following sequences are mutants of aptamer No.1, and italic font indicates the introduced mutations.</p>
<list list-type="simple">
<list-item>
<p>No.1 mut 1 5&#x2019;-GGAATGTGGTCCCTCGC<italic>
<underline>CGCGC</underline>
</italic>ATCTATGTACG<italic>
<underline>GCGCG</underline>
</italic>CCCCTTTGACCAATGCTGAAATGAGCCCTTTGACCCTGTACTTTTTTTCCAGCGGGACTAGCGCGTTGCTCCTCACT-3&#x2019;</p>
</list-item>
<list-item>
<p>No.1 mut 2 5&#x2019;-GGAATGTGGTCCCTCGCAATAAATCTATGTACGTTATTCCCC<italic>
<underline>CCG</underline>
</italic>GACCAATGCTGAAATGAGCCCTTTGACCCTGTACTTTTTTTCCAGCGGGACTAGCGCGTTGCTCCTCACT-3&#x2019;</p>
</list-item>
<list-item>
<p>No.1 mut 3 5&#x2019;-GGAATGTGGTCCCTCGCAATAAATCTATGTACGTTATTCCCCTTTGACCAATGCTGAAATGAGCCC<italic>
<underline>GCG</underline>
</italic>GACCCTGTACTTTTTTTCCAGCGGGACTAGCGCGTTGCTCCTCACT-3&#x2019;</p>
</list-item>
<list-item>
<p>No.1 mut 123 5&#x2019;-GGAATGTGGTCCCTCGC<italic>
<underline>CGCGC</underline>
</italic>ATCTATGTACG<italic>
<underline>GCGCG</underline>
</italic>CCCC<italic>
<underline>CCG</underline>
</italic>GACCAATGCTGAAATGAGCCC<italic>
<underline>GCG</underline>
</italic>GACCCTGTACTTTTTTTCCAGCGGGACTAGCGCGTTGCTCCTCACT-3&#x2019;</p>
</list-item>
</list>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>AFM imaging</title>
<p>The AFM images were acquired using an AFM system (NanoWizard UltraSpeed, JPK) equipped with a silicon nitride cantilever (Olympus, BL-AC40TS). In all the measurements, NCYM (100 nM) 10eq was added to the adjusted frame structures having aptamer (10 nM) and incubated at 25&#xb0;C for 2h. Samples were then double-diluted in annealing buffer (20 mM Tris-HCl (pH 7.4), 10 mM MgCl<sub>2</sub>, 1mM EDTA), adsorbed onto fresh mica plates for 10 minutes at room temperature, and washed three times with the annealing buffer. The observations were performed using the same buffer.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Immunoprecipitation</title>
<p>20 &#x3bc;l of Dynabeads&#x2122; protein G (Thermo Fisher Scientific) slurry was transfered to a clean tube. The tube was placed in a magnetic separation rack for 10-15 seconds, then, the buffer was carefully removed. 2 &#xb5;g of anti-GSK3&#x3b2; (BD Transduction Laboratories) or mouse IgG (Cell Signaling Technology, Danvers, MA) was dissolved in 200 &#x3bc;l of PBS (0.02% Tween 20) and the solution was added to the beads. The slurry was incubated with rotation at room temperature for 10 minutes. The beads were pelleted using a magnetic separation rack and washed three times with 200 &#x3bc;l of PBS, then resuspended in 100 &#x3bc;l of PBS. 0.17&#xb5;g (3.7 pmol) of purified GSK3&#x3b2; (Signal Chem, Richmond, Canada), 0.044g (3.7 pmol) of NCYM (<xref ref-type="bibr" rid="B1">1</xref>) and DNA aptamers (1eq (3.7 pmol) or 5 eq (18.5 pmol)) were dissolved in 500&#x3bc;l of ice-cold PBS and incubated with rotation at 4&#xb0;C for 2h. A 100 &#x3bc;l suspension of antibody-conjugated beads was added and incubated for 2h. The beads were pelleted using a magnetic separation rack and washed five times with 1&#xa0;ml of PBS. The pellet was resuspended in 20 &#x3bc;l of 1X sample buffer and heated at 95&#xb0;C for 5min.The beads were pelleted using a magnetic separation rack and the supernatant was subjected to the Abby analysis.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Abby analysis</title>
<p>The NCYM and GSK3&#x3b2; protein levels were measured using a capillary electrophoretic-based immunoassay (the Abby instrument; ProteinSimple, San Jose, CA, USA), according to the manufacturer&#x2019;s protocol. Briefly, the samples were combined with 0.1&#xd7;&#x2009;sample diluent buffer and 5&#xd7; fluorescent master mix denaturing buffer to acquire 0.8&#x2009;&#xb5;g/&#x3bc;l loading concentration. Subsequently, the samples were denatured for 5&#x2009;min at 95&#x2009;&#xb0;C. The primary antibodies used in this study were anti-NCYM (<xref ref-type="bibr" rid="B1">1</xref>) and anti-GSK3&#x3b2; (#9315, Cell Signaling Technology, Danvers, MA, USA). The Abby measurements were performed using a 12&#x2013;230&#x2009;kDa separation module with 25-min separation at 375&#xa0;V, 10-min blocking, 30-min primary antibody incubation, and 30-min secondary antibody incubation (DM-001, ProteinSimple, San Jose, CA, USA). At the end of the run, the chemiluminescent signal was displayed as a virtual blot-like image and an electropherogram based on the molecular weight using Compass (ProteinSimple, San Jose, CA, USA).</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Sample preparation for SAXS measurements</title>
<p>The expression and purification procedures for NCYM were modified from those described previously (<xref ref-type="bibr" rid="B8">8</xref>). Recombinant NCYM with glutathione S-transferase (GST) at the N-terminus was expressed in <italic>Escherichia coli</italic> BL21 (DE3) cells using the pGEX-6p-1 vector. The cells were cultured in Luria broth medium containing 0.1 mg/ml ampicillin at 30&#xb0;C. When OD<sub>600</sub> reached 0.6, protein expression was induced by 0.1 mM of isopropyl-&#x3b2;-D-thiogalactopyranoside, and culture was continued for 6&#xa0;h at 30&#xb0;C. The cells were harvested by centrifugation (3,890&#xd7;<italic>g</italic>, 15&#xa0;min, 4&#xb0;C), and then stored at &#x2212;30&#xb0;C until purification.</p>
<p>The frozen cell pellets were thawed and resuspended in phosphate-buffered saline (PBS) supplemented with cOmplete EDTA-free Protease Inhibitor Cocktail (11873580001, Roche, Basel, Switzerland) and lysed by repeated sonication in ice water. The cell lysate was centrifuged at 20,000&#xd7;<italic>g</italic>, 4&#xb0;C for 20&#xa0;min, then the supernatant was loaded onto GSTrap FF column (17513102, Cytiva, Marlborough, MA, USA) equilibrated with PBS, using a peristaltic pump. After washing out the unbound materials with PBS, GST-tagged NCYM (GST-NCYM) was eluted with an elution buffer (50 mM Tris-HCl and 10 mM reduced glutathione, pH 8.0). The flow-through was reloaded onto the re-equilibrated column, and the eluate was collected once more to increase the final protein yield.</p>
<p>The eluted GST-NCYM solution was dialyzed against a buffer containing 50 mM Tris-HCl, 100 mM NaCl, and 1 mM EDTA at pH 8.0. After adding dithiothreitol to the protein solution at a final concentration of 1 mM, the GST-tag was cleaved with 50 U/L-culture of PreScission Protease (27084301, Cytiva) for over 18&#xa0;h at 4&#xb0;C with gentle stirring. To exhaustively degrade the remaining nucleic acids, 6,000 U/L-culture of benzonase (71205-3CN/70746-3CN, Merck, Darmstadt, Germany) was added to the cleaved sample along with MgCl<sub>2</sub> at a final concentration of 2 mM (Mg<sup>2+</sup> is required for the activation of benzonase), after which the sample was dialyzed against IEX buffer (20 mM MOPS (pH 7.0) and 1 mM DTT) with 2 mM MgCl<sub>2</sub>.</p>
<p>The dialyzed sample was loaded onto a HiTrap SP HP column (17115201, Cytiva) equilibrated with IEX buffer, and eluted using a linear gradient of NaCl (0&#x2013;650 mM). The fractions containing high-purity NCYM, as confirmed by SDS-PAGE, were collected and used for SAXS measurements. The GST-tag did not bind to the column and was detected in the flow-through. The final NCYM yield was 1.25 mg/L-culture, which was estimated with the molecular absorption coefficient of 280 nm &#x3f5;<sub>280</sub>
<sup>0.1%</sup> = 0.558.</p>
<p>The purified NCYM was dialyzed against a buffer containing 10 mM Tris-HCl (pH8.0), 50 mM NaCl, and 5 mM DTT. Powdered DNA aptamers (No. 1) were dissolved directly in the same buffer. Samples of the NCYM-DNA complex were prepared by mixing these two kinds of solutions at the appropriate molar ratios (see below). These solutions were used for the following SAXS measurements.</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>SAXS experiment</title>
<p>SAXS measurements were carried out at BL40B2 in SPring-8 (Hyogo, Japan) on solution samples of NCYM (1.4 and 2.8 mg/ml), the DNA aptamer (1.6 and 5.0 mg/ml), and the NCYM-DNA complex. For the measurements of the complex, two kinds of samples, where the molar ratio of NCYM and DNA was 1:1.2 or 1:1.5 (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>), were used to extract the scattering curve of the complex by changing the relative contribution of the unbound DNA aptamers. The wavelength (&#x3bb;) of the incident X-ray was 1.0 &#xc5; and the temperature was 293&#xa0;K with the sample-to-detector distance of 2.2&#xa0;m. A pixel detector (PILATUS3S 2 M, Dectris) was used to record the scattering patterns.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Information on the measured samples of the NCYM-DNA complex.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Molar ratio (NCYM : DNA) in the sample</th>
<th valign="top" align="left">NCYM concentration in the sample [mg/ml]</th>
<th valign="top" align="left">DNA concentration  in the sample [mg/ml]</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" rowspan="2" align="left">1:1.2</td>
<td valign="top" align="left">1.3</td>
<td valign="top" align="left">3.2</td>
</tr>
<tr>
<td valign="top" align="left">0.6</td>
<td valign="top" align="left">1.5</td>
</tr>
<tr>
<td valign="top" align="left">1:1.5</td>
<td valign="top" align="left">0.6</td>
<td valign="top" align="left">1.8</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>Data reduction was conducted using the software SAngler (<xref ref-type="bibr" rid="B30">30</xref>): The recorded two-dimensional SAXS patterns were circularly averaged to obtain one-dimensional scattering curves, corrected by the incident flux measured with an ion chamber placed upstream of the samples. The net scattering curves of the scattering particles were obtained by subtracting the scattering curves of the buffer from those of the samples with an appropriate scaling factor based on the scattering particle concentration and the partial specific volumes of proteins (0.73 cm<sup>3</sup>/g) or of DNA (0.53 cm<sup>3</sup>/g) (<xref ref-type="bibr" rid="B31">31</xref>). Finally, the scattering curves were normalized to the absolute scale using H<sub>2</sub>O as the standard (<xref ref-type="bibr" rid="B32">32</xref>) to estimate the molecular weight of the scattering particles.</p>
<p>Guinier analysis was employed to evaluate the radius of gyration (R<sub>g</sub>) of the scattering particle from its scattering curve. A scattering curve I(Q), where Q (=4&#x3c0;sin&#x3b8;/&#x3bb;, where 2&#x3b8; is the scattering angle) denotes the momentum transfer, is represented as follows in a good approximation in the so-called Guinier region (Q&#xff65;R<sub>g</sub> &lt; 1.3) (<xref ref-type="bibr" rid="B33">33</xref>):</p>
<disp-formula>
<label>(1),</label>
<mml:math display="block" id="M1">
<mml:mrow>
<mml:mtext>I</mml:mtext>
<mml:mrow>
<mml:mo stretchy="false">(</mml:mo>
<mml:mtext>Q</mml:mtext>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
<mml:mo>=</mml:mo>
<mml:mtext>I</mml:mtext>
<mml:mrow>
<mml:mo stretchy="false">(</mml:mo>
<mml:mn>0</mml:mn>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
<mml:mtext>exp</mml:mtext>
<mml:mrow>
<mml:mo stretchy="false">(</mml:mo>
<mml:mrow>
<mml:mo>&#x2212;</mml:mo>
<mml:mfrac>
<mml:mn>1</mml:mn>
<mml:mn>3</mml:mn>
</mml:mfrac>
<mml:msubsup>
<mml:mtext>R</mml:mtext>
<mml:mrow><mml:mtext>g</mml:mtext></mml:mrow>
<mml:mn>2</mml:mn>
</mml:msubsup>
<mml:msup>
<mml:mtext>Q</mml:mtext>
<mml:mn>2</mml:mn>
</mml:msup>
</mml:mrow>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
</mml:mrow>
</mml:math>
</disp-formula>
<p>where I(0) [cm<sup>-1</sup>] denotes the forward scattering intensity, from which the molecular weight (MW) of the scattering particle is estimated from the following equation in kDa (<xref ref-type="bibr" rid="B32">32</xref>):</p>
<disp-formula>
<label>(2),</label>
<mml:math display="block" id="M2">
<mml:mrow>
<mml:mtext>MW</mml:mtext>
<mml:mo>=</mml:mo>
<mml:mn>1500</mml:mn>
<mml:mo>&#xd7;</mml:mo>
<mml:mtext>I</mml:mtext>
<mml:mrow>
<mml:mo stretchy="false">(</mml:mo>
<mml:mn>0</mml:mn>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
<mml:mfrac>
<mml:mn>1</mml:mn>
<mml:mtext>c</mml:mtext>
</mml:mfrac>
</mml:mrow>
</mml:math>
</disp-formula>
<p>where c is the weight concentration [g/l].</p>
<p>For rod-like particles such as the DNA aptamer and the NCYM-DNA complex, cross-sectional Guinier analysis was applied to evaluate their cross-sectional radii of gyration (R<sub>c</sub>). In this case, I(Q) is approximated as:</p>
<disp-formula>
<label>(3),</label>
<mml:math display="block" id="M3">
<mml:mrow>
<mml:mtext>Q</mml:mtext>
<mml:mo>&#xff65;</mml:mo>
<mml:mtext>I</mml:mtext>
<mml:mrow>
<mml:mo stretchy="false">(</mml:mo>
<mml:mtext>Q</mml:mtext>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
<mml:mo>=</mml:mo>
<mml:msub>
<mml:mtext>I</mml:mtext>
<mml:mtext>c</mml:mtext>
</mml:msub>
<mml:mrow>
<mml:mo stretchy="false">(</mml:mo>
<mml:mn>0</mml:mn>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
<mml:mtext>exp</mml:mtext>
<mml:mrow>
<mml:mo stretchy="false">(</mml:mo>
<mml:mrow>
<mml:mo>&#x2212;</mml:mo>
<mml:mfrac>
<mml:mn>1</mml:mn>
<mml:mn>2</mml:mn>
</mml:mfrac>
<mml:msubsup>
<mml:mtext>R</mml:mtext>
<mml:mrow><mml:mtext>c</mml:mtext></mml:mrow>
<mml:mn>2</mml:mn>
</mml:msubsup>
<mml:msup>
<mml:mtext>Q</mml:mtext>
<mml:mn>2</mml:mn>
</mml:msup>
</mml:mrow>
<mml:mo stretchy="false">)</mml:mo>
</mml:mrow>
</mml:mrow>
</mml:math>
</disp-formula>
<p>where I<sub>c</sub>(0) denotes the forward scattering intensity of the cross-section of the scattering particle. Application of Eq. 2 with I<sub>c</sub>(0) instead of I(0) yields the scattering mass per unit length.</p>
<p>The scattering curves taken at the lower particle concentrations were merged with those at the higher concentrations at Q = 0.1 &#xc5;<sup>&#x2212;1</sup> and the resultant curves were used for structural modeling. IGOR Pro software (WaveMetrics, Lake Oswego, OR, USA) was used for (cross-sectional) Guinier analyses and for processing the scattering curves.</p>
</sec>
<sec id="s2_10">
<label>2.10</label>
<title>Structural modeling using the <italic>ab initio</italic> method</title>
<p>Human NCYM comprises109 residues. Because NCYM was expressed with a GST-tag at its N-terminus in this study, eight residues were added to the 109 residues even after cutting the tag. For structural modeling, the program GASBOR (<xref ref-type="bibr" rid="B34">34</xref>) was employed, where each residue is represented by a sphere with a constant electron density. The obtained model thus consists of 117 spheres. In this study, the GASBOR runs were repeated 10 times (i.e., 10 best-fit models were obtained). For the modeling of the DNA aptamer, DAMMIF (<xref ref-type="bibr" rid="B35">35</xref>) was used, where a molecule is represented by an ensemble of spheres called dummy atoms. The input files required for DAMMIF were generated using AUTORG and DATGNOM (<xref ref-type="bibr" rid="B36">36</xref>). The maximum Q value (Q<sub>max</sub>) used for structural modeling was automatically determined using DATGNOM (Q<sub>max</sub>R<sub>g</sub> &lt; 7&#x2013;8). The DAMMIF runs were repeated 10 times and the resultant 10 models were averaged, followed by filtration using DAMAVER (<xref ref-type="bibr" rid="B37">37</xref>). Structural modeling of the NCYM-DNA complex was carried out using the program MONSA (<xref ref-type="bibr" rid="B38">38</xref>), where each of the two phases is represented by a dummy atom model while each phase is assigned a designated electron density value. As an input file of MONSA, the following information is required: The values of the electron density of NCYM and the DNA aptamer were set to be 0.09 e/&#xc5;<sup>3</sup> and 0.21 e/&#xc5;<sup>3</sup>, respectively, which are typical of these types of molecules (<xref ref-type="bibr" rid="B39">39</xref>). The volume fractions of NCYM and the DNA aptamer were obtained from the volumes obtained using GASBOR and DAMMIF, respectively. Using these parameters, the MONSA runs were repeated 10 times. In all of the programs above, the best-fit model, the scattering curve of which reproduces the experimental curve well, is determined by simulated annealing.</p>
</sec>
<sec id="s2_11">
<label>2.11</label>
<title>Scattering curve of the NCYM-DNA complex</title>
<p>The scattering curves of the NCYM-DNA complex recorded at 1:1.2 and 1:1.5 molar ratios were found to be superimposable despite the existence of different amounts of unbound DNA aptamers (<xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S2</bold>
</xref>). However, as described in the Results section, NCYM molecules and the DNA aptamers exist as monomers and dimers, respectively, in solution so that the molar ratios of NCYM and the dimeric DNA aptamer in the above samples are 1:0.6 and 1:0.75, respectively, which result in the molar ratios of the complex and the excess amount of NCYM of 0.6:0.4 and 0.75:0.25 assuming that one NCYM monomer binds to a DNA dimer. Because the scattering intensity is proportional to the square of the product of the scattering contrast of a particle and its volume, the scattering contributions of excess NCYM molecules were calculated to be 0.8% and 0.4% for the 0.6:0.4 and 0.75:0.25 samples, respectively. In this estimation, the scattering contrasts of NCYM and DNA were set to be 0.09 e/&#xc5;<sup>3</sup> and 0.21 e/&#xc5;<sup>3</sup> as described above, and the volumes of a NCYM monomer and a DNA dimer were assumed to be 17000 &#xc5;<sup>3</sup> and 68000 &#xc5;<sup>3</sup> as obtained by GASBOR and DAMMIF. Thus, it appears that the scattering contribution of free NCYM monomers is negligible, which explains why the scattering curves obtained at NCYM : DNA = 1:1.2 and 1:1.5 are similar to each other within errors. This observation also excluded the possibility that the complex consists of one NCYM monomer and one monomeric DNA aptamer. Based on the above inspection, the curves obtained from the above samples reflect those of the NCYM-DNA complex. The scattering curves taken at NCYM : DNA = 1:1.2 and 1:1.5 were, therefore, averaged to improve the signal-to-noise ratio and the resultant curve was employed as the scattering curve of the NCYM-DNA complex.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Aptamer selection by SELEX</title>
<p>To identify DNA aptamers that specifically bind to NCYM, we performed SELEX and employed NGS technology to monitor the progress of the enrichment sequences that bind to the target in the selection pool. We performed the NGS analysis using an Illumina MiniSeq for the NCYM aptamer selection pools from rounds 3 to 8 to identify the aptamer candidates. The ratio of unique DNA sequences in the selection pool per round showed that DNA sequences were enriched in round 6 (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). No. 1 aptamer candidate, which was the most abundant population in round 8, was quickly enriched from round 6 compared to the other DNA sequences. Guanine contents in the selection pools were increased slightly in round 8 (<xref ref-type="supplementary-material" rid="SM1">
<bold>Table S1</bold>
</xref>). BLI measurements and kinetic analyses showed that top three aptamers strongly bind to NCYM protein at K<sub>D</sub> value in the range of 53.9 to 299 nM (<xref ref-type="supplementary-material" rid="SM1">
<bold>Table S2</bold>
</xref>); however, the aptamer No. 2 and 3 were predicted to form different secondary structure at 38&#xb0;C, showing low structural stability at relatively high temperature compared to aptamer No.1 (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref> and <xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S3</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Identification of NCYM-bound aptamers. <bold>(A)</bold> Ratio of the enriched ssDNA sequence in the selection pool per round. Each dot represents the ratio of the enriched ssDNA sequences more than 0.001. The lines indicate the same ssDNA sequence between rounds. Top 3 enrichment sequences at round 8 were evaluated for the further structural analysis and named No. 1, No. 2, and No. 3. <bold>(B)</bold> Secondary structure prediction of NCYM-bound aptamer by RNAfold at 25&#xb0;C. Primer sequences are colored in gray.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1213678-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>AFM observation on the NCYM-DNA aptamer complexes</title>
<sec id="s3_2_1">
<label>3.2.1</label>
<title>DNA aptamers obtained by SELEX (No. 1, 2, and 3)</title>
<p>To visualize the interaction between NCYM and DNA at the molecular level, we used AFM observation of the aptamer-conjugated DNA frames with or without NCYM (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). Because the aptamer has a large single-stranded region and is not completely fixed, only dsDNA can be seen. After adding NCYM, white dots were observed on the dsDNA (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>). The numbers of DNA frames with and without these white dots were counted to assess the affinity of the aptamer for NCYM (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>). Binding of NCYM to the No. 1 aptamer was observed in 14.5% of the DNA frames (84/580 frames). Binding was also observed for the No. 2 and No. 3 aptamers at 12.0% (80/664 frames) and 14.6% (41/280 frames), respectively. The slightly lower affinity of No. 2 compared to No.1 and No.3 is consistent with the KD value evaluated by BLI measurements.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Secondary structure prediction model for aptamers and evaluation using DNA origami. <bold>(A)</bold> Design of DNA frame with NCYM aptamer and its AFM image. The open cyan triangles show the orientation marker. <bold>(B)</bold> Examples of AFM images of NCYM-aptamer No.1 complexes on DNA frames (left) and evaluation of the affinity between aptamers obtained by SELEX and NCYM (right). In the &#x201c;Occupied&#x201d; row, the numerator and the denominator represent the number of NCYM bound to the aptamers and the total number of aptamers, respectively. The &#x201c;rate&#x201d; row denotes the number fraction of NCYM bound to the aptamers calculated from the corresponding value in the &#x201c;occupied&#x201d; row.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1213678-g002.tif"/>
</fig>
</sec>
<sec id="s3_2_2">
<label>3.2.2</label>
<title>Truncated and mutated DNA aptamers</title>
<p>Because of the relatively higher stability of the secondary structures of the No.1 aptamer (<xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S2</bold>
</xref>), we focused on aptamer No.1 and further analyzed the regions required for NCYM binding. As shown in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>, the AFM results revealed a decrease in the number of bonds in short 1 (9.4%, 70/742 frames) and short 2 (5.3%, 75/1425 frames), whereas there was no change in the number of bonds in short 3 (14.2%, 173/1222 frames). Because aptamers No. 2 and No. 3 exhibited GC-rich sequences (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>), we introduced mutations in the No. 1 aptamer with increasing GC content without affecting the secondary structure, and we found that the mutations at TTT in the central loop showed a significant decrease in the affinity of aptamer No.1 to NCYM (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>). These results suggest that the 5&#x2019;-3&#x2019;-end, the 3&#x2019; end stem loop, and TTT in the central loop of the No.1 aptamer are required for binding to NCYM.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Evaluation of the affinity between truncated or mutated aptamers and NCYM. <bold>(A)</bold> Truncated No.1 aptamers for identification of NCYM binding site. The 5&#x2019;-3&#x2019;-end, the central stem loop, the 3&#x2019; end stem loop, and the primer region are colored in blue, orange, green, and gray, respectively (upper and middle). Evaluation of the affinity between the truncated aptamers and NCYM (bottom) <bold>(B)</bold> Mutated No.1 aptamers for identification of the NCYM binding site. Mutated sequences are colored in red (upper and middle). Evaluation of the affinity between the mutated aptamers and NCYM (bottom).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1213678-g003.tif"/>
</fig>
</sec>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>The effect of DNA aptamer No. 1 on the interaction between NCYM and GSK3&#x3b2;</title>
<p>To clarify the effect of DNA aptamer No.1 on NCYM function, we examined NCYM binding to GSK3&#x3b2; with or without the aptamer. As reported (<xref ref-type="bibr" rid="B1">1</xref>), purified NCYM was co-immunoprecipitated with GSK3&#x3b2; (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). Addition of aptamer No.1 enhanced the interaction between NCYM and GSK3&#x3b2; in dose-dependent manner (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). This result led us to analyze the NCYM-aptamer No.1 complex because the aptamer may help NCYM to adopt a conformation that facilitates binding to GSK3&#x3b2;.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Aptamer No.1 increased interaction between NCYM and GSK3&#x3b2;. <bold>(A)</bold> Co-immunoprecipitation of NCYM with GSK3&#x3b2; detected by Abby analysis. <bold>(B)</bold> Aptamer No.1 increased the amount of NCYM co-immunoprecipitated with GSK3&#x3b2; in a dose-dependent manner (0, 1, and 5 eq.).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1213678-g004.tif"/>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>SAXS results</title>
<sec id="s3_4_1">
<label>3.4.1</label>
<title>Guinier analysis and Kratky plot</title>
<p>To elucidate their structural properties, we employed SAXS analysis to reveal the approximate structures of the complexes in solution. <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref> shows the results of the Guinier analysis. The radii of gyration (R<sub>g</sub>) were estimated to be 25.2 &#xb1; 0.7 &#xc5;, 46.0 &#xb1; 0.3 &#xc5;, and 44.8 &#xb1; 0.2 &#xc5;, for NCYM, the DNA aptamer No. 1, and the NCYM-DNA complex, respectively. The molecular weights of NCYM and the DNA aptamer were estimated to be 7.2, and 54.5 kDa, respectively, indicating that NCYM molecules exist as a monomer in solution whereas DNA aptamers are dimers because the molecular weights of NCYM and the DNA aptamer were 12 kDa, 24.2 kDa, respectively. Although the molecular weight of the complex was estimated to be 46.8 kDa, because the true concentration of the complexes in the sample is not known due to the existence of a small amount of excess NCYM molecules, this value should be interpreted with caution. Scattering curves other than NCYM were found to follow the cross-sectional Guinier approximation, suggesting that the DNA aptamer and the complex adopt a rod-like shape. <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref> shows the results of the cross-sectional Guinier analysis, from which the cross-sectional radii of gyration (R<sub>c</sub>) were estimated to be 12.2 &#xb1; 0.4 &#xc5; and 12.5 &#xb1; 0.2 &#xc5; for the DNA aptamer and the complex, respectively. This suggests that the overall size of the cross-section is similar between the DNA aptamer and the complex. Both the Guinier analysis and the cross-sectional Guinier analysis can be applied to the current samples because of their relatively short entire length, whereas in many cases, fibrillar proteins are quite long (even on the order of &#x3bc;m) and only the cross-sectional Guinier analysis can be applied (<xref ref-type="bibr" rid="B40">40</xref>, <xref ref-type="bibr" rid="B41">41</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Summary of the analysis of the SAXS scattering curves of the NCYM-DNA system. <bold>(A)</bold> Guinier analysis. The logarithm of the scattering intensity is shown as a function of Q<sup>2</sup> for NCYM (cyan), the DNA aptamer No. 1 (magenta), and the NCYM-DNA complex (orange). Upper panels denote the corresponding residuals between the measured and the fitted values. <bold>(B)</bold> Cross-sectional Guinier analysis. Instead of ln[I(Q)] of the Guinier analysis, ln[Q&#xff65;I(Q)] is plotted as a function of Q<sup>2</sup>, from which the cross-sectional radius of gyration is evaluated. <bold>(C)</bold> The left, middle, and right panels show the Kratky plot, Q<sup>3</sup>&#xff65;I(Q) vs Q<sup>3</sup> plot, and the Porod-Debye plot, respectively, of NCYM.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1213678-g005.tif"/>
</fig>
<p>Several plots were used to investigate the structural properties of NCYM, as shown in <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>. The Kratky plot (Q<sup>2</sup>&#xff65;I(Q) vs Q) (<xref ref-type="bibr" rid="B42">42</xref>) shows that the Q<sup>2</sup>&#xff65;I(Q) value reaches a peak at around Q = 0.1 [&#xc5;<sup>-1</sup>] and decreases slightly, followed by the increase, suggesting that NCYM is not a completely unfolded protein, but a partially folded protein. This interpretation is further supported by the Q3 plot (Q<sup>3</sup>&#xff65;I(Q) vs Q<sup>3</sup>), where the Q<sup>3</sup>&#xff65;I(Q) value reaches a plateau, which is a hallmark of partially folded proteins (<xref ref-type="bibr" rid="B43">43</xref>). In contrast, no plateau was observed in the Porod-Debye plot (<xref ref-type="bibr" rid="B43">43</xref>), suggesting that NCYM is not a well-folded protein. These results show that NCYM adopts a highly flexible conformation, though it is not a completely unfolded protein, but a partially folded protein. This is in agreement with a previous study showing that NCYM molecules contain defined secondary structures in solution (<xref ref-type="bibr" rid="B8">8</xref>).</p>
</sec>
<sec id="s3_4_2">
<label>3.4.2</label>
<title>Solution structure of NCYM, the DNA aptamer, and the NCYM-DNA complex</title>
<p>The results of the structural modeling of NCYM, the DNA aptamer No. 1, and the NCYM-DNA complex are summarized in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>. <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref> compares the experimental SAXS curves with those calculated using the best-fit model obtained for each of the three samples. The &#x3c7;<sup>2</sup> values, which are averaged over 10 models obtained, were 1.17, 1.37, and 1.85, for NCYM, the DNA aptamer, and the complex, respectively. As shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>, the obtained models provide excellent fits to the measured SAXS curves.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>
<italic>Ab initio</italic> structural models of NCYM, the DNA aptamer No. 1, and the NCYM-DNA complex. Comparison of the scattering curves between the experiments and the models of NCYM is shown in the upper panel of <bold>(A)</bold> The lower panel of <bold>(A)</bold> shows the comparisons for the DNA aptamer and the NCYM-DNA complex. Experimental values are shown in grey filled circles and the simulated values from the models are shown in cyan solid lines. Error bars are within symbols if not shown. Scattering curves are vertically shifted for clarity. <bold>(B)</bold> Gallery of the NCYM models (arbitrarily chosen 4 models) obtained from GASBOR. Each sphere represents one amino acid residue. <bold>(C)</bold> A representative dummy atom model of the DNA aptamer obtained from DAMMIF and DAMAVER (&#x201c;damfilt.pdb&#x201d; is shown). <bold>(D)</bold> Dummy atom models of the NCYM-DNA complex obtained from MONSA. The moieties corresponding to NCYM and the DNA aptamer are shown in marine blue and in orange, respectively.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1213678-g006.tif"/>
</fig>
<p>As shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>, NCYM was found to have a slightly extended structure in which the bulky and flexible parts are mixed. It is not a completely unfolded protein such as a random coil, as expected from the panels in <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref> and our previous study on the secondary structure of NCYM (<xref ref-type="bibr" rid="B8">8</xref>). Although the assignment of the secondary structure to the three-dimensional structures of the current NCYM models is not possible at this stage, future structural modeling using SAXS curves with higher Q values would be useful for this purpose (<xref ref-type="bibr" rid="B44">44</xref>). The volume of the NCYM models was ~17000 &#xc5;<sup>3</sup>. Regarding the DNA aptamer, a structure with a volume of ~68000 &#xc5;<sup>3</sup>, in which four to five bulky nodes were connected, was found to reproduce the measured SAXS curve, as shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>. Because the aptamers exist as dimers, as evidenced by the molecular weight estimation as described above, a monomeric DNA aptamer corresponds to two or three nodes in this model. The structural features of the DNA model with some nodes here are consistent with those predicted using RNAfold (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). Two representative models of the NCYM-DNA complex are shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6D</bold>
</xref>. In both cases, the volumes of the NCYM molecule and of the DNA aptamer in the complex were ~19000 &#xc5;<sup>3</sup> and ~63000 &#xc5;<sup>3</sup>, which are roughly the same as those obtained when these molecules are in isolation. The volume of the complex (~82000 &#xc5;<sup>3</sup>) was essentially the same as the sum of the volumes of NCYM and DNA in isolation (~85000 &#xc5;<sup>3</sup>) within 4% accuracy. It thus follows that the NCYM-DNA complex consists of one NCYM molecule and two DNA aptamers (a dimer). NCYM tends to bind either to or close to a tip of a dimeric DNA aptamer. The slight differences (~10%) in the volumes of each component between in isolation and in the complex may imply that some intramolecular structural changes occur upon binding. A more detailed structure of the complex can be obtained by small-angle neutron scattering (SANS) combined with contrast matching or variation (<xref ref-type="bibr" rid="B45">45</xref>), which will be performed in the future. All the 10 models obtained for NCYM, the DNA aptamer, and the NCYM-DNA complex are shown in <xref ref-type="supplementary-material" rid="SM1">
<bold>Figures S4</bold>
</xref>&#x2013;<xref ref-type="supplementary-material" rid="SM1">
<bold>S6</bold>
</xref>, respectively.</p>
<p>Attempts were made to identify other possible conformations of the complex by changing the volume ratio of each phase in the complex and/or assuming a symmetry in the structure, which are provided as an input file to MONSA. Whereas several models which fit the SAXS curve of the complex quite well in terms of the &#x3c7;<sup>2</sup> values were obtained, in all cases, deviation of the volumes of NCYM and the DNA aptamer in the complex with regards to those in the unbound state was much larger (15&#x2013;20%) than the models presented in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>. Considering an independent line of evidence that the volume change of proteins between the folded and the unfolded states is less than 0.5% (<xref ref-type="bibr" rid="B46">46</xref>), the volume change of each component in the complex should be the smallest. Since in the models in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>, the volume of each component in the complex is close to that in the unbound state, and truncation of one edge of a DNA aptamer breaks down the interaction with NCYM as observed by AFM, the models presented here appear to be reasonable.</p>
</sec>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>In this study, we established a new observation system using aptamers for the single-molecule observation of proteins using DNA origami. To date, protein studies using DNA origami have mainly involved single-molecule observations of proteins that bind directly to DNA or using systems based on ligand or avidin-biotin binding (<xref ref-type="bibr" rid="B21">21</xref>&#x2013;<xref ref-type="bibr" rid="B29">29</xref>, <xref ref-type="bibr" rid="B47">47</xref>&#x2013;<xref ref-type="bibr" rid="B52">52</xref>). However, DNA origami research using aptamers has mainly focused on functionalizing the DNA origami using already established aptamers (<xref ref-type="bibr" rid="B53">53</xref>&#x2013;<xref ref-type="bibr" rid="B56">56</xref>). Therefore, a system that uses DNA origami and aptamers to elucidate the structure of proteins, as in this study, is a new approach that has never been used. In this study, we have also succeeded in roughly identifying the binding site of NCYM to the aptamer obtained using the SELEX method. The method using aptamers can easily fix proteins onto the DNA origami. Therefore, it is expected to be applied to the observation of the interaction between a fixed protein and its target, and to the functional evaluation of proteins for which single molecule observation has not been performed.</p>
<p>In addition to the AFM observation, further structural characterization of NCYM and the DNA aptamer No. 1 that facilitates NCYM binding to GSK3&#x3b2; was conducted using SAXS. Regarding the structure of the DNA aptamer, it was found that it exists as a dimer. This finding is supported by both the molecular weight estimation from the forward scattering intensity and the fitting of the corresponding SAXS curve. Although it is not possible to unambiguously determine the manner in which the two DNA aptamers form dimers, this can be inferred from the current findings. There are three types of arrangements for the two DNA aptamers to form a structure similar to that shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref> (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7A&#x2013;C</bold>
</xref>).</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Schematic illustration of possible ways by which the DNA aptamer No. 1 forms a dimer. An aptamer is shown in either orange or magenta. The corresponding predicted structure of the aptamer is shown in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref> (left). There are three types of arrangements for two DNA aptamers to take a form similar to that shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>: <bold>(A)</bold> The interface between the two aptamers is formed by the central stem loop of one aptamer and the 5&#x2019;-3&#x2019;-end of the other aptamer. <bold>(B)</bold> Two 5&#x2019;-3&#x2019;-ends form the interface of the dimer. <bold>(C)</bold> The interface of the dimer is formed by two central stem loops. For a more detailed discussion, please see the main text.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1213678-g007.tif"/>
</fig>
<p>As shown in <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>, there are three types of arrangements for two DNA aptamers to form a similar form to that shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>. In the case where the interface between the two aptamers is formed by the central stem loop of one aptamer and the 5&#x2019;-3&#x2019;-end of the other aptamer (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>), NCYM is able to bind to the 5&#x2019;-3&#x2019;-end of the upper aptamer. Whereas there is a possibility that other aptamers bind to either edge of the dimer in the same manner, dimers might be more stable than higher-order aggregates as observed for a protein (<xref ref-type="bibr" rid="B57">57</xref>) probably due to entropy-enthalpy compensation. In case where two 5&#x2019;-3&#x2019;-ends form the interface of the dimer (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7B</bold>
</xref>), NCYM would not be able to bind to the aptamer since these regions are required for NCYM binding as suggested by AFM. If the interface of the dimer is formed by two central stem loops (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7C</bold>
</xref>), at least two NCYM molecules would be able to bind to both edges of the dimer, which is inconsistent with the discussion on the SAXS curve of the complex and our modeling results. The second NCYM binding may be unfavorable in terms of entropy. There are thus two possible models on the mode of dimeric formation of the DNA aptamer (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7A, C</bold>
</xref>). In addition, the observation that NCYM binds to the dimeric DNA aptamer (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>) implies that the affinity between NCYM and an aptamer is lower than that between monomeric aptamers and thus DNA dimers do not dissociate into two monomeric aptamers in the current solution condition.</p>
<p>A concern in the current SAXS analysis is that the deviation of the estimated molecular weight (7.2 kDa) of NCYM from its theoretical value (11.7 kDa) is relatively large. This raises the possibility that the DNA aptamers might exist as trimers or tetramers. The large deviation observed for NCYM is likely to be caused by the small size of NCYM, thus resulting in relatively large experimental errors. However, because the scattering intensity is proportional to the square of the molecular volume, the SAXS curve of the DNA aptamer, which has a larger molecular weight than NCYM, has much lower experimental errors than NCYM (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). This results in a more reliable molecular weight estimation for the DNA aptamer than for NCYM. Furthermore, the structural modeling of an isolated DNA aptamer presented in this work does not require any information on the molecular property including its molecular weight because it is an &#x201c;ab initio&#x201d; approach. From the SAXS-derived models with five bumps (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>) and the secondary-structure predicted by RNAfold, which has 2&#x2013;3 bumps in one aptamer (No. 1 in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>), it is reasonable to conclude that the DNA aptamer forms a dimer in solution.</p>
<p>In the dummy atom models of the complex, the moiety corresponding to NCYM adopted a compact and well-defined shape whereas NCYM showed flexibility and adoped a slightly extended conformation in the unbound state. This implies that highly flexible NCYM molecules fold upon binding to DNA through the well-known &#x201c;fly-casting mechanism&#x201d; (<xref ref-type="bibr" rid="B58">58</xref>), in which an unfolded region(s) of a protein binds weakly to the binding site at a relatively large distance, followed by folding as the protein approaches the binding site. As aptamer No.1 facilitated the interaction between NCYM and GSK3&#x3b2;, the compact and well-defined shape of NCYM found in the complex with aptamer No. 1 appears to be the functional structure of NCYM. Folding upon binding has been demonstrated for another <italic>de novo</italic> protein AFGP8 (<xref ref-type="bibr" rid="B16">16</xref>). A similar mechanism may also apply to interactions between NCYM and GSK-3&#x3b2;, underlying the mechanism of stabilization of these molecules.</p>
<p>One of the most important advantages of AFM observations with a DNA frame is that the DNA frame is guaranteed to be a monomeric aptamer, which is a feature not observed in other binding assays. This is because dsDNA is bound to an DNA aptamer (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>) and thus two dsDNAs should be observed by AFM if the DNA aptamers form dimers, which is not the case. Therefore, it is most likely that monomeric aptamers are capable of binding NCYM and dimer formation of DNA aptamers is not a prerequisite for binding of NCYM. Since the SAXS data alone did not show that NCYM could bind to the monomeric form of the aptamer, AFM, in combination with SAXS, provides important insights into the structure of the aptamer-NCYM complex.</p>
<p>Identification of DNA aptamers that can specifically bind to NCYM and facilitate its binding to GSK3&#x3b2; is useful for elucidation of the structure of NCYM in its active form. Although the aptamer-NCYM complex described in this study has not yet been tested by X-ray crystallography, investigation of the structural properties of the complexes may pave the way for the structural characterization of NCYM molecules at the atomic level. Therefore, the present study suggests that the combination of SELEX, AFM, and SAXS is useful for understanding the structural properties of NCYM and the current findings will serve as a foundation for the future design of novel anti-cancer drugs targeting NCYM as well as for elucidating the stabilization mechanism of other cancer-related proteins by NCYM.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec id="s6" sec-type="author-contributions">
<title>Author contributions</title>
<p>YS and TM designed and supervised the study. SY, FK, KN, MH, KH, TT, YH, YS and TM performed the experiments, acquired, and analyzed the data. SY, FK, KN, TT, YS and TM wrote the manuscript. KN, YH, TT, YS and TM acquired funds. All authors contributed to the article, read, and approved the submitted version.</p>
</sec>
</body>
<back>
<sec id="s7" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This work was supported by the AMED eASIA JRP (22jm0210092h0002), and by the JSPS Bilateral Program Number JPJSBP120233212 (SAKURA project).</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>The authors thank SPring-8 for the allocation of the beamtime. The SAXS experiments were carried out under the approval of the SPring-8 Program Review Committee (2022B1242).</p>
</ack>
<sec id="s8" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>MH and KH are employees of NEC Solution Innovators. This does not alter the authors&#x2019; adherence to all Frontiers in Oncology policies.</p>
<p>The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s9" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors&#xa0;and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s10" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fonc.2023.1213678/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fonc.2023.1213678/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet_1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suenaga</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Islam</surname> <given-names>SMR</given-names>
</name>
<name>
<surname>Alagu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Kaneko</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Kato</surname> <given-names>M</given-names>
</name>
<name>
<surname>Tanaka</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>NCYM, a cis-antisense gene of MYCN, encodes a <italic>de novo</italic> evolved protein that inhibits GSK3&#x3b2; Resulting in the stabilization of MYCN in human neuroblastomas</article-title>. <source>PloS Genet</source> (<year>2014</year>) <volume>10</volume>:<elocation-id>e1003996</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pgen.1003996</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suenaga</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Nakatani</surname> <given-names>K</given-names>
</name>
<name>
<surname>Nakagawara</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>
<italic>De novo</italic> evolved gene product NCYM in the pathogenesis and clinical outcome of human neuroblastomas and other cancers</article-title>. <source>Jpn&#xa0;J Clin Oncol</source> (<year>2020</year>) <volume>50</volume>:<page-range>839&#x2013;46</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/jjco/hyaa097</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shoji</surname> <given-names>W</given-names>
</name>
<name>
<surname>Suenaga</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Kaneko</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Islam</surname> <given-names>SMR</given-names>
</name>
<name>
<surname>Alagu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Yokoi</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>NCYM promotes calpain-mediated Myc-nick production in human MYCN-amplified neuroblastoma cells</article-title>. <source>Biochem Biophys Res Commun</source> (<year>2015</year>) <volume>461</volume>:<page-range>501&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbrc.2015.04.050</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suenaga</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Yamamoto</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sakuma</surname> <given-names>T</given-names>
</name>
<name>
<surname>Sasada</surname> <given-names>M</given-names>
</name>
<name>
<surname>Fukai</surname> <given-names>F</given-names>
</name>
<name>
<surname>Ohira</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>TAp63 represses transcription of MYCN/NCYM gene and its high levels of expression are associated with favorable outcome in neuroblastoma</article-title>. <source>Biochem Biophys Res Commun</source> (<year>2019</year>) <volume>518</volume>:<page-range>311&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbrc.2019.08.052</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kaneko</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Suenaga</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Islam</surname> <given-names>SMR</given-names>
</name>
<name>
<surname>Matsumoto</surname> <given-names>D</given-names>
</name>
<name>
<surname>Nakamura</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Ohira</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Functional interplay between MYCN, NCYM, and OCT4 promotes aggressiveness of human neuroblastomas</article-title>. <source>Cancer Sci</source> (<year>2015</year>) <volume>106</volume>:<page-range>840&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/cas.12677</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Islam</surname> <given-names>SMR</given-names>
</name>
<name>
<surname>Suenaga</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Takatori</surname> <given-names>A</given-names>
</name>
<name>
<surname>Ueda</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Kaneko</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Kawana</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Sendai virus-mediated expression of reprogramming factors promotes plasticity of human neuroblastoma cells</article-title>. <source>Cancer Sci</source> (<year>2015</year>) <volume>106</volume>:<page-range>1351&#x2013;61</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/cas.12746</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>LSINCT5 activates Wnt/&#x3b2;-catenin signaling by interacting with NCYM to promote bladder cancer progression</article-title>. <source>Biochem Biophys Res Commun</source> (<year>2018</year>) <volume>502</volume>:<fpage>299</fpage>&#x2013;<lpage>306</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbrc.2018.05.076</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsuo</surname> <given-names>T</given-names>
</name>
<name>
<surname>Nakatani</surname> <given-names>K</given-names>
</name>
<name>
<surname>Setoguchi</surname> <given-names>T</given-names>
</name>
<name>
<surname>Matsuo</surname> <given-names>K</given-names>
</name>
<name>
<surname>Tamada</surname> <given-names>T</given-names>
</name>
<name>
<surname>Suenaga</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Secondary structure of human <italic>de novo</italic> evolved gene product NCYM analyzed by vacuum-ultraviolet circular dichroism</article-title>. <source>Front Oncol</source> (<year>2021</year>) <volume>11</volume>:<elocation-id>688852</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fonc.2021.688852</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Van Oss</surname> <given-names>SB</given-names>
</name>
<name>
<surname>Carvunis</surname> <given-names>A-R</given-names>
</name>
</person-group>. <article-title>
<italic>De novo</italic> gene birth</article-title>. <source>PloS Genet</source> (<year>2019</year>) <volume>15</volume>:<elocation-id>e1008160</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pgen.1008160</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Broeils</surname> <given-names>LA</given-names>
</name>
<name>
<surname>Ruiz-Orera</surname> <given-names>J</given-names>
</name>
<name>
<surname>Snel</surname> <given-names>B</given-names>
</name>
<name>
<surname>Hubner</surname> <given-names>N</given-names>
</name>
<name>
<surname>van Heesch</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Evolution and implications of <italic>de novo</italic> genes in humans</article-title>. <source>Nat Ecol Evol</source> (<year>2023</year>) <volume>7</volume>:<page-range>804&#x2013;15</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41559-023-02014-y</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Weisman</surname> <given-names>CM</given-names>
</name>
</person-group>. <article-title>The origins and functions of <italic>de novo</italic> genes: against all odds</article-title>? <source>J&#xa0;Mol Evol</source> (<year>2022</year>) <volume>90</volume>:<page-range>244&#x2013;57</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00239-022-10055-3</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bornberg-Bauer</surname> <given-names>E</given-names>
</name>
<name>
<surname>Hlouchova</surname> <given-names>K</given-names>
</name>
<name>
<surname>Lange</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Structure and function of naturally evolved <italic>de novo</italic> proteins</article-title>. <source>Curr Opin Struct Biol</source> (<year>2021</year>) <volume>68</volume>:<page-range>175&#x2013;83</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.sbi.2020.11.010</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Heames</surname> <given-names>B</given-names>
</name>
<name>
<surname>Buchel</surname> <given-names>F</given-names>
</name>
<name>
<surname>Aubel</surname> <given-names>M</given-names>
</name>
<name>
<surname>Tretyachenko</surname> <given-names>V</given-names>
</name>
<name>
<surname>Loginov</surname> <given-names>D</given-names>
</name>
<name>
<surname>Nov&#xe1;k</surname> <given-names>P</given-names>
</name>
<etal/>
</person-group>. <article-title>Experimental characterization of <italic>de novo</italic> proteins and their unevolved random-sequence counterparts</article-title>. <source>Nat Ecol Evol</source> (<year>2023</year>) <volume>7</volume>:<page-range>570&#x2013;80</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41559-023-02010-2</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bungard</surname> <given-names>D</given-names>
</name>
<name>
<surname>Copple</surname> <given-names>JS</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>J</given-names>
</name>
<name>
<surname>Chhun</surname> <given-names>JJ</given-names>
</name>
<name>
<surname>Kumirov</surname> <given-names>VK</given-names>
</name>
<name>
<surname>Foy</surname> <given-names>SG</given-names>
</name>
<etal/>
</person-group>. <article-title>Foldability of a natural <italic>de novo</italic> evolved protein</article-title>. <source>Structure</source> (<year>2017</year>) <volume>25</volume>:<fpage>1687</fpage>&#x2013;<lpage>1696.e4</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.str.2017.09.006</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lange</surname> <given-names>A</given-names>
</name>
<name>
<surname>Patel</surname> <given-names>PH</given-names>
</name>
<name>
<surname>Heames</surname> <given-names>B</given-names>
</name>
<name>
<surname>Damry</surname> <given-names>AM</given-names>
</name>
<name>
<surname>Saenger</surname> <given-names>T</given-names>
</name>
<name>
<surname>Jackson</surname> <given-names>CJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Structural and functional characterization of a putative <italic>de novo</italic> gene in Drosophila</article-title>. <source>Nat Commun</source> (<year>2021</year>) <volume>12</volume>:<elocation-id>1667</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-021-21667-6</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Her</surname> <given-names>C</given-names>
</name>
<name>
<surname>Yeh</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Krishnan</surname> <given-names>VV</given-names>
</name>
</person-group>. <article-title>The ensemble of conformations of antifreeze glycoproteins (AFGP8): a study using nuclear magnetic resonance spectroscopy</article-title>. <source>Biomolecules</source> (<year>2019</year>) <volume>9</volume>:<fpage>235</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/biom9060235</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Armstrong</surname> <given-names>BC</given-names>
</name>
<name>
<surname>Krystal</surname> <given-names>GW</given-names>
</name>
</person-group>. <article-title>Isolation and characterization of complementary DNA for N-cym, a gene encoded by the DNA strand opposite to N-myc</article-title>. <source>Cell Growth Differ Mol Biol J Am Assoc Cancer Res</source> (<year>1992</year>) <volume>3</volume>:<page-range>385&#x2013;90</page-range>.</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gold</surname> <given-names>L</given-names>
</name>
<name>
<surname>Ayers</surname> <given-names>D</given-names>
</name>
<name>
<surname>Bertino</surname> <given-names>J</given-names>
</name>
<name>
<surname>Bock</surname> <given-names>C</given-names>
</name>
<name>
<surname>Bock</surname> <given-names>A</given-names>
</name>
<name>
<surname>Brody</surname> <given-names>EN</given-names>
</name>
<etal/>
</person-group>. <article-title>Aptamer-based multiplexed proteomic technology for biomarker discovery</article-title>. <source>PloS One</source> (<year>2010</year>) <volume>5</volume>:<elocation-id>e15004</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0015004</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Minagawa</surname> <given-names>H</given-names>
</name>
<name>
<surname>Onodera</surname> <given-names>K</given-names>
</name>
<name>
<surname>Fujita</surname> <given-names>H</given-names>
</name>
<name>
<surname>Sakamoto</surname> <given-names>T</given-names>
</name>
<name>
<surname>Akitomi</surname> <given-names>J</given-names>
</name>
<name>
<surname>Kaneko</surname> <given-names>N</given-names>
</name>
<etal/>
</person-group>. <article-title>Selection, characterization and application of artificial DNA aptamer containing appended bases with sub-nanomolar affinity for a salivary biomarker</article-title>. <source>Sci Rep</source> (<year>2017</year>) <volume>7</volume>:<elocation-id>42716</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/srep42716</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cantu</surname> <given-names>VA</given-names>
</name>
<name>
<surname>Sadural</surname> <given-names>J</given-names>
</name>
<name>
<surname>Edwards</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>PRINSEQ++, a multi-threaded tool for fast and efficient quality control and preprocessing of sequencing datasets</article-title>. <source>PeerJ Prepr</source> (<year>2019</year>) <volume>7</volume>:<elocation-id>e27553v1</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.7287/peerj.preprints.27553v1</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Endo</surname> <given-names>M</given-names>
</name>
<name>
<surname>Katsuda</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Hidaka</surname> <given-names>K</given-names>
</name>
<name>
<surname>Sugiyama</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Regulation of DNA methylation using different tensions of double strands constructed in a defined DNA nanostructure</article-title>. <source>J Am Chem Soc</source> (<year>2010</year>) <volume>132</volume>:<page-range>1592&#x2013;7</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/ja907649w</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rajendran</surname> <given-names>A</given-names>
</name>
<name>
<surname>Endo</surname> <given-names>M</given-names>
</name>
<name>
<surname>Hidaka</surname> <given-names>K</given-names>
</name>
<name>
<surname>Tran</surname> <given-names>PLT</given-names>
</name>
<name>
<surname>Mergny</surname> <given-names>J-L</given-names>
</name>
<name>
<surname>Sugiyama</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Controlling the stoichiometry and strand polarity of a tetramolecular G-quadruplex structure by using a DNA origami frame</article-title>. <source>Nucleic Acids Res</source> (<year>2013</year>) <volume>41</volume>:<page-range>8738&#x2013;47</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkt592</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Endo</surname> <given-names>M</given-names>
</name>
<name>
<surname>Inoue</surname> <given-names>M</given-names>
</name>
<name>
<surname>Suzuki</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Masui</surname> <given-names>C</given-names>
</name>
<name>
<surname>Morinaga</surname> <given-names>H</given-names>
</name>
<name>
<surname>Hidaka</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>Regulation of B-Z conformational transition and complex formation with a Z-form binding protein by introduction of constraint to double-stranded DNA by using a DNA nanoscaffold</article-title>. <source>Chem Eur J</source> (<year>2013</year>) <volume>19</volume>:<page-range>16887&#x2013;90</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/chem.201303830</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Endo</surname> <given-names>M</given-names>
</name>
<name>
<surname>Suzuki</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Hidaka</surname> <given-names>K</given-names>
</name>
<name>
<surname>Sugiyama</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Direct observation of the dual-switching behaviors corresponding to the state transition in a DNA nanoframe</article-title>. <source>Chem Commun</source> (<year>2014</year>) <volume>50</volume>:<page-range>4211&#x2013;3</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1039/C4CC00489B</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rajendran</surname> <given-names>A</given-names>
</name>
<name>
<surname>Endo</surname> <given-names>M</given-names>
</name>
<name>
<surname>Hidaka</surname> <given-names>K</given-names>
</name>
<name>
<surname>Sugiyama</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Direct and single-molecule visualization of the solution-state structures of G-hairpin and G-triplex intermediates</article-title>. <source>Angew Chem Int Ed Engl</source> (<year>2014</year>) <volume>53</volume>:<page-range>4107&#x2013;12</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/anie.201308903</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suzuki</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Endo</surname> <given-names>M</given-names>
</name>
<name>
<surname>Ca&#xf1;as</surname> <given-names>C</given-names>
</name>
<name>
<surname>Ayora</surname> <given-names>S</given-names>
</name>
<name>
<surname>Alonso</surname> <given-names>JC</given-names>
</name>
<name>
<surname>Sugiyama</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Direct analysis of Holliday junction resolving enzyme in a DNA origami nanostructure</article-title>. <source>Nucleic Acids Res</source> (<year>2014</year>) <volume>42</volume>:<page-range>7421&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gku320</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamamoto</surname> <given-names>S</given-names>
</name>
<name>
<surname>De</surname> <given-names>D</given-names>
</name>
<name>
<surname>Hidaka</surname> <given-names>K</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>KK</given-names>
</name>
<name>
<surname>Endo</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sugiyama</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Single molecule visualization and characterization of Sox2-Pax6 complex formation on a regulatory DNA element using a DNA origami frame</article-title>. <source>Nano Lett</source> (<year>2014</year>) <volume>14</volume>:<page-range>2286&#x2013;92</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/nl4044949</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Endo</surname> <given-names>M</given-names>
</name>
<name>
<surname>Xing</surname> <given-names>X</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>X</given-names>
</name>
<name>
<surname>Emura</surname> <given-names>T</given-names>
</name>
<name>
<surname>Hidaka</surname> <given-names>K</given-names>
</name>
<name>
<surname>Tuesuwan</surname> <given-names>B</given-names>
</name>
<etal/>
</person-group>. <article-title>Single-molecule manipulation of the duplex formation and dissociation at the G-quadruplex/i-motif site in the DNA nanostructure</article-title>. <source>ACS Nano</source> (<year>2015</year>) <volume>9</volume>:<page-range>9922&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/acsnano.5b03413</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>R&#xe4;z</surname> <given-names>MH</given-names>
</name>
<name>
<surname>Hidaka</surname> <given-names>K</given-names>
</name>
<name>
<surname>Sturla</surname> <given-names>SJ</given-names>
</name>
<name>
<surname>Sugiyama</surname> <given-names>H</given-names>
</name>
<name>
<surname>Endo</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Torsional constraints of DNA substrates impact cas9 cleavage</article-title>. <source>J Am Chem Soc</source> (<year>2016</year>) <volume>138</volume>:<page-range>13842&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/jacs.6b08915</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shimizu</surname> <given-names>N</given-names>
</name>
<name>
<surname>Yatabe</surname> <given-names>K</given-names>
</name>
<name>
<surname>Nagatani</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Saijyo</surname> <given-names>S</given-names>
</name>
<name>
<surname>Kosuge</surname> <given-names>T</given-names>
</name>
<name>
<surname>Igarashi</surname> <given-names>N</given-names>
</name>
</person-group>. <article-title>Software development for analysis of small-angle x-ray scattering data</article-title>. <source>AIP Conf Proc</source> (<year>2016</year>) <fpage>1741</fpage>:<elocation-id>050017</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1063/1.4952937</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Savelyev</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Assessment of the DNA partial specific volume and hydration layer&#xa0;properties from CHARMM Drude polarizable and additive MD simulations</article-title>. <source>Phys&#xa0;Chem Chem Phys</source> (<year>2021</year>) <volume>23</volume>:<page-range>10524&#x2013;35</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1039/d1cp00688f</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Orthaber</surname> <given-names>D</given-names>
</name>
<name>
<surname>Bergmann</surname> <given-names>A</given-names>
</name>
<name>
<surname>Glatter</surname> <given-names>O</given-names>
</name>
</person-group>. <article-title>SAXS experiments on absolute scale with&#xa0;Kratky systems using water as a secondary standard</article-title>. <source>J Appl Crystallogr</source> (<year>2000</year>) <volume>33</volume>:<page-range>218&#x2013;25</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1107/S0021889899015216</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Svergun</surname> <given-names>D</given-names>
</name>
<name>
<surname>Koch</surname> <given-names>MH</given-names>
</name>
<name>
<surname>Timmins</surname> <given-names>P</given-names>
</name>
<name>
<surname>May</surname> <given-names>RP</given-names>
</name>
</person-group>. <source>Small angle X-ray and neutron scattering from solutions of biological macromolecules</source>. <publisher-loc>United Kingdom</publisher-loc>: <publisher-name>Oxford Universty Press</publisher-name> (<year>2013</year>).</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Svergun</surname> <given-names>DI</given-names>
</name>
<name>
<surname>Petoukhov</surname> <given-names>MV</given-names>
</name>
<name>
<surname>Koch</surname> <given-names>MH</given-names>
</name>
<name>
<surname>Biophys</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Determination of domain structure of proteins from X-ray solution scattering</article-title>. <source>Biophys J</source> (<year>2001</year>) <volume>80</volume>:<page-range>2946&#x2013;53</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0006-3495(01)76260-1</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Franke</surname> <given-names>D</given-names>
</name>
<name>
<surname>Svergun</surname> <given-names>DI</given-names>
</name>
</person-group>. <article-title>DAMMIF, a program for rapidab-initioshape determination in small-angle scattering</article-title>. <source>J Appl Crystallogr</source> (<year>2009</year>) <volume>42</volume>:<page-range>342&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1107/s0021889809000338</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Petoukhov</surname> <given-names>MV</given-names>
</name>
<name>
<surname>Konarev</surname> <given-names>PV</given-names>
</name>
<name>
<surname>Kikhney</surname> <given-names>AG</given-names>
</name>
<name>
<surname>Svergun</surname> <given-names>DI</given-names>
</name>
</person-group>. <article-title>ATSAS 2.1 &#x2013; towards automated and web-supported small-angle scattering data analysis</article-title>. <source>J Appl Crystallogr</source> (<year>2007</year>) <volume>40</volume>:<page-range>s223&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1107/s0021889807002853</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Volkov</surname> <given-names>VV</given-names>
</name>
<name>
<surname>Svergun</surname> <given-names>DI</given-names>
</name>
</person-group>. <article-title>Uniqueness of ab initio shape determination in small-angle scattering</article-title>. <source>J Appl Crystallogr</source> (<year>2003</year>) <volume>36</volume>:<page-range>860&#x2013;4</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1107/s0021889803000268</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Svergun</surname> <given-names>DI</given-names>
</name>
</person-group>. <article-title>Restoring low resolution structure of biological macromolecules from solution scattering using simulated annealing</article-title>. <source>Biophys J</source> (<year>1999</year>) <volume>76</volume>:<page-range>2879&#x2013;86</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0006-3495(99)77443-6</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gabel</surname> <given-names>F</given-names>
</name>
<name>
<surname>Engilberge</surname> <given-names>S</given-names>
</name>
<name>
<surname>Schmitt</surname> <given-names>E</given-names>
</name>
<name>
<surname>Thureau</surname> <given-names>A</given-names>
</name>
<name>
<surname>Mechulam</surname> <given-names>Y</given-names>
</name>
<name>
<surname>P&#xe9;rez</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Medical contrast agents as promising tools for biomacromolecular SAXS experiments</article-title>. <source>Acta Crystallogr Sect D Struct Biol</source> (<year>2022</year>) <volume>78</volume>:<page-range>1120&#x2013;30</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1107/S2059798322007392</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsuo</surname> <given-names>T</given-names>
</name>
<name>
<surname>Kono</surname> <given-names>F</given-names>
</name>
<name>
<surname>Fujiwara</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Effects of the cardiomyopathy-causing E244D mutation of troponin T on the structures of cardiac thin filaments studied by small-angle X-ray scattering</article-title>. <source>J Struct Biol</source> (<year>2019</year>) <volume>205</volume>:<fpage>196</fpage>&#x2013;<lpage>205</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jsb.2018.12.005</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsuo</surname> <given-names>T</given-names>
</name>
<name>
<surname>Arata</surname> <given-names>T</given-names>
</name>
<name>
<surname>Oda</surname> <given-names>T</given-names>
</name>
<name>
<surname>Fujiwara</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Difference in hydration structures between F-actin and myosin subfragment-1 detected by small-angle X-ray and neutron scattering</article-title>. <source>Biophysics (Oxf)</source> (<year>2013</year>) <volume>9</volume>:<fpage>99</fpage>&#x2013;<lpage>106</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2142/biophysics.9.99</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Porod</surname> <given-names>G</given-names>
</name>
</person-group>. <article-title>General theory</article-title>. In: <person-group person-group-type="editor">
<name>
<surname>Glatter</surname> <given-names>O</given-names>
</name>
<name>
<surname>Kratky</surname> <given-names>O</given-names>
</name>
</person-group>, editors. <source>Small angle X-ray scattering</source>. <publisher-loc>London</publisher-loc>: <publisher-name>Plenum Press</publisher-name>. (<year>1982</year>) p. <fpage>17</fpage>&#x2013;<lpage>52</lpage>.</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rambo</surname> <given-names>RP</given-names>
</name>
<name>
<surname>Tainer</surname> <given-names>JA</given-names>
</name>
</person-group>. <article-title>Characterizing flexible and intrinsically unstructured biological macromolecules by SAS using the porod-debye law</article-title>. <source>Biopolymers</source> (<year>2011</year>) <volume>95</volume>:<page-range>559&#x2013;71</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/Bip.21638</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsuo</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Usefulness of medium-angle X-ray scattering for structural characterization of flexible proteins studied by computer simulations</article-title>. <source>Biochem Biophys Res Commun</source> (<year>2020</year>) <volume>525</volume>:<page-range>830&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbrc.2020.02.150</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Matsuo</surname> <given-names>T</given-names>
</name>
<name>
<surname>Arluison</surname> <given-names>V</given-names>
</name>
<name>
<surname>Wien</surname> <given-names>F</given-names>
</name>
<name>
<surname>Peters</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Structural information on bacterial amyloid and amyloid-DNA complex obtained by small-angle neutron/X-ray scattering</article-title>. In: <person-group person-group-type="editor">
<name>
<surname>Arluison</surname> <given-names>V</given-names>
</name>
<name>
<surname>Wien</surname> <given-names>F</given-names>
</name>
<name>
<surname>Marcoleta</surname> <given-names>A</given-names>
</name>
</person-group>, editors. <source>Bacterial amyloids: methods and protocols, methods in molecular biology</source>. <publisher-loc>New Jersey</publisher-loc>: <publisher-name>Springer, Humana Press</publisher-name>. (<year>2022</year>) p. <fpage>95</fpage>&#x2013;<lpage>107</lpage>.</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Harpaz</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Gerstein</surname> <given-names>M</given-names>
</name>
<name>
<surname>Chothia</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>Volume changes on protein folding</article-title>. <source>Structure</source> (<year>1994</year>) <volume>2</volume>:<page-range>641&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0969-2126(00)00065-4</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ko</surname> <given-names>SH</given-names>
</name>
<name>
<surname>Gallatin</surname> <given-names>GM</given-names>
</name>
<name>
<surname>Liddle</surname> <given-names>JA</given-names>
</name>
</person-group>. <article-title>Nanomanufacturing with DNA origami: factors affecting the kinetics and yield of quantum dot binding</article-title>. <source>Adv Funct Mater</source> (<year>2012</year>) <volume>22</volume>:<page-range>1015&#x2013;23</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/adfm.201102077</pub-id>
</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Suma</surname> <given-names>A</given-names>
</name>
<name>
<surname>Cui</surname> <given-names>M</given-names>
</name>
<name>
<surname>Grundmeier</surname> <given-names>G</given-names>
</name>
<name>
<surname>Carnevale</surname> <given-names>V</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>Arranging small molecules with subnanometer precision on DNA origami substrates for the single-molecule investigation of protein&#x2013;ligand interactions</article-title>. <source>Small Struct</source> (<year>2020</year>) <volume>1</volume>:<elocation-id>2000038</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/sstr.202000038</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rosier</surname> <given-names>BJHM</given-names>
</name>
<name>
<surname>Cremers</surname> <given-names>GAO</given-names>
</name>
<name>
<surname>Engelen</surname> <given-names>W</given-names>
</name>
<name>
<surname>Merkx</surname> <given-names>M</given-names>
</name>
<name>
<surname>Brunsveld</surname> <given-names>L</given-names>
</name>
<name>
<surname>de Greef</surname> <given-names>TFA</given-names>
</name>
</person-group>. <article-title>Incorporation of native antibodies and Fc-fusion proteins on DNA nanostructures via a modular conjugation strategy</article-title>. <source>Chem Commun</source> (<year>2017</year>) <volume>53</volume>:<page-range>7393&#x2013;6</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1039/C7CC04178K</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ngo</surname> <given-names>TA</given-names>
</name>
<name>
<surname>Dinh</surname> <given-names>H</given-names>
</name>
<name>
<surname>Nguyen</surname> <given-names>TM</given-names>
</name>
<name>
<surname>Liew</surname> <given-names>FF</given-names>
</name>
<name>
<surname>Nakata</surname> <given-names>E</given-names>
</name>
<name>
<surname>Morii</surname> <given-names>T</given-names>
</name>
</person-group>. <article-title>Protein adaptors assemble functional proteins on DNA scaffolds</article-title>. <source>Chem Commun</source> (<year>2019</year>) <volume>55</volume>:<page-range>12428&#x2013;46</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1039/C9CC04661E</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Funke</surname> <given-names>JJ</given-names>
</name>
<name>
<surname>Dietz</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Placing molecules with Bohr radius resolution using DNA origami</article-title>. <source>Nat Nanotechnol</source> (<year>2016</year>) <volume>11</volume>:<fpage>47</fpage>&#x2013;<lpage>52</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nnano.2015.240</pub-id>
</citation>
</ref>
<ref id="B52">
<label>52</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Voigt</surname> <given-names>NV</given-names>
</name>
<name>
<surname>T&#xf8;rring</surname> <given-names>T</given-names>
</name>
<name>
<surname>Rotaru</surname> <given-names>A</given-names>
</name>
<name>
<surname>Jacobsen</surname> <given-names>MF</given-names>
</name>
<name>
<surname>Ravnsb&#xe6;k</surname> <given-names>JB</given-names>
</name>
<name>
<surname>Subramani</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>Single-molecule chemical reactions on DNA origami</article-title>. <source>Nat Nanotechnol</source> (<year>2010</year>) <volume>5</volume>:<page-range>200&#x2013;3</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nnano.2010.5</pub-id>
</citation>
</ref>
<ref id="B53">
<label>53</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>S</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>R</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>J</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wen</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>A DNA origami-based aptamer nanoarray for potent and reversible anticoagulation in hemodialysis</article-title>. <source>Nat Commun</source> (<year>2021</year>) <volume>12</volume>:<fpage>358</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-020-20638-7</pub-id>
</citation>
</ref>
<ref id="B54">
<label>54</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rinker</surname> <given-names>S</given-names>
</name>
<name>
<surname>Ke</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Chhabra</surname> <given-names>R</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Self-assembled DNA nanostructures for distance-dependent multivalent ligand-protein binding</article-title>. <source>Nat Nanotechnol</source> (<year>2008</year>) <volume>3</volume>:<page-range>418&#x2013;22</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nnano.2008.164</pub-id>
</citation>
</ref>
<ref id="B55">
<label>55</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chhabra</surname> <given-names>R</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>J</given-names>
</name>
<name>
<surname>Ke</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Rinker</surname> <given-names>S</given-names>
</name>
<name>
<surname>Lindsay</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Spatially addressable multiprotein nanoarrays templated by aptamer-tagged DNA nanoarchitectures</article-title>. <source>J Am Chem Soc</source> (<year>2007</year>) <volume>129</volume>:<page-range>10304&#x2013;5</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/ja072410u</pub-id>
</citation>
</ref>
<ref id="B56">
<label>56</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mei</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Johnson</surname> <given-names>RH</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>X</given-names>
</name>
<name>
<surname>Su</surname> <given-names>F</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Kelbauskas</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>On-chip isotachophoresis separation of functional DNA origami capture nanoarrays from cell lysate</article-title>. <source>Nano Res</source> (<year>2013</year>) <volume>6</volume>:<page-range>712&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12274-013-0347-1</pub-id>
</citation>
</ref>
<ref id="B57">
<label>57</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Song</surname> <given-names>X</given-names>
</name>
<name>
<surname>Berezov</surname> <given-names>A</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>G</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Human glucocorticoid-induced TNF receptor ligand regulates its signaling activity through multiple oligomerization states</article-title>. <source>Proc Natl Acad Sci USA</source> (<year>2008</year>) <volume>105</volume>:<page-range>5465&#x2013;70</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.0711350105</pub-id>
</citation>
</ref>
<ref id="B58">
<label>58</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shoemaker</surname> <given-names>BA</given-names>
</name>
<name>
<surname>Portman</surname> <given-names>JJ</given-names>
</name>
<name>
<surname>Wolynes</surname> <given-names>PG</given-names>
</name>
</person-group>. <article-title>Speeding molecular recognition by using the folding funnel: The fly-casting mechanism</article-title>. <source>Proc Natl Acad Sci USA</source> (<year>2000</year>) <volume>97</volume>:<page-range>8868&#x2013;73</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.160259697</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>