<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Oncol.</journal-id>
<journal-title>Frontiers in Oncology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Oncol.</abbrev-journal-title>
<issn pub-type="epub">2234-943X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fonc.2023.1112020</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Oncology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Identifying key transcription factors and immune infiltration in non-small-cell lung cancer using weighted correlation network and Cox regression analyses</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Jingyao</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1597633"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Yinuo</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yuan</surname>
<given-names>Baowen</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1142880"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Qin</surname>
<given-names>Hao</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2083310"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Yong</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yu</surname>
<given-names>Hefen</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/992694"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Teng</surname>
<given-names>Xu</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/899443"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yang</surname>
<given-names>Yunkai</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1150936"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zou</surname>
<given-names>Jun</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Min</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Huang</surname>
<given-names>Wei</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1039877"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Wang</surname>
<given-names>Yan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/500214"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Key Laboratory of Cancer and Microbiome, State Key Laboratory of Molecular Oncology, National Cancer Center/National Clinical Research Center for Cancer/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College</institution>, <addr-line>Beijing</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Ultrasound, National Cancer Center/National Clinical Research Center for Cancer/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College</institution>, <addr-line>Beijing</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Beijing Key Laboratory of Cancer Invasion and Metastasis Research, Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Capital Medical University</institution>, <addr-line>Beijing</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Ming Lu, Shandong University, China</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Lutao Du, The Second Hospital of Shandong University, China; Rohit Gundamaraju, University of Tasmania, Australia</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Wei Huang, <email xlink:href="mailto:weihuang@ccmu.edu.cn">weihuang@ccmu.edu.cn</email>; Yan Wang, <email xlink:href="mailto:yanwang@cicams.ac.cn">yanwang@cicams.ac.cn</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>01</day>
<month>05</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>13</volume>
<elocation-id>1112020</elocation-id>
<history>
<date date-type="received">
<day>30</day>
<month>11</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>12</day>
<month>04</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Zhang, Wang, Yuan, Qin, Wang, Yu, Teng, Yang, Zou, Zhang, Huang and Wang</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Zhang, Wang, Yuan, Qin, Wang, Yu, Teng, Yang, Zou, Zhang, Huang and Wang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Introduction</title>
<p>Lung cancer is one of the most common cancers and a significant cause of cancer-related deaths. Non-small cell lung cancer (NSCLC) accounts for about 85% of all lung cancer cases. Therefore, it is crucial to identify effective diagnostic and therapeutic methods. In addition, transcription factors are essential for eukaryotic cells to regulate their gene expression, and aberrant expression transcription factors are an important step in the process of oncogenesis in NSCLC.</p>
</sec> <sec>
<title>Methods</title>
<p>Differentially expressed transcription factors between NSCLC and normal tissues by analyzing mRNA profiling from The Cancer Genome Atlas (TCGA) database program were identified. Weighted correlation network analysis (WGCNA) and line plot of least absolute shrinkage and selection operator (LASSO) were performed to find prognosis-related transcription factors. The cellular functions of transcription factors were performed by 5-ethynyl-2'-deoxyuridine (EdU) assay, wound healing assay, cell invasion assay in lung cancer cells.</p>
</sec>
<sec>
<title>Results</title>
<p>We identified 725 differentially expressed transcription factors between NSCLC and normal tissues. Three highly related modules for survival were discovered, and transcription factors highly associated with survival were obtained by using WGCNA. Then line plot of LASSO was applied to screen transcription factors related to prognosis and build a prognostic model. Consequently, <italic>SETDB2, SNAI3, SCML4</italic>, and <italic>ZNF540</italic> were identified as prognosis-related transcription factors and validated in multiple databases. The low expression of these hub genes in NSCLC was associated with poor prognosis. The deletions of both <italic>SETDB2</italic> and <italic>SNAI3</italic> were found to promote proliferation, invasion, and stemness in lung cancer cells. Furthermore, there were significant differences in the proportions of 22 immune cells between the high- and low-score groups.</p>
</sec> <sec>
<title>Discussion</title>
<p>Therefore, our study identified the transcription factors involved in regulating NSCLC, and we constructed a panel for the prediction of prognosis and immune infiltration to inform the clinical application of transcription factor analysis in the prevention and treatment of NSCLC.</p>
</sec>
</abstract>
<kwd-group>
<kwd>Transcription Factors</kwd>
<kwd>WGCNA</kwd>
<kwd>Cox regression analysis</kwd>
<kwd>LASSO analysis</kwd>
<kwd>Immune infiltration</kwd>
<kwd>NSCLC</kwd>
</kwd-group>
<contract-num rid="cn001">42125707, 41931291, 82273403, 81902960</contract-num>
<contract-num rid="cn002">2022YFA1103402</contract-num>
<contract-num rid="cn003">SKLMO-2021-21</contract-num>
<contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content>
</contract-sponsor>
<contract-sponsor id="cn002">Major State Basic Research Development Program of China<named-content content-type="fundref-id">10.13039/501100012336</named-content>
</contract-sponsor>
<contract-sponsor id="cn003">State Key Laboratory of Molecular Oncology<named-content content-type="fundref-id">10.13039/501100011637</named-content>
</contract-sponsor>
<counts>
<fig-count count="8"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="58"/>
<page-count count="16"/>
<word-count count="6165"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Thoracic Oncology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Lung cancer is the leading cause of cancer-related morbidity and mortality. It is estimated that there will be nearly 2.4 million new lung and bronchus cancer cases and 1.3 million deaths per year, accounting for nearly 21.4% of cancer-related deaths (<xref ref-type="bibr" rid="B1">1</xref>). Non-small cell lung cancer (NSCLC) accounts for approximately 85% of lung cancer cases (<xref ref-type="bibr" rid="B2">2</xref>), and it mainly includes lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC) (<xref ref-type="bibr" rid="B3">3</xref>). Surgical treatment is currently the most important means of achieving local disease control and curing stage I&#x2013;III and oligometastatic NSCLC (<xref ref-type="bibr" rid="B4">4</xref>). Low-dose chest computed tomography (CT) in patients with NSCLC has reduced lung cancer mortality by approximately 6.7%. The use of immune checkpoint inhibitors (CPIs) has profoundly promoted the development of novel, effective NSCLC treatments (<xref ref-type="bibr" rid="B5">5</xref>). Despite therapeutic advances in surgery, chemotherapy, immunotherapy, and radiation, prognoses of patients with advanced NSCLC remains unsatisfactory (<xref ref-type="bibr" rid="B5">5</xref>, <xref ref-type="bibr" rid="B6">6</xref>). Recent studies have shown different driver gene mutations and gene expression characteristics in NSCLC (<xref ref-type="bibr" rid="B7">7</xref>). Molecular characterization and utility of immunohistochemistry biomarkers in NSCLC precision medicine are a focus of current research (<xref ref-type="bibr" rid="B7">7</xref>). Particularly, RNA-sequencing (RNA-seq) is vital in cancer outlining because of the rapid development of next-generation genome-sequencing technology.</p>
<p>Tumors are cells with unlimited proliferation ability, and they are surrounded by the tumor microenvironment (TME) (<xref ref-type="bibr" rid="B8">8</xref>). The TME comprises diverse elements, including cancer cells, immune cells, tumor-associated fibroblasts, and various inflammatory cytokines secreted by these cells, such as interleukin 6 (IL6), vascular endothelial growth factor (VEGF), transforming growth factor &#x3b2;1 (TGF-&#x3b2;), and cytochrome P450 family 1 subfamily B member 1 (CYP1B) (<xref ref-type="bibr" rid="B9">9</xref>, <xref ref-type="bibr" rid="B10">10</xref>). Tumor initiation and progression are largely affected by TME dynamics and spatial and temporal heterogeneity (<xref ref-type="bibr" rid="B11">11</xref>, <xref ref-type="bibr" rid="B12">12</xref>), and the TME plays a vital role in NSCLC (<xref ref-type="bibr" rid="B13">13</xref>). Treatment of NSCLC has been revolutionized by applying programmed cell death 1 (PD-1)- and programmed cell death 1 ligand 1 (PD-L1)-related immune CPIs (<xref ref-type="bibr" rid="B14">14</xref>). The PD-1/PD-L1 inhibitors are the standard first-line treatments for metastatic NSCLC (<xref ref-type="bibr" rid="B15">15</xref>).</p>
<p>With the continuous development of treatments, immunotherapy resistance is a problem that must be urgently solved (<xref ref-type="bibr" rid="B16">16</xref>). A key strategy in counteracting CPI resistance is modulation of immunosuppressive TME. The TME is a mediator of the interaction between tumor and immune cells with multiple important roles, and it affects the response to immunotherapy (<xref ref-type="bibr" rid="B17">17</xref>). Resistance to inhibitors of immune examination is suppressed by regulating factors and receptors in the TME. For example, ectopic expression of tumor-associated macrophages (TAM) receptors in NSCLC may contribute to an immunosuppressive, tumor-promoting TME; TAM receptor inhibitors (TAM RI) convert immunosuppressive TMEs into immunostimulatory TMEs to overcome CPI resistance in NSCLC (<xref ref-type="bibr" rid="B14">14</xref>). Lefitolimod, an agonist of Toll-like receptor 9 that promotes innate and adaptive immune responses, converts non-immunogenic (&#x201c;cold&#x201d;) tumors into immunogenic (&#x201c;hot&#x201d;) tumors. Lefitolimod and CPI combination produces synergistic antitumor potency (<xref ref-type="bibr" rid="B18">18</xref>). C-C Motif Chemokine Receptor 4 (CCR4) inhibitors, which mediate tumor trafficking of regulatory T cells (Tregs), lead to decreased Treg frequency and increased antitumor activity; however, CCR4 inhibitors are used in combination with CPI to improve antitumor efficacy (<xref ref-type="bibr" rid="B16">16</xref>). Consequently, exploring the regulatory mechanism of TME is crucial for clarifying the mechanism of tumorigenesis and addressing the problems of immunotherapy sensitivity and drug resistance.</p>
<p>Transcription initiation in eukaryotic cells is a complex process involving binding transcription factors (TFs) (<xref ref-type="bibr" rid="B19">19</xref>). Transcription factors have been implicated in each stage of the development and progression of various human tumors. Many studies have shown that TFs play critical roles in cancer; for example, they influence the activity of genes involved in immunological response, immune cell infiltration, and the cell cycle (<xref ref-type="bibr" rid="B19">19</xref>, <xref ref-type="bibr" rid="B20">20</xref>). Moreover, TFs can be products of oncogenes or tumor suppressor genes. Epithelial-mesenchymal transition (EMT)-activating TFs promote tumorigenesis and cancer invasion in cell lines and xenograft mice models (<xref ref-type="bibr" rid="B21">21</xref>). Recent studies have shown that some TFs predict the prognosis of patients with malignant tumors. Other studies have shown that forkhead box TFs affect the EMT and regulate hormones and the immune system, affecting tumor development, metastasis, and drug resistance (<xref ref-type="bibr" rid="B22">22</xref>). Manshouri et&#xa0;al. reported that ZEB1, the TF of the EMT, recruits the nucleosome remodeling and deacetylase complex in NSCLC, acts as a transcriptional suppressor, and transcriptionally inhibits <italic>TBC1D2b</italic> expression, promoting the E-cadherin degradation and mesenchymal tumor transition (<xref ref-type="bibr" rid="B23">23</xref>). Mollaoglu et&#xa0;al. reported that tumor-associated neutrophils in NSCLC recruit SOX2 to mediate <italic>CXCL5</italic> expression and regulate the TME (<xref ref-type="bibr" rid="B24">24</xref>). While TFs have attracted much attention in tumor research, their roles in tumor prognosis remain unclear.</p>
<p>Weighted correlation network analysis (WGCNA) is used to identify clusters (modules) of highly related genes. It can be used to evaluate gene interconnectivity in the module and convert gene expression profile data into co-expression modules, allowing for the construction of a gene regulatory network. There are five steps in WGCNA: constructing a gene co-expression network, identifying modules, relating modules to external information, studying module relationships, and finding the key drivers of interesting modules (<xref ref-type="bibr" rid="B25">25</xref>). This method is widely used in research of many cancers, including pancreatic (<xref ref-type="bibr" rid="B26">26</xref>), lung (<xref ref-type="bibr" rid="B27">27</xref>), and liver cancers (<xref ref-type="bibr" rid="B28">28</xref>). However, differential expression analysis only considers each gene&#x2019;s expression, whereas gene network analysis considers the connections between genes, building a more comprehensive network of tumor regulatory mechanisms (<xref ref-type="bibr" rid="B29">29</xref>).</p>
<p>In the present study, a prognostic model of NSCLC based on cancer-related TFs and the effect of TFs on NSCLC prognosis was constructed. The mRNA expression of NSCLC using The Cancer Genome Atlas (TCGA) dataset was analyzed. Based on the TCGA-NSCLC gene expression profile, differential genes were obtained through differential expression analysis between cancer and normal samples. A panel of five survival-associated TFs was identified. This study will be significant in the exploration of TFs related to the prognosis of potential NSCLC and the role of TFs in NSCLC.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Antibodies and reagents</title>
<p>Antibodies used in this study included Vimentin (#5741), SLUG (#9585), &#x3b2;-catenin (#8480), and Anti-rabbit Alexa Fluor<sup>&#xae;</sup> 594 Conjugate (#8889) from Cell Signaling Technology and MMP9 (10375-2-AP), SNAI1 (13099-1-AP), SNAI3 (21350-1-AP), and SETDB2 (14428-1-AP) from Proteintech. The siRNAs were obtained from Shanghai GenePharma.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Cell culture and transfection</title>
<p>The cell lines were purchased from American Type Culture Collection (ATCC). The cell lines BEAS-2B, A549, HCC827, H1299, H1975, EPLC-272H, H226, H157, and H2170 were cultured in a humidified incubator at 5% CO<sub>2</sub> and 37&#xb0;C using RPMI1640 medium with 10% fetal bovine serum (FBS) and 1% Pen-Strep penicillin-streptomycin (Gibco). Transfections were performed with RNAiMAX Reagent (Invitrogen) according to the manufacturer&#x2019;s instructions. Each experiment was performed at least three times. siRNA against SETDB2 (5&#x2019;-GUGUACGCUGUCUAGAUGATT-3&#x2019;), siRNA against SNAI3 (5&#x2019;-GACGCAGAGAGAAAUCAAUTT-3&#x2019;) and siRNA negative control (5&#x2019;-UUCUCCGAACGUGUCACGUTT-3&#x2019;) were obtained from Shanghai GenePharma.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Database</title>
<p>The research route is shown in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>. The TCGA dataset referenced in the study is available in a public repository from UCSC Xena (<ext-link ext-link-type="uri" xlink:href="https://xena.ucsc.edu/">https://xena.ucsc.edu/</ext-link>), including transcriptome expression RNA-seq and clinical data of 1076 NSCLCs. The expression profile and survival information of patients with NSCLC, including 130 samples, were downloaded from the UCSC database (<ext-link ext-link-type="uri" xlink:href="https://ucscpublic.xenahubs.net">https://ucscpublic.xenahubs.net</ext-link>). Transcription factor sets were defined using Trrust (<ext-link ext-link-type="uri" xlink:href="https://www.grnpedia.org/trrust/">https://www.grnpedia.org/trrust/</ext-link>), CISBP (<ext-link ext-link-type="uri" xlink:href="http://cisbp.ccbr.utoronto.ca/index.php">http://cisbp.ccbr.utoronto.ca/index.php</ext-link>), and JASPAR (<ext-link ext-link-type="uri" xlink:href="http://jaspar.genereg.net/">http://jaspar.genereg.net/</ext-link>). In total, 1942 (after de-redundancy) human TFs were downloaded from the database for subsequent analysis.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Workflow of data analysis.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1112020-g001.tif"/>
</fig>
<p>Data from 130 samples from UCSC were used to verify the efficacy of the TFs prognostic scores. After standardizing the maximum and minimum data values, a log-rank test was performed on the overall survival (OS) data, and a Kaplan&#x2013;Meier curve was drawn. <italic>p</italic> &lt; 0.05 was considered a statistically significant correlation. The survival receiver operating characteristic (ROC) software package was used to plot the ROC curve, observe the prognostic efficacy with 5-year survival as the threshold, and calculate the area under the curve (AUC) score. The ROC curve was used to describe the sensitivity and specificity of the survival prediction based on the TFs score.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Differential gene expression</title>
<p>Differentially expressed genes (DEGs) between normal and tumor samples were estimated using the limma R package. Using a Bayesian approach to computation, candidate DEGs were identified by <italic>p &lt;</italic>&#x2009;0.05 and |fold-change| &gt; 1.5. After determining the intersection with the TF set, the &#x201c;pheatmap&#x201d; R package was used to draw a heatmap of partial differential TF gene expression in tumor and normal tissues. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed using the Database for Annotation, Visualization, and Integrated Discovery (DAVID: <ext-link ext-link-type="uri" xlink:href="https://david.ncifcrf.gov/">https://david.ncifcrf.gov/</ext-link>).</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Co-expression network construction</title>
<p>The &#x201c;WGCNA&#x201d; R package (<xref ref-type="bibr" rid="B25">25</xref>) was used to perform co-expression network analysis on TCGA containing differentially expressed TFs. First, no abnormal samples were found during sample clustering. A picksoft threshold was used to select the optimal soft threshold &#x3b2; for subsequent network construction; the expression profile was analyzed using scale-free clustering and a dynamic shearing tree to identify co-expressed gene modules. The co-expression network matrix calculation was used on the Pearson correlation. In addition, the relationship between these gene modules and clinical phenotypes was positioned the module as a survival module; the genes of these modules were used as candidate prognostic-related TFs.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Cox regression and line plot of least absolute shrinkage and selection operator regression</title>
<p>For the cancer samples of TCGA-NSCLC (997 samples after removing the no-OS data), the TF genes were analyzed using Cox single-factor survival analysis based on the survival package; the prognostic genes with single-factor significance (<italic>p</italic> &lt; 0.05) were selected as candidate genes. The Kaplan&#x2013;Meier method was used to establish survival curves, and the log-rank test was used to calculate the significance of the differences. Forest plot software was to plot a prognostic forest plot of the Cox single-factor results of related genes. Subsequently, prognosis-related TFs were included in the LASSO regression analysis using the &#x201c;glmnet&#x201d; R package to obtain the prognostic-related TFs, obtain the corresponding genes&#x2019; regression factor parameters, and build a TFs prognosis model based on this. Finally, Cox proportional hazards regression was used to analyze the independent predictive power of the TFs score.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Quantitative reverse transcription PCR</title>
<p>Total cellular RNA was extracted from cells using an RNA-Quick Purification Kit (Yishan Biotechnology). cDNA was prepared using a Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland). Reverse transcriptase polymerase chain reaction of the selected genes was performed by reverse transcriptase polymerase chain reaction using ABI QuantStudio 5 (Applied Biosystems). In addition, SYBR Green fluorescence was measured and quantified using the comparative Ct method (2<sup>-</sup>&#x394;&#x394;Ct), with <italic>GAPDH</italic> expression as an internal control. The assay was performed in triplicate, and the primers used are listed in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>The primers of select genes.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="center">Gene</th>
<th valign="top" align="center">Forward primer</th>
<th valign="top" align="center">Reverse primer</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="center">
<italic>ETV1</italic>
</td>
<td valign="top" align="center">GGCCCCAGGCAGTTTTATGAT</td>
<td valign="top" align="center">GATCCTCGCCGTTGGTATGT</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>SCML4</italic>
</td>
<td valign="top" align="center">TCACTCCACGCCTATGAAGAT</td>
<td valign="top" align="center">GGGTTTCCGCCCTCTTTTC</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>SETDB2</italic>
</td>
<td valign="top" align="center">ACCACCCCGAGAGCATCTGAACT</td>
<td valign="top" align="center">TGTGGTCGCCTGGTTACATCTGC</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>SNAI3</italic>
</td>
<td valign="top" align="center">ACTGCGACAAGGAGTACACC</td>
<td valign="top" align="center">GAGTGCGTTTGCAGATGGG</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>ZNF540</italic>
</td>
<td valign="top" align="center">AGTGTATGCGGACAACTTACCC</td>
<td valign="top" align="center">AGGTTTCTTACCTGCATGAGTTC</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>MMP9</italic>
</td>
<td valign="top" align="center">CGCAGACATCGTCATCCAGT</td>
<td valign="top" align="center">AACCGAGTTGGAACCACGAC</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>Vimentin</italic>
</td>
<td valign="top" align="center">AGGCAAAGCAGGAGTCCACTGA</td>
<td valign="top" align="center">ATCTGGCGTTCCAGGGACTCAT</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>&#x3b2;-catenin</italic>
</td>
<td valign="top" align="center">AAAGCGGCTGTTAGTCACTGG</td>
<td valign="top" align="center">CGAGTCATTGCATACTGTCCAT</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>SNAI1</italic>
</td>
<td valign="top" align="center">TGCCCTCAAGATGCACATCCGA</td>
<td valign="top" align="center">GGGACAGGAGAAGGGCTTCTC</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>SLUG</italic>
</td>
<td valign="top" align="center">ATCTGCGGCAAGGCGTTTTCCA</td>
<td valign="top" align="center">GAGCCCTCAGATTTGACCTGTC</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>SOX2</italic>
</td>
<td valign="top" align="center">GCCTGGGCGCCGAGTGGA</td>
<td valign="top" align="center">GGGCGAGCCGTTCATGTAGGTCTG</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>OCT4</italic>
</td>
<td valign="top" align="center">ATCACCCTGGGATATACACAG</td>
<td valign="top" align="center">CTGCTTTGCATATCTCCTGA</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>NANOG</italic>
</td>
<td valign="top" align="center">TCTGGACACTGGCTGAATCCT</td>
<td valign="top" align="center">CGCTGATTAGGCTCCAACCAT</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>GAPDH</italic>
</td>
<td valign="top" align="center">GTCAACGGATTTGGTCGTAT</td>
<td valign="top" align="center">GTCAACGGATTTGGTCGTAT</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>EdU assay</title>
<p>Cells were inoculated into 12-well plates. Next, the cells were processed using the EdU cell proliferation kit (C10310 RiboBio). Finally, the assay was performed with a fluorescent microscope. The whole process was carried out according to the manufacturer&#x2019;s instructions.</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Wound healing assay</title>
<p>Cells were taken at logarithmic growth stage, spread in a 6-well plate, and waited for the cells to grow above 95% confluence for scratching. Cells were washed 3 times with PBS and photographed; at this point the photo was taken for 0 h. The cells were added to the medium and incubated, and the healing of the scratches was observed and photographed. The images were used to analyze the percentage of healing of the scratches. Images at time zero (0 h) and at 24 or 36 h (&#x394; h) were captured. The area of wound was quantified by Image J software. The percentage of wound closure: percentage of wound closure = [(A (0 h) &#x2013; A (&#x394; h)/A (0 h)] &#xd7; 100%, A (0 h) is the area of wound measured immediately after scratching, and A (&#x394; h) is the area of wound measured 24 or 36 h after scratching.</p>
</sec>
<sec id="s2_10">
<label>2.10</label>
<title>Cell invasion assay</title>
<p>Transwell chamber filters were wrapped with Matrigel (BD Biosciences, Franklin Lakes, NJ). Lung cancer cells transfected with specific siRNAs were suspended in serum-free medium, and the cells were seeded into the upper chamber of the Transwell. The lower chamber was filled with medium containing 10% FBS. After 24 h of incubation, the cells were fixed with methanol and stained with crystal violet solution, after which the cells in the upper chamber were wiped off with a cotton swab and the remaining cells were photographed. Five high-power fields of view were taken for each small chamber selection.</p>
</sec>
<sec id="s2_11">
<label>2.11</label>
<title>Immunofluorescence staining</title>
<p>Cells were cultured in confocal-specific dishes until 85% confluence was reached, when they were fixed in 2% paraformaldehyde fixative, after which the cells were washed 3 times with PBS. Cells were treated with 0.2% triton x-100 for 5 min at 25&#xb0;C, washed 3 times with PBS, and closed with 0.8% bovine serum albumin for 1 h at 25&#xb0;C. Cells were incubated overnight or for 1 h at 25&#xb0;C by primary antibody and then they were washed 2 times (10 min each) at 25&#xb0;C with 0.1% triton x-100. Cells were incubated for 1 h with the addition of secondary antibody, and 0.1% triton x-100 was added to wash twice for 10 min each time at 25&#xb0;C. Finally, fluoroshield with 4&#x2032;,6-diamidino-2-phenylindole (DAPI) was added to cover the bottom of the dish. The mean fluorescence intensity (MFI) of cells was calculated from Image J software.</p>
</sec>
<sec id="s2_12">
<label>2.12</label>
<title>Western blotting</title>
<p>Cell-culture dishes were placed on ice, and cells were washed with ice-cold PBS. Cells were added to ice-cold Radio Immunoprecipitation Assay (RIPA) lysate and lysed at 4&#xb0;C for 10 min, vortexing every 5 min. The BCA was quantified, and protein lysate was added to the loading buffer for 10 minutes at 95&#xb0;C. Electrophoresis was carried out at 80 V until bromophenol blue ran through the top layer of the gel, followed by a shift to 120 V until bromophenol blue ran out of the sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel. To transfer the proteins from the gel to the membrane, the polyvinylidene fluoride (PVDF) was activated with methanol for 1 min and rinsed with transfer buffer in a &#x201c;sandwich&#x201d; filter paper and sponge configuration, sponge&#x2013;filter paper&#x2013;gel-membrane filter paper&#x2013;sponge. The PVDF membrane was placed in 5% skimmed milk for 1 h at 25&#xb0;C. The PVDF membranes were washed with tris buffered saline with tween 20 (TBST), and then primary antibody (diluted in primary antibody diluent) was added and incubated overnight at 4&#xb0;C. The membranes were washed 3 times in TBST for 5 minutes each time, secondary antibody prepared in 5% skimmed milk was added, and the membranes were incubated for 1 h at 25&#xb0;C in a gentle mix. Membranes were washed 3 times in TBST for 5 minutes each time. Chemiluminescence images were obtained using a darkroom development technique. Western Blot signal was quantified using the Image J software.</p>
</sec>
<sec id="s2_13">
<label>2.13</label>
<title>Statistical analysis</title>
<p>GraphPad Prism (version 8.0) was used to analyze the data from our study. Results are expressed as the mean &#xb1; SD of at least three individuals. Student&#x2019;s t-test was used to compare differences between the two groups. Survival curves were plotted using the Kaplan&#x2013;Meier &#x201c;survival&#x201d; package in R (version 3.4.3). Log-rank test was used to assess statistical significance. Statistical significance was set at <italic>p</italic> &lt; 0.05.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Identifying differentially expressed TFs in NSCLCs and normal samples</title>
<p>Data containing 1017 NSCLC and 59 normal samples from the TCGA dataset with clinical and RNA-seq datasets were used. Differential analysis was performed to find differentially expressed genes (DEGs) between normal and NSCLC samples, with the criteria of |fold change| &gt;1.5 and <italic>p</italic> &lt; 0.05; 8840 DEGs were identified. In total, 725 TFs (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplemental Table&#xa0;1</bold>
</xref>) were identified as NSCLC-related TFs (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>), of which the top 200 TFs were upregulated in NSCLC compared to normal tissues. The heatmap of the top 200 differentially expressed TFs is shown in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>. To further determine the function of these TFs, GO and KEGG pathway annotations were used to analyze the 725 differential TFs. These genes could be enriched in tumor malignancy-related GO biological processes, containing cell differentiation, proliferation, apoptosis, stemness, and angiogenesis (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>). Moreover, KEGG pathway enrichment analysis showed that 725 genes were involved in many pathways, including tumor transcriptional regulation interrelated to oncogenesis and development, the Hippo signaling pathway, TGF-&#x3b2; signaling pathway, cell cycle, immune-related Th17 cell differentiation, and Th1 and Th2 cell differentiation (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Identification of differentially expressed TFs in NSCLC and normal tissues. <bold>(A)</bold> Volcano plot of differentially expressed TFs. Red points: upregulated genes; Blue points: downregulated genes. <bold>(B)</bold> Heatmap of the top upregulated TFs. Green square group: normal tissues; pink square: tumor tissue. <bold>(C)</bold> Functional annotation of the TFs using Gene Ontology (GO) term. <bold>(D)</bold> Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment of differential TFs.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1112020-g002.tif"/>
</fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Construction of NSCLC co-expression module <italic>via</italic> WGCNA</title>
<p>We used WGCNA to build a co-expression network and modules of NSCLC-correlated differentially expressed TFs. A co-expression network was constructed with several modules. A scale-free network evaluation coefficient threshold &gt; 0.9 was selected to make the co-expression network conform to the scale-free network standard. The 725 transcription factors were subjected to clustering analysis to classify them into six modules (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A, B</bold>
</xref>) (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). The six modules were divided into two categories: green, brown, and yellow made up one category, while the other category included blue and turquoise (<xref ref-type="supplementary-material" rid="SM2">
<bold>Supplemental Table&#xa0;2</bold>
</xref>). Internal modules in the same category were positively correlated (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>). The correlation analysis of each module and clinical data was performed to find transcription factor modules that are highly correlated with clinical survival. There was a correlation between the gene significance of OS and module membership of the green module (cor = &#x2212;0.071, <italic>p</italic> = 0.03). The OS time negatively correlated with &#x201c;brown&#x201d; (cor = &#x2212;0.063, <italic>p</italic> = 0.05) and &#x201c;yellow&#x201d; (cor = &#x2212;0.087, <italic>p</italic> = 0.006) (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>). The module membership of the green module was significantly related to the gene significance of the OS, and the module membership of the brown and yellow modules was significantly related to the gene significance of the OS time (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3E</bold>
</xref>). Therefore, 118 genes contained in these three modules (green, brown, and yellow) were selected as candidate survival-related TFs for further analysis. 118 genes were enriched in many immune-related pathways, including T-cell differentiation, lymphocyte differentiation, and T-cell cytokine production. Furthermore, the potential regulatory molecular functions of these TFs were found to involve their classical functions, including enhancer binding, histone deacetylation, nuclear receptor activity, and histone acetyltransferase (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3F, G</bold>
</xref>) (<xref ref-type="supplementary-material" rid="SM3">
<bold>Supplemental Table&#xa0;3</bold>
</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Construction of NSCLC co-expression module <italic>via</italic> WGCNA. <bold>(A)</bold> Analysis of network topology for various soft-threshold powers. Left: The relationship between the soft threshold &#x3b2; and the scale-free network topology R<sup>2</sup>, where the threshold is set to 0.9 for R<sup>2</sup> and the &#x3b2; value standard is the corresponding &#x3b2; value when R<sup>2</sup> reaches 0.9 for the first time. Right: Relationship between the soft threshold &#x3b2; and connectivity. <bold>(B)</bold> Clustering dendrograms of TFs with dissimilarity based on topological overlap with assigned module colors. <bold>(C)</bold> Heatmap visualization of correlations between modules. <bold>(D)</bold> Analysis of module-NSCLC clinical data relationships. <bold>(E)</bold> Co-expression analysis of gene, brown, and yellow significance (GS) and module membership (MM). <bold>(F)</bold> Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment of 118 TFs. <bold>(G)</bold> Functional annotation of 118 TFs using Gene Ontology (GO) term. MF, molecular function; CC, cellular component; BP: biological process.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1112020-g003.tif"/>
</fig>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>The number of genes in the coexpression modules.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Module</th>
<th valign="middle" align="center">Gene count</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="center">Blue</td>
<td valign="middle" align="center">64</td>
</tr>
<tr>
<td valign="middle" align="center">Brown</td>
<td valign="middle" align="center">43</td>
</tr>
<tr>
<td valign="middle" align="center">Green</td>
<td valign="middle" align="center">36</td>
</tr>
<tr>
<td valign="middle" align="center">Turquoise</td>
<td valign="middle" align="center">85</td>
</tr>
<tr>
<td valign="middle" align="center">Yellow</td>
<td valign="middle" align="center">39</td>
</tr>
<tr>
<td valign="middle" align="center">Grey</td>
<td valign="middle" align="center">458</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Construction of Prognostic TFs in NSCLC</title>
<p>To search for TFs with key roles in the NSCLC prognosis, Cox single-factor regression analysis was performed on the above 118 key TFs; 9 TFs significantly (<italic>p</italic> &lt; 0.05) related to survival were selected (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). According to previous research, 21 genes highly related to NSCLC cell proliferation and OS of patients with NSCLC in the study were added, including 11 potential tumor suppressor genes (<italic>AFF3, AhR, AR, CBFA2T3, CHD4, KANK2, NR3C2, PTEN, PRDM16, RB1</italic>, and <italic>STK11</italic>) and 10 potential oncogenes (<italic>BARX1, DLX6, ELF3, EN1, ETV1, FOXBE1, IRX4, IRX5</italic>, and <italic>SALL1</italic>) (<xref ref-type="bibr" rid="B30">30</xref>). We performed LASSO regression analysis for these 30 TFs. Finally, five prognostic-related TFs (<italic>SETDB2, SNAI3, SCML4, ZNF540</italic>, and <italic>ETV1</italic>) were screened using LASSO regression (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). The LASSO regression coefficients of each gene were shown in <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>. Subsequently, clinical data were analyzed in relation to TFs scores, and the analysis revealed that the number of packs smoked per year (<italic>p</italic> = 0.003017), gender (<italic>p</italic> = 2.899365e-08), pathological stage TNM (T: <italic>p</italic> = 0.0004997501, N: <italic>p</italic> = 0. 006496752, M: <italic>p</italic> = 0.004497751), and targeted molecular therapy (<italic>p</italic> = 0.02204301) had significant differences in the distribution of clinical characteristics in the high and low TFs score groups. Conversely, there was no significant trend in other clinical characteristics (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Constructing prognostic TFs in NSCLC. <bold>(A)</bold> Univariate Cox regression analysis of TFs. <bold>(B)</bold> Line plot of least absolute shrinkage and selection operator (LASSO) regression analysis of 30 TFs in NSCLC. <bold>(C)</bold> Coefficients of relevant 5 TFs in LASSO regression result. <bold>(D)</bold> Heatmap of the five prognosis-related TFs expression profiles combined with clinical traits in the high- and low-score groups. <bold>(E)</bold> ROC curve of 3- and 5- year survival probability in NSCLC cancer from the UCSC dataset. <bold>(F)</bold> Kaplan&#x2013;Meier analysis of high- and low-score groups for NSCLC from the UCSC dataset.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1112020-g004.tif"/>
</fig>
<p>Furthermore, in the ROC analysis score for prognosis, the 3-year survival AUC value was 0.868, and that for the 5-year survival was 0.731 in the ROC curve (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4E</bold>
</xref>). To verify the prognostic model&#x2019;s validity, the prognostic performance of the TFs score on another set of UCSC (<ext-link ext-link-type="uri" xlink:href="https://ucscpublic.xenahubs.net">https://ucscpublic.xenahubs.net</ext-link>) data containing 130 samples from NSCLC was analyzed. The TFs score was shown to have a predictive function for the survival of NSCLC patients (<italic>p &lt;</italic> 0.037) (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4F</bold>
</xref>).</p>
<p>Finally, Cox multifactor regression was used to analyze the independent predictive performance of the model and explore the effect of other clinical factors on the prognosis in the TF score. We evaluated the prognostic value of the five TFs according to score, age, sex, number of packs smoked per year, N stage, radiotherapy, and targeted therapy. Univariate regression analysis showed that the TFs score was significantly associated with OS (HR = 1.2869, <italic>p</italic> = 0.0195); multivariate regression analysis showed that the TFs score was significantly correlated with OS (HR = 1.2681, <italic>p</italic> = 0.0348) (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A, B</bold>
</xref>). The nomogram quantified the contribution of individual factors to clinical prognosis to verify the model&#x2019;s validity, which had good predictive power (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>) (<xref ref-type="supplementary-material" rid="SM4">
<bold>Supplemental Table&#xa0;4</bold>
</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Predicting the prognosis probability in TCGA-NSCLC. <bold>(A)</bold> Univariate Cox regression analysis in the NSCLC cohort. <bold>(B)</bold> Multivariate Cox regression analysis in the NSCLC cohort. <bold>(C)</bold> Nomogram line graph for multivariate cox results of the NSCLC cohort.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1112020-g005.tif"/>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Analysis of immune infiltration</title>
<p>One important function of the immune system is to recognize and subsequently destroy tumors. In recent years, progress in tumor treatment has benefited from research involving immunotherapy (<xref ref-type="bibr" rid="B31">31</xref>&#x2013;<xref ref-type="bibr" rid="B33">33</xref>). Therefore, TME plays a vital role in diagnosing and treating tumors. According to the TCGA-NSCLC dataset, we analyzed the differences in the immune microenvironment between the high- and low-score groups (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). Using CIBERSORT calculations, significant differences were found in the infiltration levels of 22 immune cells in the high- and low-score groups. The immune cells with significant differences were memory B cells, naive CD4 T cells, resting memory CD4 T cells, regulatory T cells, resting natural killer (NK) cells, activated NK cells, monocytes, M0 macrophages, M1 macrophages, resting dendritic cells, activated dendritic cells, resting mast cells, activated mast cells, eosinophils, and neutrophils (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>) (<xref ref-type="supplementary-material" rid="SM5">
<bold>Supplemental Table&#xa0;5</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Immune microenvironment analysis of NSCLC in high- and low-score groups. <bold>(A)</bold> Proportion of infiltrating immune cells among the 22 groups with high- and low-TF scores. Different colors represent the cell types. <bold>(B)</bold> Infiltration ratios of different immune cell types with high- and low-TFs score. *<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01, ***<italic>p</italic> &lt; 0.001, ****<italic>p</italic> &lt; 0.0001. Student&#x2019;s t-test.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1112020-g006.tif"/>
</fig>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Gene network of TFs construction and survival analysis of five TFs</title>
<p>To further explore the expression of the five TFs in clinical samples, LUAD and LUSC data from TCGA were used to compare their expression in normal and NSCLC samples. The results showed that the expression levels of <italic>SETDB2, SNAI3, SCML4, ZNF540</italic>, and <italic>ETV1</italic> in LUAD (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref>) and LUSC (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7B</bold>
</xref>) were significantly lower than those in normal tissues. Meanwhile, survival analysis of each TF showed that lower <italic>SETDB2, SNAI3, SCML4</italic>, and <italic>ZNF540</italic> expression was associated with poor prognosis in lung cancer; higher expression of <italic>ETV1</italic> was associated with poor prognosis in lung cancer <italic>via</italic> Affymetrix microarray data and <italic>via</italic> RNA-seq data (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7C, D</bold>
</xref>) (<ext-link ext-link-type="uri" xlink:href="https://kmplot.com/analysis">https://kmplot.com/analysis</ext-link>). It was worth noting that the expression level of <italic>ETV1</italic> in normal tissues was higher than that in lung cancer tissues; however, patients with high expression had poor prognoses. This phenomenon suggested two roles of ETV1 in the occurrence and development of lung cancer. The TFs likely interacted with other proteins to form complexes that activated or inhibited the transcriptional regulation of genes and downstream genes to function (<xref ref-type="bibr" rid="B19">19</xref>). Therefore, the interaction protein network of the five TFs were analyzed using STRING (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7E</bold>
</xref>) (<xref ref-type="supplementary-material" rid="SM6">
<bold>Supplemental Table&#xa0;6</bold>
</xref>) (<ext-link ext-link-type="uri" xlink:href="https://string-db.org">https://string-db.org</ext-link>). These data showed that SETDB2, SNAI3, SCML4, and ZNF540 have tumor suppressor functions in lung cancer.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Expression profile and survival analysis of 5 transcription factors (TFs) in NSCLC. <bold>(A)</bold> Expression profile of 5 TFs (SETDB2, SNAI3, SCML4, ZNF540, and ETV1) in LUAD. <bold>(B)</bold> Expression profile of 5 TFs (SETDB2, SNAI3, SCML4, ZNF540, and ETV1) in LUSC. <bold>(C)</bold> Kaplan&#x2013;Meier analysis of 5 TFs (SETDB2, SNAI3, SCML4, ZNF540, and ETV1) using Affymetrix microarray data. <bold>(D)</bold> Kaplan&#x2013;Meier analysis of 5 TFs (SETDB2, SNAI3, SCML4, ZNF540, and ETV1) using RNA-seq data. <bold>(E)</bold> Analysis of the 5-TFs protein interaction network.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1112020-g007.tif"/>
</fig>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>Validating the TFs phenotypes, functions, and expression in lung cancer</title>
<p>To gain further support for the notion that SETDB2, SNAI3, SCML4, ZNF540, and ETV1 regulate the malignant phenotypes of lung cancer through the transcriptional repression of genes, experiments were performed. First, to further explore the function of SETDB2, SNAI3, SCML4, ZNF540, and ETV1 in lung cancer cell lines, the mRNA expression levels in the normal human bronchial epithelial cell line (BEAS-2B), lung adenocarcinoma cell lines (A549, HCC827, H1299, and H1975), and lung squamous cell lines (EPLC-272H, H226, H157, and H2170) were measured (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>). Consistent with the results of bioinformatics analysis, the expression levels of SETDB2 and SNAI3 were higher in BEAS-2B than in lung cancer cell lines (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8B</bold>
</xref>).</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Validating the TFs phenotypes, functions, and expression in lung cancer. <bold>(A)</bold> SETDB2, SNAI3, SCML4, ZNF540, and ETV1 mRNA expression levels in the normal human bronchial epithelial cell line (BEAS-2B), lung adenocarcinoma cell lines (A549, HCC827, H1299, and H1975), and lung squamous cell lines (EPLC-272H, H226, H157, and H2170) using RT-qPCR. Blue box: normal human bronchial epithelial cell line (BEAS-2B). Red box: lung cancer cell lines. <bold>(B)</bold> The mRNA expression levels of SETDB2 and SNAI3 in the normal human bronchial epithelial cell line (BEAS-2B), lung adenocarcinoma cell lines (A549, HCC827, H1299, and H1975), and lung squamous cell lines (EPLC-272H, H226, H157, and H2170) using RT-qPCR. <bold>(C)</bold> EdU assays were performed in A549 cells infected with siCtrl, siSETDB2, and siSNAI3. siCtrl, siControl; siSE2, siSETDB2; siSN3, siSNAI3. <bold>(D)</bold> Wound healing experiments were performed in A549, HCC827, and H1299 transfected with siCtrl, siSETDB2, and siSNAI3. siCtrl, siControl; siSE2, siSETDB2; siSN3, siSNAI3. <bold>(E)</bold> Transwell invasion assays were performed on lung cancer cells (A549, HCC827, and H1299) infected with siCtrl, siSETDB2, and siSNAI3. siCtrl, siControl; siSE2, siSETDB2; siSN3, siSNAI3. <bold>(F)</bold> Immunofluorescence staining including MMP9, Vimentin, &#x3b2;-catenin, SNAI1 and SLUG was performed in A549 cells transfected with siCtrl, siSETDB2 and siSNAI3. Blue fluorescence of DAPI labeled cell nucleus, red fluorescence of labeled corresponding protein. siCtrl, siControl; siSE2, siSETDB2; siSN3, siSNAI3. MFI, mean fluorescence intensity. <bold>(G)</bold> The mRNA expression levels of metastatic markers (MMP9, Vimentin, &#x3b2;-catenin, SNAI1, and SLUG) as well as SNAI3 and SETDB2 were detected by RT-qPCR in A549 cells transfected with siCtrl, siSETDB2, and siSNAI3. siCtrl, siControl. <bold>(H)</bold> The protein levels of metastatic markers (MMP9, Vimentin, &#x3b2;-catenin, SNAI1, and SLUG) as well as SNAI3 and SETDB2 were detected by western blotting in A549 cells transfected with siCtrl, siSETDB2, and siSNAI3. siCtrl, siControl; siSE2, siSETDB2; siSN3, siSNAI3. <bold>(I)</bold> The mRNA expression levels of stem cell markers (SOX2, OCT4, and NANOG) in A549 cells transfected with siCtrl, siSETDB2, and siSNAI3 using RT-qPCR. siCtrl, siControl. <bold>(B-E, G, I)</bold> Error bar represents mean &#xb1; SD of three independent experiments. *<italic>p</italic> &lt; 0.05, **<italic>p</italic> &lt; 0.01. Student&#x2019;s t-test.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fonc-13-1112020-g008.tif"/>
</fig>
<p>To determine how SETDB2 and SNAI3 regulate the cell proliferation of NSCLC, EdU assays were performed, which showed that knockdown of SETDB2 or SNAI3 in A549 cells had a strong promotion effect on the proliferation of lung cancer cells (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8C</bold>
</xref>). We then investigated the roles of SETDB2 and SNAI3 in cellular behavior of NSCLC using wound healing and transwell invasion assay in A549, HCC827, and H1299, which were transfected with control siRNA, SETDB2 siRNA, or SNAI3 siRNA. The wound healing assay showed that depletion of SETDB2 or SNAI3 promoted the migration of lung cancer cells (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8D</bold>
</xref>). Meanwhile, the increased invasion was induced by knocking-down SETDB2 or SNAI3 (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8E</bold>
</xref>).</p>
<p>We next investigated the possibility of SETDB2 and SNAI3 in NSCLC metastasis and stemness <italic>in vitro</italic>. The result of immunofluorescence assay indicated that metastasis-related markers (MMP9, Vimentin, &#x3b2;-catenin, SNAI1, and SLUG) were significantly upregulated with SETDB2 or SNAI3 knockdown in A549 cells (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8F</bold>
</xref>). The expression of metastasis-related markers was analyzed by RT-qPCR and Western blotting using A549 cells transfected with control siRNA, SETDB2 siRNA, or SNAI3 siRNA. SETDB2 or SNAI3 depletion led to an increase of metastasis-related markers (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8G, H</bold>
</xref>). In addition, the stem cell markers (SOX2, OCT4, and NANOG) were upregulated with the knockdown of SETDB2 or SNAI3 (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8I</bold>
</xref>). These results show that SETDB2 and SNAI3 inhibit proliferation, migration, invasive, metastasis, and cell stemness of lung cancer cells.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>Lung cancer is one of the most common cancers all over the world and has become a major threat to human health due to its high morbidity and mortality (<xref ref-type="bibr" rid="B30">30</xref>). In 2001, the 3-year survival rate of patients with lung cancer was 19%, increasing to 31% in 2015&#x2013;2017. This is due to the progress in the diagnosis and treatment of NSCLC, including more accurate staging and advanced surgical concepts and techniques (<xref ref-type="bibr" rid="B34">34</xref>&#x2013;<xref ref-type="bibr" rid="B37">37</xref>). Therefore, identifying gene markers related to prognosis and exploring potential NSCLC targets are crucial efforts in its diagnosis and treatment, and the discovery of more sensitive and specific biomarkers will improve the diagnosis and treatment of NSCLC.</p>
<p>In the present study, we screened 725 differentially expressed TFs in normal lung tissue and NSCLC. In the WGCNA module analysis of these disease-related TFs, three similar modules were found to be associated with survival state and survival time, from which 118 survival phenotype-related TFs were obtained. Nine survival-related TFs were identified using Cox univariate analysis; five survival-related TFs (SETDB2, SNAI3, SCML4, ZNF540, and ETV1) and the corresponding regression factors were obtained using LASSO regression analysis.</p>
<p>Accumulating evidence showed that TFs play important roles in tumorigenesis, metastasis, and tumor immunity (<xref ref-type="bibr" rid="B38">38</xref>&#x2013;<xref ref-type="bibr" rid="B40">40</xref>). SETDB2 promoted methylation (transcriptional repression) of histone H3K9, and SETDB2 was involved in innate immune inflammation and response. <italic>SETDB2</italic> expression was upregulated in M1 macrophages, which killed tumor cells, but not in M2 macrophages, which promoted tumor growth, invasion, and metastasis (<xref ref-type="bibr" rid="B41">41</xref>, <xref ref-type="bibr" rid="B42">42</xref>). In addition, SETDB2 was also a glucocorticoid-induced putative epigenetic modifier that promotes the enrichment of glucocorticoid receptor chromatin, and glucocorticoids were found to inhibit the growth of lymphoma (<xref ref-type="bibr" rid="B43">43</xref>, <xref ref-type="bibr" rid="B44">44</xref>). SNAI3 is a member of the Snail family. <italic>SNAI3</italic> expression was downregulated in multiple tumors compared to normal tissues. Whereas <italic>SNAI3</italic> expression was found to be associated with good prognosis in breast cancer. SNAI3 had a potential opposite role for SNAI1 and SNAI2 in tumorigenesis and progression (<xref ref-type="bibr" rid="B45">45</xref>). <italic>SCML4</italic> expression was shown to correlate with poor prognosis in breast cancer (<xref ref-type="bibr" rid="B46">46</xref>). Studies found that SCML4 potentially regulates the immune response and is involved in vascular remodeling (<xref ref-type="bibr" rid="B46">46</xref>, <xref ref-type="bibr" rid="B47">47</xref>). <italic>ZNF540</italic> is a zinc-finger protein located on chromosome 19; it interacts with MVP and inhibits the transcriptional activity of the ERK signaling pathway (<xref ref-type="bibr" rid="B48">48</xref>, <xref ref-type="bibr" rid="B49">49</xref>). Some studies showed that CpG methylation changes in the <italic>ZNF540</italic> through renal clear carcinoma tissue analysis associated with tumor aggressiveness and patient prognosis (<xref ref-type="bibr" rid="B50">50</xref>, <xref ref-type="bibr" rid="B51">51</xref>). The above study showed that ZNF540 is a potential suppressor gene in tumors. ETV1 has a vital role in developing the cardiac conduction system, muscle development, and cerebellar circuit development (<xref ref-type="bibr" rid="B52">52</xref>). In prostate cancer, androgen receptor activation mediates <italic>ETV1</italic> expression, activating Twist1, leading to EMT and tumor metastasis (<xref ref-type="bibr" rid="B53">53</xref>). Similarly, ETV1 is activated by HER2/Neu in high-risk female tumors (breast, endometrial, and ovarian cancers), mediating the malignant tumor phenotype (<xref ref-type="bibr" rid="B54">54</xref>, <xref ref-type="bibr" rid="B55">55</xref>). Overexpression of <italic>ETV1</italic> in various tumors mediates cell growth, invasion, and migration in various tumor cells, leading to tumor progression, metastasis, and drug resistance (<xref ref-type="bibr" rid="B52">52</xref>, <xref ref-type="bibr" rid="B55">55</xref>). Therefore, SETDB2, SNAI3, SCML4, and ZNF540 are potential suppressors in tumors, and their specific mechanisms should be further explored.</p>
<p>The immune infiltration of various immune cells was different in the high- and low-score groups, including various regulatory T cells, activated NK cells, monocytes, M0 macrophages, and M1 macrophages, which were important in the TME. Regulatory T cells were immunosuppressive T cells categorized by the expression of <italic>FOXP3</italic>, which hinders effective antitumor immune responses (<xref ref-type="bibr" rid="B56">56</xref>, <xref ref-type="bibr" rid="B57">57</xref>). Furthermore, the gut microbiota regulates intertumoral infiltration and NK cell activity to promote pancreatic ductal adenocarcinoma progression. In addition, Tumor-associated macrophages (TAMs) regulate tumor progression, promoting lung cancer cells to assume an M2 (TAM-like) phenotype and, subsequently, EMT and invasion of lung cancer cells (<xref ref-type="bibr" rid="B58">58</xref>). Therefore, this predictive model showed that the two groups of tumors had different immune cell profiles and infiltration. This ongoing research intended to predict the effects of immunotherapy and develop new treatment strategies.</p>
<p>In conclusion, we performed WGCNA analysis on NSCLC-related TF genes and mined module TF genes related to survival prognosis, including Cox single factor analysis, to obtain candidate prognostic risk TF genes. This 5-TF prediction model was validated using an additional UCSC dataset. Meanwhile, the cohort was divided into high- and low- score groups according to the model, and the differences in the proportional distribution of immune cells between the high- and low- score groups were compared. In addition, the roles of SETDB2, SNAI3, SCML4, ZNF540, and ETV1 were validated in multiple datasets and human lung cancer cell lines. The method provided in this study was beneficial for screening patients with NSCLC with poor prognoses to achieve early detection, early treatment, and improved survival. This study had several limitations, more samples were needed for further verification and optimization in the future.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>.</p>
</sec>
<sec id="s6" sec-type="author-contributions">
<title>Author contributions</title>
<p>WH and YanW contributed the study design. JYZ were involved in the acquisition of data, prepared all figures and tables, and wrote the manuscript. JYZ, YNW, YY, JZ, MZ performed the experiments. BY, HQ, YongW, HY, XT analyzed the data. JYZ, WH, and YanW wrote the original draft. All authors approved this work for publication. All authors contributed to the article.</p>
</sec>
</body>
<back>
<sec id="s7" sec-type="funding-information">
<title>Funding</title>
<p>This study was supported by grants from the National Natural Science Foundation of China (41931291, 42125707, 82273403, 81902960), the Major State Basic Research Development Program of China (2022YFA1103402), the Non-profit Central Research Institute Fund of Chinese Academy of Medical Sciences (2019PT310027, 2021-RC310-006, 2021-RC310-018), the Chinese Academy of Medical Sciences Innovation Fund for Medical Sciences (2021-I2M-1-018), and the State Key Laboratory of Molecular Oncology (SKLMO-2021-21).</p>
</sec>
<sec id="s8" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s9" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s10" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fonc.2023.1112020/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fonc.2023.1112020/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Table_1.xlsx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
<supplementary-material xlink:href="Table_2.xlsx" id="SM2" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
<supplementary-material xlink:href="Table_3.xlsx" id="SM3" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
<supplementary-material xlink:href="Table_4.xlsx" id="SM4" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
<supplementary-material xlink:href="Table_5.xlsx" id="SM5" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
<supplementary-material xlink:href="Table_6.xlsx" id="SM6" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Siegel</surname> <given-names>R</given-names>
</name>
<name>
<surname>Miller</surname> <given-names>K</given-names>
</name>
<name>
<surname>Fuchs</surname> <given-names>H</given-names>
</name>
<name>
<surname>Jemal</surname> <given-names>A</given-names>
</name>
</person-group>. <article-title>Cancer statistics, 2022</article-title>. <source>CA: Cancer J Clin</source> (<year>2022</year>) <volume>72</volume>(<issue>1</issue>):<fpage>7</fpage>&#x2013;<lpage>33</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3322/caac.21708</pub-id>
</citation>
</ref>
<ref id="B2">
<label>2</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname> <given-names>G</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Pan</surname> <given-names>J</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Ouari</surname> <given-names>O</given-names>
</name>
<name>
<surname>Hardy</surname> <given-names>M</given-names>
</name>
<etal/>
</person-group>. <article-title>Targeting lonidamine to mitochondria mitigates lung tumorigenesis and brain metastasis</article-title>. <source>Nat Commun</source> (<year>2019</year>) <volume>10</volume>(<issue>1</issue>):<fpage>2205</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-019-10042-1</pub-id>
</citation>
</ref>
<ref id="B3">
<label>3</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Herbst</surname> <given-names>RS</given-names>
</name>
<name>
<surname>Morgensztern</surname> <given-names>D</given-names>
</name>
<name>
<surname>Boshoff</surname> <given-names>C</given-names>
</name>
</person-group>. <article-title>The biology and management of non-small cell lung cancer</article-title>. <source>Nature</source> (<year>2018</year>) <volume>553</volume>(<issue>7689</issue>):<page-range>446&#x2013;54</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nature25183</pub-id>
</citation>
</ref>
<ref id="B4">
<label>4</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Deboever</surname> <given-names>N</given-names>
</name>
<name>
<surname>Mitchell</surname> <given-names>KG</given-names>
</name>
<name>
<surname>Feldman</surname> <given-names>HA</given-names>
</name>
<name>
<surname>Cascone</surname> <given-names>T</given-names>
</name>
<name>
<surname>Sepesi</surname> <given-names>B</given-names>
</name>
</person-group>. <article-title>Current surgical indications for non-Small-Cell lung cancer</article-title>. <source>Cancers (Basel)</source> (<year>2022</year>) <volume>14</volume>(<issue>5</issue>):<fpage>1263</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/cancers14051263</pub-id>
</citation>
</ref>
<ref id="B5">
<label>5</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Duma</surname> <given-names>N</given-names>
</name>
<name>
<surname>Santana-Davila</surname> <given-names>R</given-names>
</name>
<name>
<surname>Molina</surname> <given-names>JR</given-names>
</name>
</person-group>. <article-title>Non-small cell lung cancer: epidemiology, screening, diagnosis, and treatment</article-title>. <source>Mayo Clin Proc</source> (<year>2019</year>) <volume>94</volume>(<issue>8</issue>):<page-range>1623&#x2013;40</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.mayocp.2019.01.013</pub-id>
</citation>
</ref>
<ref id="B6">
<label>6</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Higgins</surname> <given-names>KA</given-names>
</name>
<name>
<surname>Puri</surname> <given-names>S</given-names>
</name>
<name>
<surname>Gray</surname> <given-names>JE</given-names>
</name>
</person-group>. <article-title>Systemic and radiation therapy approaches for locally advanced non-Small-Cell lung cancer</article-title>. <source>J Clin Oncol</source> (<year>2022</year>) <volume>40</volume>(<issue>6</issue>):<page-range>576&#x2013;85</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1200/jco.21.01707</pub-id>
</citation>
</ref>
<ref id="B7">
<label>7</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Osmani</surname> <given-names>L</given-names>
</name>
<name>
<surname>Askin</surname> <given-names>F</given-names>
</name>
<name>
<surname>Gabrielson</surname> <given-names>E</given-names>
</name>
<name>
<surname>Li</surname> <given-names>QK</given-names>
</name>
</person-group>. <article-title>Current who guidelines and the critical role of immunohistochemical markers in the subclassification of non-small cell lung carcinoma (Nsclc): moving from targeted therapy to immunotherapy</article-title>. <source>Semin Cancer Biol</source> (<year>2018</year>) <volume>52</volume>(<issue>Pt 1</issue>):<page-range>103&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.semcancer.2017.11.019</pub-id>
</citation>
</ref>
<ref id="B8">
<label>8</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Role of epigenetic regulation in plasticity of tumor immune microenvironment</article-title>. <source>Front Immunol</source> (<year>2021</year>) <volume>12</volume>:<elocation-id>640369</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2021.640369</pub-id>
</citation>
</ref>
<ref id="B9">
<label>9</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>D&#x2019;Uva</surname> <given-names>G</given-names>
</name>
<name>
<surname>Baci</surname> <given-names>D</given-names>
</name>
<name>
<surname>Albini</surname> <given-names>A</given-names>
</name>
<name>
<surname>Noonan</surname> <given-names>DM</given-names>
</name>
</person-group>. <article-title>Cancer chemoprevention revisited: cytochrome P450 family 1b1 as a target in the tumor and the microenvironment</article-title>. <source>Cancer Treat Rev</source> (<year>2018</year>) <volume>63</volume>:<fpage>1</fpage>&#x2013;<lpage>18</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ctrv.2017.10.013</pub-id>
</citation>
</ref>
<ref id="B10">
<label>10</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>L&#xf3;pez de Andr&#xe9;s</surname> <given-names>J</given-names>
</name>
<name>
<surname>Gri&#xf1;&#xe1;n-Lis&#xf3;n</surname> <given-names>C</given-names>
</name>
<name>
<surname>Jim&#xe9;nez</surname> <given-names>G</given-names>
</name>
<name>
<surname>Marchal</surname> <given-names>JA</given-names>
</name>
</person-group>. <article-title>Cancer stem cell secretome in the tumor microenvironment: a key point for an effective personalized cancer treatment</article-title>. <source>J Hematol Oncol</source> (<year>2020</year>) <volume>13</volume>(<issue>1</issue>):<fpage>136</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13045-020-00966-3</pub-id>
</citation>
</ref>
<ref id="B11">
<label>11</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>H</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>M</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Su</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X</given-names>
</name>
<etal/>
</person-group>. <article-title>Functions and clinical significance of mechanical tumor microenvironment: cancer cell sensing, mechanobiology and metastasis</article-title>. <source>Cancer Commun (Lond)</source> (<year>2022</year>) <volume>42</volume>(<issue>5</issue>):<fpage>374</fpage>&#x2013;<lpage>400</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/cac2.12294</pub-id>
</citation>
</ref>
<ref id="B12">
<label>12</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ganguly</surname> <given-names>K</given-names>
</name>
<name>
<surname>Shah</surname> <given-names>A</given-names>
</name>
<name>
<surname>Atri</surname> <given-names>P</given-names>
</name>
<name>
<surname>Rauth</surname> <given-names>S</given-names>
</name>
<name>
<surname>Ponnusamy</surname> <given-names>MP</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Chemokine-mucinome interplay in shaping the heterogeneous tumor microenvironment of pancreatic cancer</article-title>. <source>Semin Cancer Biol</source> (<year>2022</year>) <volume>86</volume>(<issue>Pt 2</issue>):<page-range>511&#x2013;20</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.semcancer.2022.03.022</pub-id>
</citation>
</ref>
<ref id="B13">
<label>13</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sadeghi Rad</surname> <given-names>H</given-names>
</name>
<name>
<surname>Bahrami</surname> <given-names>T</given-names>
</name>
<name>
<surname>Layeghi</surname> <given-names>SM</given-names>
</name>
<name>
<surname>Yousefi</surname> <given-names>H</given-names>
</name>
<name>
<surname>Rezaei</surname> <given-names>M</given-names>
</name>
<name>
<surname>Hosseini-Fard</surname> <given-names>SR</given-names>
</name>
<etal/>
</person-group>. <article-title>Immunotherapeutic targets in non-small cell lung cancer</article-title>. <source>Immunology</source> (<year>2023</year>) <volume>168</volume>(<issue>2</issue>):<page-range>256&#x2013;72</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/imm.13562</pub-id>
</citation>
</ref>
<ref id="B14">
<label>14</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Peters</surname> <given-names>S</given-names>
</name>
<name>
<surname>Paz-Ares</surname> <given-names>L</given-names>
</name>
<name>
<surname>Herbst</surname> <given-names>RS</given-names>
</name>
<name>
<surname>Reck</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Addressing cpi resistance in nsclc: targeting Tam receptors to modulate the tumor microenvironment and future prospects</article-title>. <source>J Immunother Cancer</source> (<year>2022</year>) <volume>10</volume>(<issue>7</issue>):<elocation-id>e004863</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1136/jitc-2022-004863</pub-id>
</citation>
</ref>
<ref id="B15">
<label>15</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Adkins</surname> <given-names>DR</given-names>
</name>
<name>
<surname>Haddad</surname> <given-names>RI</given-names>
</name>
</person-group>. <article-title>Clinical trial data of anti-Pd-1/Pd-L1 therapy for recurrent or metastatic nasopharyngeal carcinoma: a review</article-title>. <source>Cancer Treat Rev</source> (<year>2022</year>) <volume>109</volume>:<elocation-id>102428</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ctrv.2022.102428</pub-id>
</citation>
</ref>
<ref id="B16">
<label>16</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marshall</surname> <given-names>LA</given-names>
</name>
<name>
<surname>Marubayashi</surname> <given-names>S</given-names>
</name>
<name>
<surname>Jorapur</surname> <given-names>A</given-names>
</name>
<name>
<surname>Jacobson</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zibinsky</surname> <given-names>M</given-names>
</name>
<name>
<surname>Robles</surname> <given-names>O</given-names>
</name>
<etal/>
</person-group>. <article-title>Tumors establish resistance to immunotherapy by regulating T(Reg) recruitment <italic>via</italic> Ccr4</article-title>. <source>J Immunother Cancer</source> (<year>2020</year>) <volume>8</volume>(<issue>2</issue>):<elocation-id>e000764</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1136/jitc-2020-000764</pub-id>
</citation>
</ref>
<ref id="B17">
<label>17</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Su</surname> <given-names>JY</given-names>
</name>
<name>
<surname>Li</surname> <given-names>WH</given-names>
</name>
<name>
<surname>Li</surname> <given-names>YM</given-names>
</name>
</person-group>. <article-title>New opportunities for immunomodulation of the tumour microenvironment using chemical tools</article-title>. <source>Chem Soc Rev</source> (<year>2022</year>) <volume>51</volume>(<issue>18</issue>):<page-range>7944&#x2013;70</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1039/d2cs00486k</pub-id>
</citation>
</ref>
<ref id="B18">
<label>18</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kapp</surname> <given-names>K</given-names>
</name>
<name>
<surname>Volz</surname> <given-names>B</given-names>
</name>
<name>
<surname>Oswald</surname> <given-names>D</given-names>
</name>
<name>
<surname>Wittig</surname> <given-names>B</given-names>
</name>
<name>
<surname>Baumann</surname> <given-names>M</given-names>
</name>
<name>
<surname>Schmidt</surname> <given-names>M</given-names>
</name>
</person-group>. <article-title>Beneficial modulation of the tumor microenvironment and generation of anti-tumor responses by Tlr9 agonist lefitolimod alone and in combination with checkpoint inhibitors</article-title>. <source>Oncoimmunology</source> (<year>2019</year>) <volume>8</volume>(<issue>12</issue>):<elocation-id>e1659096</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/2162402x.2019.1659096</pub-id>
</citation>
</ref>
<ref id="B19">
<label>19</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>F</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Perna</surname> <given-names>F, </given-names></name>
<collab>Nimer SD</collab>
</person-group>. <article-title>Beyond transcription factors: how oncogenic signalling reshapes the epigenetic landscape</article-title>. <source>Nat Rev Cancer</source> (<year>2016</year>) <volume>16</volume>(<issue>6</issue>):<page-range>359&#x2013;72</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrc.2016.41</pub-id>
</citation>
</ref>
<ref id="B20">
<label>20</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Deng</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>F</given-names>
</name>
<name>
<surname>Hughes</surname> <given-names>T</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Foxos in cancer immunity: knowns and unknowns</article-title>. <source>Semin Cancer Biol </source> (<year>2018</year>) <volume>50</volume>:<fpage>53</fpage>&#x2013;<lpage>64</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.semcancer.2018.01.005</pub-id>
</citation>
</ref>
<ref id="B21">
<label>21</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Puisieux</surname> <given-names>A</given-names>
</name>
<name>
<surname>Brabletz</surname> <given-names>T</given-names>
</name>
<name>
<surname>Caramel</surname> <given-names>J</given-names>
</name>
</person-group>. <article-title>Oncogenic roles of emt-inducing transcription factors</article-title>. <source>Nat Cell Biol</source> (<year>2014</year>) <volume>16</volume>(<issue>6</issue>):<page-range>488&#x2013;94</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/ncb2976</pub-id>
</citation>
</ref>
<ref id="B22">
<label>22</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Castaneda</surname> <given-names>M</given-names>
</name>
<name>
<surname>den Hollander</surname> <given-names>P</given-names>
</name>
<name>
<surname>Mani</surname> <given-names>SA</given-names>
</name>
</person-group>. <article-title>Forkhead box transcription factors: double-edged swords in cancer</article-title>. <source>Cancer Res</source> (<year>2022</year>) <volume>82</volume>(<issue>11</issue>):<page-range>2057&#x2013;65</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/0008-5472.Can-21-3371</pub-id>
</citation>
</ref>
<ref id="B23">
<label>23</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Manshouri</surname> <given-names>R</given-names>
</name>
<name>
<surname>Coyaud</surname> <given-names>E</given-names>
</name>
<name>
<surname>Kundu</surname> <given-names>ST</given-names>
</name>
<name>
<surname>Peng</surname> <given-names>DH</given-names>
</name>
<name>
<surname>Stratton</surname> <given-names>SA</given-names>
</name>
<name>
<surname>Alton</surname> <given-names>K</given-names>
</name>
<etal/>
</person-group>. <article-title>Zeb1/Nurd complex suppresses Tbc1d2b to stimulate e-cadherin internalization and promote metastasis in lung cancer</article-title>. <source>Nat Commun</source> (<year>2019</year>) <volume>10</volume>(<issue>1</issue>):<fpage>5125</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-019-12832-z</pub-id>
</citation>
</ref>
<ref id="B24">
<label>24</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mollaoglu</surname> <given-names>G</given-names>
</name>
<name>
<surname>Jones</surname> <given-names>A</given-names>
</name>
<name>
<surname>Wait</surname> <given-names>SJ</given-names>
</name>
<name>
<surname>Mukhopadhyay</surname> <given-names>A</given-names>
</name>
<name>
<surname>Jeong</surname> <given-names>S</given-names>
</name>
<name>
<surname>Arya</surname> <given-names>R</given-names>
</name>
<etal/>
</person-group>. <article-title>The lineage-defining transcription factors Sox2 and Nkx2-1 determine lung cancer cell fate and shape the tumor immune microenvironment</article-title>. <source>Immunity</source> (<year>2018</year>) <volume>49</volume>(<issue>4</issue>):<fpage>764</fpage>&#x2013;<lpage>79.e9</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.immuni.2018.09.020</pub-id>
</citation>
</ref>
<ref id="B25">
<label>25</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Langfelder</surname> <given-names>P</given-names>
</name>
<name>
<surname>Horvath</surname> <given-names>S</given-names>
</name>
</person-group>. <article-title>Wgcna: an r package for weighted correlation network analysis</article-title>. <source>BMC Bioinf</source> (<year>2008</year>) <volume>9</volume>:<elocation-id>559</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2105-9-559</pub-id>
</citation>
</ref>
<ref id="B26">
<label>26</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mantini</surname> <given-names>G</given-names>
</name>
<name>
<surname>Vall&#xe9;s</surname> <given-names>A</given-names>
</name>
<name>
<surname>Le Large</surname> <given-names>T</given-names>
</name>
<name>
<surname>Capula</surname> <given-names>M</given-names>
</name>
<name>
<surname>Funel</surname> <given-names>N</given-names>
</name>
<name>
<surname>Pham</surname> <given-names>T</given-names>
</name>
<etal/>
</person-group>. <article-title>Co-Expression analysis of pancreatic cancer proteome reveals biology and prognostic biomarkers</article-title>. <source>Cell Oncol (Dordr)</source> (<year>2020</year>) <volume>43</volume>(<issue>6</issue>):<page-range>1147&#x2013;59</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s13402-020-00548-y</pub-id>
</citation>
</ref>
<ref id="B27">
<label>27</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tian</surname> <given-names>F</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>J</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>X</given-names>
</name>
<name>
<surname>Kang</surname> <given-names>Z</given-names>
</name>
</person-group>. <article-title>Weighted gene Co-expression network analysis in identification of metastasis-related genes of lung squamous cell carcinoma based on the cancer genome atlas database</article-title>. <source>J Thorac Dis</source> (<year>2017</year>) <volume>9</volume>(<issue>1</issue>):<fpage>42</fpage>&#x2013;<lpage>53</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.21037/jtd.2017.01.04</pub-id>
</citation>
</ref>
<ref id="B28">
<label>28</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nguyen</surname> <given-names>TB</given-names>
</name>
<name>
<surname>Do</surname> <given-names>DN</given-names>
</name>
<name>
<surname>Nguyen-Thanh</surname> <given-names>T</given-names>
</name>
<name>
<surname>Tatipamula</surname> <given-names>VB</given-names>
</name>
<name>
<surname>Nguyen</surname> <given-names>HT</given-names>
</name>
</person-group>. <article-title>Identification of five hub genes as key prognostic biomarkers in liver cancer <italic>Via</italic> integrated bioinformatics analysis</article-title>. <source>Biol (Basel)</source> (<year>2021</year>) <volume>10</volume>(<issue>10</issue>):<fpage>957</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/biology10100957</pub-id>
</citation>
</ref>
<ref id="B29">
<label>29</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Niemira</surname> <given-names>M</given-names>
</name>
<name>
<surname>Collin</surname> <given-names>F</given-names>
</name>
<name>
<surname>Szalkowska</surname> <given-names>A</given-names>
</name>
<name>
<surname>Bielska</surname> <given-names>A</given-names>
</name>
<name>
<surname>Chwialkowska</surname> <given-names>K</given-names>
</name>
<name>
<surname>Reszec</surname> <given-names>J</given-names>
</name>
<etal/>
</person-group>. <article-title>Molecular signature of subtypes of non-Small-Cell lung cancer by large-scale transcriptional profiling: identification of key modules and genes by weighted gene Co-expression network analysis (Wgcna)</article-title>. <source>Cancers (Basel)</source> (<year>2019</year>) <volume>12</volume>(<issue>1</issue>):<fpage>37</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/cancers12010037</pub-id>
</citation>
</ref>
<ref id="B30">
<label>30</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>DL</given-names>
</name>
<name>
<surname>Qu</surname> <given-names>LW</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>L</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>YC</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>GZ</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>XC</given-names>
</name>
<etal/>
</person-group>. <article-title>Genome-wide identification of transcription factors that are critical to non-small cell lung cancer</article-title>. <source>Cancer Lett</source> (<year>2018</year>) <volume>434</volume>:<page-range>132&#x2013;43</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.canlet.2018.07.020</pub-id>
</citation>
</ref>
<ref id="B31">
<label>31</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Aerts</surname> <given-names>JG</given-names>
</name>
<name>
<surname>Hegmans</surname> <given-names>JP</given-names>
</name>
</person-group>. <article-title>Tumor-specific cytotoxic T cells are crucial for efficacy of immunomodulatory antibodies in patients with lung cancer</article-title>. <source>Cancer Res</source> (<year>2013</year>) <volume>73</volume>(<issue>8</issue>):<page-range>2381&#x2013;8</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/0008-5472.Can-12-3932</pub-id>
</citation>
</ref>
<ref id="B32">
<label>32</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zielinski</surname> <given-names>C</given-names>
</name>
<name>
<surname>Knapp</surname> <given-names>S</given-names>
</name>
<name>
<surname>Mascaux</surname> <given-names>C</given-names>
</name>
<name>
<surname>Hirsch</surname> <given-names>F</given-names>
</name>
</person-group>. <article-title>Rationale for targeting the immune system through checkpoint molecule blockade in the treatment of non-Small-Cell lung cancer</article-title>. <source>Ann Oncol</source> (<year>2013</year>) <volume>24</volume>(<issue>5</issue>):<page-range>1170&#x2013;9</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/annonc/mds647</pub-id>
</citation>
</ref>
<ref id="B33">
<label>33</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname> <given-names>F</given-names>
</name>
<name>
<surname>Furones</surname> <given-names>AR</given-names>
</name>
<name>
<surname>Landegren</surname> <given-names>N</given-names>
</name>
<name>
<surname>Fuxe</surname> <given-names>J</given-names>
</name>
<name>
<surname>Sarhan</surname> <given-names>D</given-names>
</name>
</person-group>. <article-title>Sex dimorphism in the tumor microenvironment - from bench to bedside and back</article-title>. <source>Semin Cancer Biol</source> (<year>2022</year>) <volume>86</volume>(<issue>Pt 3</issue>):<page-range>166&#x2013;79</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.semcancer.2022.03.007</pub-id>
</citation>
</ref>
<ref id="B34">
<label>34</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shirley</surname> <given-names>M</given-names>
</name>
<name>
<surname>Keam</surname> <given-names>SJ</given-names>
</name>
</person-group>. <article-title>Aumolertinib: a review in non-small cell lung cancer</article-title>. <source>Drugs</source> (<year>2022</year>) <volume>82</volume>(<issue>5</issue>):<page-range>577&#x2013;84</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s40265-022-01695-2</pub-id>
</citation>
</ref>
<ref id="B35">
<label>35</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Janning</surname> <given-names>M</given-names>
</name>
<name>
<surname>S&#xfc;ptitz</surname> <given-names>J</given-names>
</name>
<name>
<surname>Albers-Leischner</surname> <given-names>C</given-names>
</name>
<name>
<surname>Delpy</surname> <given-names>P</given-names>
</name>
<name>
<surname>Tufman</surname> <given-names>A</given-names>
</name>
<name>
<surname>Velthaus-Rusik</surname> <given-names>JL</given-names>
</name>
<etal/>
</person-group>. <article-title>Treatment outcome of atypical egfr mutations in the German national network genomic medicine lung cancer (Nngm)</article-title>. <source>Ann Oncol</source> (<year>2022</year>) <volume>33</volume>(<issue>6</issue>):<page-range>602&#x2013;15</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.annonc.2022.02.225</pub-id>
</citation>
</ref>
<ref id="B36">
<label>36</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname> <given-names>S</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X</given-names>
</name>
<name>
<surname>Du</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Fan</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>Lorlatinib for previously treated alk-positive advanced non-small cell lung cancer: primary efficacy and safety from a phase 2 study in China</article-title>. <source>J Thorac Oncol</source> (<year>2022</year>) <volume>17</volume>(<issue>6</issue>):<page-range>816&#x2013;26</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jtho.2022.02.014</pub-id>
</citation>
</ref>
<ref id="B37">
<label>37</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fukui</surname> <given-names>T</given-names>
</name>
<name>
<surname>Tachihara</surname> <given-names>M</given-names>
</name>
<name>
<surname>Nagano</surname> <given-names>T</given-names>
</name>
<name>
<surname>Kobayashi</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>Review of therapeutic strategies for anaplastic lymphoma kinase-rearranged non-small cell lung cancer</article-title>. <source>Cancers (Basel)</source> (<year>2022</year>) <volume>14</volume>(<issue>5</issue>):<fpage>1184</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/cancers14051184</pub-id>
</citation>
</ref>
<ref id="B38">
<label>38</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chabanon</surname> <given-names>RM</given-names>
</name>
</person-group>. <article-title>Postel-vinay s. a novel synthetic lethal approach to target myc-driven cancers</article-title>. <source>Cancer Res</source> (<year>2022</year>) <volume>82</volume>(<issue>6</issue>):<page-range>969&#x2013;71</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1158/0008-5472.Can-22-0302</pub-id>
</citation>
</ref>
<ref id="B39">
<label>39</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marqu&#xe9;s</surname> <given-names>M</given-names>
</name>
<name>
<surname>Sorolla</surname> <given-names>MA</given-names>
</name>
<name>
<surname>Urdanibia</surname> <given-names>I</given-names>
</name>
<name>
<surname>Parisi</surname> <given-names>E</given-names>
</name>
<name>
<surname>Hidalgo</surname> <given-names>I</given-names>
</name>
<name>
<surname>Morales</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Are transcription factors plausible oncotargets for triple negative breast cancers</article-title>? <source>Cancers (Basel)</source> (<year>2022</year>) <volume>14</volume>(<issue>5</issue>):<fpage>1101</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/cancers14051101</pub-id>
</citation>
</ref>
<ref id="B40">
<label>40</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Awasthi</surname> <given-names>N</given-names>
</name>
<name>
<surname>Liongue</surname> <given-names>C</given-names>
</name>
<name>
<surname>Ward</surname> <given-names>AC</given-names>
</name>
</person-group>. <article-title>Stat proteins: a kaleidoscope of canonical and non-canonical functions in immunity and cancer</article-title>. <source>J Hematol Oncol</source> (<year>2021</year>) <volume>14</volume>(<issue>1</issue>):<fpage>198</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s13045-021-01214-y</pub-id>
</citation>
</ref>
<ref id="B41">
<label>41</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>X</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>J</given-names>
</name>
<name>
<surname>Canfr&#xe1;n-Duque</surname> <given-names>A</given-names>
</name>
<name>
<surname>Aryal</surname> <given-names>B</given-names>
</name>
<name>
<surname>Tellides</surname> <given-names>G</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>YJ</given-names>
</name>
<etal/>
</person-group>. <article-title>Deficiency of histone lysine methyltransferase Setdb2 in hematopoietic cells promotes vascular inflammation and accelerates atherosclerosis</article-title>. <source>JCI Insight</source> (<year>2021</year>) <volume>6</volume>(<issue>12</issue>):<elocation-id>e147984</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1172/jci.insight.147984</pub-id>
</citation>
</ref>
<ref id="B42">
<label>42</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Long</surname> <given-names>R</given-names>
</name>
<name>
<surname>Han</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>The role of exosomes in the tumour microenvironment on macrophage polarisation</article-title>. <source>Biochim Biophys Acta Rev Cancer</source> (<year>2022</year>) <volume>1877</volume>(<issue>6</issue>):<elocation-id>188811</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbcan.2022.188811</pub-id>
</citation>
</ref>
<ref id="B43">
<label>43</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pufall</surname> <given-names>MA</given-names>
</name>
</person-group>. <article-title>Glucocorticoids and cancer</article-title>. <source>Adv Exp Med Biol</source> (<year>2015</year>) <volume>872</volume>:<page-range>315&#x2013;33</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-1-4939-2895-8_14</pub-id>
</citation>
</ref>
<ref id="B44">
<label>44</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roqueta-Rivera</surname> <given-names>M</given-names>
</name>
<name>
<surname>Esquejo</surname> <given-names>RM</given-names>
</name>
<name>
<surname>Phelan</surname> <given-names>PE</given-names>
</name>
<name>
<surname>Sandor</surname> <given-names>K</given-names>
</name>
<name>
<surname>Daniel</surname> <given-names>B</given-names>
</name>
<name>
<surname>Foufelle</surname> <given-names>F</given-names>
</name>
<etal/>
</person-group>. <article-title>Setdb2 links glucocorticoid to lipid metabolism through Insig2a regulation</article-title>. <source>Cell Metab</source> (<year>2016</year>) <volume>24</volume>(<issue>3</issue>):<page-range>474&#x2013;84</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.cmet.2016.07.025</pub-id>
</citation>
</ref>
<ref id="B45">
<label>45</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tu</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Fang</surname> <given-names>P</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>L</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>K</given-names>
</name>
</person-group>. <article-title>Analysis of the effect of snai family in breast cancer and immune cell</article-title>. <source>Front Cell Dev Biol</source> (<year>2022</year>) <volume>10</volume>:<elocation-id>906885</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fcell.2022.906885</pub-id>
</citation>
</ref>
<ref id="B46">
<label>46</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>da Silveira</surname> <given-names>WA</given-names>
</name>
<name>
<surname>Palma</surname> <given-names>PVB</given-names>
</name>
<name>
<surname>Sicchieri</surname> <given-names>RD</given-names>
</name>
<name>
<surname>Villacis</surname> <given-names>RARA</given-names>
</name>
<name>
<surname>Mandarano</surname> <given-names>LRM</given-names>
</name>
<name>
<surname>Oliveira</surname> <given-names>TMG</given-names>
</name>
<etal/>
</person-group>. <article-title>Transcription factor networks derived from breast cancer stem cells control the immune response in the basal subtype</article-title>. <source>Sci Rep</source> (<year>2017</year>) <volume>7</volume>(<issue>1</issue>):<fpage>2851</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-017-02761-6</pub-id>
</citation>
</ref>
<ref id="B47">
<label>47</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>D</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>C</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>S</given-names>
</name>
<etal/>
</person-group>. <article-title>Genome-wide association and functional studies identify Scml4 and Thsd7a as novel susceptibility genes for coronary artery disease</article-title>. <source>Arterioscler Thromb Vasc Biol</source> (<year>2018</year>) <volume>38</volume>(<issue>4</issue>):<page-range>964&#x2013;75</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1161/atvbaha.117.310594</pub-id>
</citation>
</ref>
<ref id="B48">
<label>48</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ullah</surname> <given-names>R</given-names>
</name>
<name>
<surname>Yin</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Snell</surname> <given-names>AH</given-names>
</name>
<name>
<surname>Wan</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Raf-Mek-Erk pathway in cancer evolution and treatment</article-title>. <source>Semin Cancer Biol</source> (<year>2022</year>) <volume>85</volume>:<page-range>123&#x2013;54</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.semcancer.2021.05.010</pub-id>
</citation>
</ref>
<ref id="B49">
<label>49</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xiang</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>W</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>N</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>K</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>Y</given-names>
</name>
<etal/>
</person-group>. <article-title>A novel human zinc finger protein Znf540 interacts with mvp and inhibits transcriptional activities of the erk signal pathway</article-title>. <source>Biochem Biophys Res Commun</source> (<year>2006</year>) <volume>347</volume>(<issue>1</issue>):<page-range>288&#x2013;96</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbrc.2006.06.076</pub-id>
</citation>
</ref>
<ref id="B50">
<label>50</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arai</surname> <given-names>E</given-names>
</name>
<name>
<surname>Chiku</surname> <given-names>S</given-names>
</name>
<name>
<surname>Mori</surname> <given-names>T</given-names>
</name>
<name>
<surname>Gotoh</surname> <given-names>M</given-names>
</name>
<name>
<surname>Nakagawa</surname> <given-names>T</given-names>
</name>
<name>
<surname>Fujimoto</surname> <given-names>H</given-names>
</name>
<etal/>
</person-group>. <article-title>Single-Cpg-Resolution methylome analysis identifies clinicopathologically aggressive cpg island methylator phenotype clear cell renal cell carcinomas</article-title>. <source>Carcinogenesis</source> (<year>2012</year>) <volume>33</volume>(<issue>8</issue>):<page-range>1487&#x2013;93</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/carcin/bgs177</pub-id>
</citation>
</ref>
<ref id="B51">
<label>51</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tian</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Arai</surname> <given-names>E</given-names>
</name>
<name>
<surname>Gotoh</surname> <given-names>M</given-names>
</name>
<name>
<surname>Komiyama</surname> <given-names>M</given-names>
</name>
<name>
<surname>Fujimoto</surname> <given-names>H</given-names>
</name>
<name>
<surname>Kanai</surname> <given-names>Y</given-names>
</name>
</person-group>. <article-title>Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of cpg island methylator phenotype marker genes</article-title>. <source>BMC Cancer</source> (<year>2014</year>) <volume>14</volume>:<fpage>772</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2407-14-772</pub-id>
</citation>
</ref>
<ref id="B52">
<label>52</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qi</surname> <given-names>T</given-names>
</name>
<name>
<surname>Qu</surname> <given-names>Q</given-names>
</name>
<name>
<surname>Li</surname> <given-names>G</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>H</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Z</given-names>
</name>
<etal/>
</person-group>. <article-title>Function and regulation of the Pea3 subfamily of ets transcription factors in cancer</article-title>. <source>Am J Cancer Res</source> (<year>2020</year>) <volume>10</volume>(<issue>10</issue>):<page-range>3083&#x2013;105</page-range>.</citation>
</ref>
<ref id="B53">
<label>53</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khatiwada</surname> <given-names>P</given-names>
</name>
<name>
<surname>Kannan</surname> <given-names>A</given-names>
</name>
<name>
<surname>Malla</surname> <given-names>M</given-names>
</name>
<name>
<surname>Dreier</surname> <given-names>M</given-names>
</name>
<name>
<surname>Shemshedini</surname> <given-names>L</given-names>
</name>
</person-group>. <article-title>Androgen up-regulation of Twist1 gene expression is mediated by Etv1</article-title>. <source>PeerJ</source> (<year>2020</year>) <volume>8</volume>:<fpage>e8921</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.7717/peerj.8921</pub-id>
</citation>
</ref>
<ref id="B54">
<label>54</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dowdy</surname> <given-names>SC</given-names>
</name>
<name>
<surname>Mariani</surname> <given-names>A</given-names>
</name>
<name>
<surname>Janknecht</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>Her2/Neu- and Tak1-mediated up-regulation of the transforming growth factor beta inhibitor Smad7 <italic>Via</italic> the ets protein Er81</article-title>. <source>J Biol Chem</source> (<year>2003</year>) <volume>278</volume>(<issue>45</issue>):<page-range>44377&#x2013;84</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/jbc.M307202200</pub-id>
</citation>
</ref>
<ref id="B55">
<label>55</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shin</surname> <given-names>S</given-names>
</name>
<name>
<surname>Bosc</surname> <given-names>DG</given-names>
</name>
<name>
<surname>Ingle</surname> <given-names>JN</given-names>
</name>
<name>
<surname>Spelsberg</surname> <given-names>TC</given-names>
</name>
<name>
<surname>Janknecht</surname> <given-names>R</given-names>
</name>
</person-group>. <article-title>Rcl is a novel Etv1/Er81 target gene upregulated in breast tumors</article-title>. <source>J Cell Biochem</source> (<year>2008</year>) <volume>105</volume>(<issue>3</issue>):<page-range>866&#x2013;74</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/jcb.21884</pub-id>
</citation>
</ref>
<ref id="B56">
<label>56</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Togashi</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Shitara</surname> <given-names>K</given-names>
</name>
<name>
<surname>Nishikawa</surname> <given-names>H</given-names>
</name>
</person-group>. <article-title>Regulatory T cells in cancer immunosuppression - implications for anticancer therapy</article-title>. <source>Nat Rev Clin Oncol</source> (<year>2019</year>) <volume>16</volume>(<issue>6</issue>):<page-range>356&#x2013;71</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41571-019-0175-7</pub-id>
</citation>
</ref>
<ref id="B57">
<label>57</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leng</surname> <given-names>F</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>W</given-names>
</name>
<name>
<surname>Ramirez</surname> <given-names>RN</given-names>
</name>
<name>
<surname>Leon</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhong</surname> <given-names>Y</given-names>
</name>
<name>
<surname>Hou</surname> <given-names>L</given-names>
</name>
<etal/>
</person-group>. <article-title>The transcription factor Foxp3 can fold into two dimerization states with divergent implications for regulatory T cell function and immune homeostasis</article-title>. <source>Immunity</source> (<year>2022</year>) <volume>55</volume>(<issue>8</issue>):<fpage>1354</fpage>&#x2013;<lpage>69.e8</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.immuni.2022.07.002</pub-id>
</citation>
</ref>
<ref id="B58">
<label>58</label>
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname> <given-names>Z</given-names>
</name>
<name>
<surname>Song</surname> <given-names>J</given-names>
</name>
<name>
<surname>Hao</surname> <given-names>J</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>H</given-names>
</name>
<name>
<surname>Du</surname> <given-names>X</given-names>
</name>
<name>
<surname>Li</surname> <given-names>E</given-names>
</name>
<etal/>
</person-group>. <article-title>M2 macrophages promote nsclc metastasis by upregulating cryab</article-title>. <source>Cell Death Dis</source> (<year>2019</year>) <volume>10</volume>(<issue>6</issue>):<fpage>377</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41419-019-1618-x</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>