The TNBC cell lines MDA-MB-231 (RRID: CVCL_0062) and Hs 578T (RRID: CVCL_0332) were purchased from ATCC (https://www.atcc.org/). Cells were cultured in DMEM (Lonza) growth medium supplemented with 10% of FBS (Biowest), 1% Penicillin-Streptomycin (Thermo Fisher Scientific) and 0.5% Amphotericin B (Thermo Fisher Scientific). All the cultures were carried out at 37°C in a 5% CO₂ atmosphere. Cell line authentication was performed by STR profiling, and mycoplasma testing was performed regularly. To perform OGG1 inhibition, cells were released into a fresh medium containing the OGG1 inhibitor TH5487 (22). PARP inhibition was carried out incubating cells with olaparib (Axon Medchem). Stock solutions of TH5487 and olaparib were made in 100% Dimethyl sulfoxide (DMSO, Sigma-Aldrich) and working solutions were prepared in complete cell culture medium. Incubation periods and concentrations used of both inhibitors in the different studies are indicated in the corresponding figures. Complete cell culture medium with the same concentration of DMSO but without the tested inhibitor/s was used as control in treatments with TH5487 and/or olaparib.

Similar treatments were performed with the OGG1 inhibitor SUO268 and PARP inhibitor Niraparib (Selleck Chemical LLC) for validation of the results. All experiments were performed with mycoplasma-free cells. Cell lines have been authenticated using STR profiling.

sgRNAs were designed using the Benchling CRISPR sgRNA Design tool (http://www.benchling.com). Specifics sgRNA were tested against the BRCA1 gene (exon 11) and also a non-targeting control (NT) was used (sgBRCA1: GCTCATTACAGCATGAGAAC and sgNT: CCGCGCCGTTAGGGAACGAG). Those sequences were cloned into the lentiCRISPRv2 vector (plasmid #52961, Addgene) and verified by Sanger sequencing (primers listed in Supplementary Table S1 ). Viruses were produced by transient plasmid transfection into HEK293T cells by the calcium phosphate method, as previously described (27). Briefly, cells were seeded at 1.1 × 10⁷ cells/dish in 15-cm dishes the day before transfection. Cells were transfected using second-generation packaging plasmids (psPAX2 and pMD.2G, #12260 and #12259, respectively, Addgene) and the appropriate transfer plasmid (pLV CRISPR sgBRCA1 or sgNT). The medium was collected after 48 h, cleared by low-speed centrifugation, and filtered through 0.45 μm-pore-size PVDF filters (Millipore). Viral titers were calculated and values range around 107 to 108 TU/ml. In order to carry out transductions, cells were split and 24 h later were transduced using an MOI of 5 to ensure a high rate of transduced cells. Cells were incubated at 37°C for 12 hours. After that viral supernatant was replaced with a fresh cell medium.

BRCA1 knockout cells were generated using the MDA-MB-231 and Hs 578T TNBC cell lines. Several single colony clones were established, some of which displayed reduced BRCA1 mRNA expression. Then, these clones were selected for Western blotting validation. BRCA1 knockout clones were validated by Sanger sequencing of the targeted region, followed by analysis using Tracking of Indels by Decomposition (TIDE) (https://tide.nki.nl), confirming BRCA1 gene disruption ( Figure 1A ).

DNA and RNA were extracted from cultured cells using the DNeasy^® Blood & Tissue Kit (Qiagen) or TRIzol^® Reagent (Thermo Fisher Scientific), respectively. In both cases, according to the manufacturer´s instructions. Subsequently, extracted DNA was quantified by the PicoGreen^® fluorometric assay (Thermo Fisher Scientific). RNA quantity and quality were assessed by NanoDrop^® (Thermo Fisher Scientific).

The High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) was utilized for cDNA synthesis following the manufacturer’s instructions using 1000 ng of total RNA. Two μL of cDNA at a final concentration of 10 ng/μL was mixed with 1 x GoTaq^® qPCR MasterMix (Promega) and 1 μM cDNA primers of each pair of primers (F/R) in a final volume reaction of 10 μL. Primers used are listed in Supplementary Table S1 . The amplification conditions consisted of an initial step at 95°C for 10 min, followed by 40 cycles of 10 s at 95°C and 1 min at 65°C. Each qPCR was performed in triplicate including no-template controls in an ABI QuantStudio S6 Flex System (Applied Biosystems). Relative genes mRNA expression was calculated using the 2ΔΔCt method for qPCR analysis after normalization with the housekeeping gene GAPDH using the QuantStudioTM Real-Time PCR Software (Applied Biosystems).

Protein expression was determined by Western blotting. Briefly, cell pellets of cultured cells were lysed in RIPA buffer (Sigma) in the presence of Complete Protease Inhibitor Cocktail (Roche). Total protein concentration was determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) following the manufacturer’s instructions. Sixty micrograms of protein were electrophoresed on 12% SDS/PAGE and transferred to Immobilon-FL membranes (Millipore). Membranes were blocked in TBS-T (50 mM Tris-HCl, 150 mM NaCl, pH 7.5 plus 0.1% Tween-20) and 5% non-fat milk for 1 h at room temperature. Blots were probed over-night at 4 °C with the following primary antibodies: rabbit anti-BRCA1 (sc-6954; Santa Cruz) at 1/200 dilution and mouse anti-β-Actin (A5441; Sigma) at 1/10,000 dilution in blocking solution. Anti-mouse and anti-rabbit IgG-HRP (Dako) were used as the secondary antibodies at 1/10,000 dilution in blocking solution 1 h at room temperature. Immunoblots were developed using Immobilon Classico Western HRP substrate (Millipore). Each western blot was performed at least in duplicate. Images were analyzed using ImageJ software (NIH Image) and BRCA1 protein levels were normalized by β-Actin.

Cells (sgNT or KO clones) were seeded at a density of 350 cells/well in 6-well plates. Twenty-four hours after seeding, the medium was replaced and cells were treated with PARP inhibitor olaparib and/or OGG1 inhibitor TH5487 and were incubated until colony size surpassed a minimum of 50 cells (≈12-14 days). The different concentrations used for both inhibitors are indicated in the corresponding figures ( Figures 2B, D and Supplementary Figures 1B, D ). Complete growth medium with the same concentration of DMSO as the one used in the highest concentration for each inhibitor but without the tested inhibitor/s was used as control. Finally, cells were washed twice with PBS, fixed with ice-cold methanol (Sigma) for 10 min, and stained with 1% crystal violet solution (Sigma) for 20 min, followed by extensive washes in tap water and air drying. The plates were scanned and the number of colonies per well was measured with ImageJ software (NIH Image).

The effect of PARP and OGG1 inhibition on cell viability was assessed in the TNBC cell lines using the MTT colorimetric assay. Cells were seeded in 96-well plates at a density of 2,500 cells per well and, after 8 h, treated with olaparib, TH5487, niraparib, SUO268 or a combination of drugs at different concentrations for 72 h. The different concentrations used for both inhibitors are indicated in the corresponding figures ( Figures 2A, C and Supplementary Figures 1A, C , 2 ). Six replicates for each concentration were used, with a 1% DMSO final concentration, in at least two independent plates. MTT (Sigma-Aldrich) dissolved in PBS was added to a final concentration of 1 g/l and incubated 4 h at 37 °C. Afterwards, the medium was removed and 50 μL of 100% DMSO were transferred into each well to dissolve the formazan crystals. Compounds were added to the plates using the Biomeck NPX Laboratory Automation Workstation (Beckman Coulter). Absorbance at 544 nm was read on a spectrophotometer (VICTOR Multilabel Plate Reader; PerkinElmer). The data were normalized to a mean absorbance detected in wells containing media without cells, and the results were expressed as a percentage (%) of the control (DMSO-treated cells). Curves were fitted using GraphPad Prism 8 (GraphPad Software Inc) and half-maximal inhibitory concentration (IC₅₀) values were determined.

Combination effect between drugs was evaluated by calculating the combination index (CI) based on the Bliss Independence model (28) whereby the CI was calculated with the following equation: CI=Ea+Eb-Ea*Eb/Eab, where Ea indicates the viability effect of drug A, Eb indicates the viability effect of drug B and Eab indicates the viability effect of the drug combination. CI < 1 indicates synergism, CI = 1 indicates additivity and CI > 1 indicates antagonism.

γH2AX mean signal intensity in the TNBC cell lines was measured as a marker of DNA damage. Cells were seeded in uCLEAR bottom 96‐well plates (Greiner Bio‐One) at a density of 2,500 cells per well and, after 8 h, treated with olaparib, TH5487, or a combination of drugs at different concentrations for 72 h, followed by the following immunofluorescence protocol. Cells were fixed with 4% paraformaldehyde (PFA, Agar Scientific) for 10 min. After washing with PBS (Sigma), cell permeabilization was performed with 0.5% Triton X-100 in PBS for 15 min. Blocking with 3% BSA (Sigma) in PBS for 1 h was followed by staining with primary (overnight) and secondary antibodies (1 h) and 0.5 μg/ml 4′,6-Diamidino-2-Phenylindole (DAPI; Sigma) to visualize nuclei. After each staining, a washing step was performed three times (10 min in PBS each). All steps were performed at room temperature. Antibodies used were primary rabbit anti-phospho-histone H2AX (#9718, Cell Signalling) and secondary anti-rabbit Alexa 555 (TermoFisher Scientific). Images were automatically acquired from each well using an Opera High‐Content Screening System (Perkin Elmer). Images were segmented based on the DAPI staining to generate masks matching cell nuclei, from which mean signal intensities were calculated. We considered γH2AX positive cells those with a pan-nuclear γH2AX signal intensity higher than an arbitrarily chosen threshold of 500 arbitrary units.

The Kolmogorov-Smirnov test was used to evaluate if the data sets were normally distributed. For comparative analyses between two groups of data, statistically significant differences were assessed by Student´s unpaired t-test for normally distributed variables and the Mann-Whitney U test for non-normal data distribution. For comparative analyses between three or more groups, statistically differences were analyzed with the one-way analysis of variance (ANOVA) test. Statistical calculations and graphs were done using GraphPad Prism 8 (GraphPad Software Inc). In all analyses, a 2-tailed p-value <0.05 was considered statistically significant: *P<0.05; **P<0.01; ***P<0.001 and ****P<0.0001.

TNBC cell lines MDA-MB-231 and Hs 578T were selected for this study, first because this phenotype is frequently associated to the lack of BRCA1, and we thought that they could best represent a BRCA1-deficiency context, and secondly because TNBC is the most aggressive subtype and presents limited choices of therapy (29, 30). We used CRISPR/Cas9 to silence the BRCA1 gene in these cell lines and BRCA1 knockout (KO) single colony clones were generated. Gene disruption in the selected clones was confirmed by DNA sequencing ( Figure 1A ). Additionally, the quantitative RT-PCR analysis showed a significantly lower BRCA1 mRNA expression in BRCA1-KO clones compared to non-targeting control cells ( Figure 1B ), and Western blotting confirmed BRCA1 protein loss ( Figure 1C ).

Firstly, in order to validate the synthetic lethal interaction between BRCA1 and PARP1 (3) we treated BRCA1-proficient (sgNT) and BRCA1-KO clones with the PARP inhibitor olaparib and analysed differences in cell proliferation and the clonogenic potential. As expected, BRCA1 knockout markedly increased sensitivity to olaparib. In both cell lines, BRCA1-KO clones showed a decrease in cell proliferation ( Figure 2A and Supplementary Figure 1A ) and a significantly relative lower number of colonies compared to BRCA1-proficient cells ( Figure 2B and Supplementary Figure 1B ) in the full range of olaparib concentrations tested. These results confirm that PARP inhibition causes a selective loss of viability in BRCA1-deficient TNBC cells.

As is the case of PARPi, we decided to evaluate whether BRCA1 knockout sensitizes TNBC cells to OGG1 inhibition. To this end, we incubated the TNBC BRCA1-proficient and their derived BRCA1-KO clones with a dilution series of the OGG1 inhibitor TH5487 (22) up to 72 h to analyse differences regarding cell proliferation. BRCA1-KO clones displayed slower proliferation for up to 72 h and present substantially lower IC₅₀ values for TH5487 than control cells ( Figure 2C and Supplementary Figure 1C ). In parallel, we also found that TH5487 decreased significantly clonogenic potential in BRCA1 knockout clones compared to BRCA1-proficient cells ( Figure 2D and Supplementary Figure 1D ). Overall, these data show that BRCA1 knockout increases sensitivity to OGG1 inhibition, supporting that a synthetic lethal interaction might exist between BRCA1 and OGG1. We further validated these findings by treating one of the KO clones of Hs 578T (BRCA1ko2) with another OGG1 inhibitor, SUO268, for which we obtained a IC50 of 6.64µM in the KO compared to 11.29µM in the BRCA1-proficient cell in the cell viability assays ( Supplementary Figure S2 ). This confirms that the synthetic lethal interaction between BRCA1 and OGG1 inhibition is not an off-target effect.

Considering the two synthetic lethal interactions found between BRCA1 and the BER members OGG1 and PARP1, we decided to analyse the possible interaction between the inhibitors of these two BER enzymes in the context of BRCA1 deficiency. To test this, we selected sublethal concentrations of olaparib (0.5 µM and 30 nM in MTT and colony formation assays, respectively) and TH5487 (3.75 µM and 3 µM in MTT and colony formation assays, respectively), which caused a significantly higher impact on the BRCA1-KO clones than BRCA1-proficient TNBC cells, and evaluated their effect on cell proliferation and clonogenic potential. According to the previous experiments, single treatments with both inhibitors at the chosen concentrations induced a significantly higher decrease in proliferation and clonogenic potential in the BRCA1-KO clones ( Figures 3A, B , and Supplementary Figures S1E, F ). Interestingly, the combination of both inhibitors significantly decreased cell proliferation by a greater extent than each of the treatments alone in BRCA1-depleted clones, while in BRCA1-proficient cells, TH5487 did not enhance the effect of the olaparib treatment alone ( Figure 3A and Supplementary Figure S1E ). Furthermore, the combined treatment with these two inhibitors notably diminishes the number of colonies compared to single-drug treatments in BRCA1-KO clones but not in the control cells ( Figure 3B and Supplementary Figure S1F ). A formal analysis of the interaction was performed by calculating the combination index (CI) based on Bliss model showing an additive effect between the drugs in both cell lines for the viability assays, which reached values of synergy for the clonogenic survival analysis ( Supplementary Table 2 ) in the BRCA1-deficient context. These results support that the OGG1 inhibitor TH5487 increases the sensitivity to PARP1 inhibition especially in BRCA1-depleted TNBC cells. When combining the alternative PARP and OGG1 inhibitors Niraparib and SUO268, a synergic effect was seen in both the parental and BRCA1-KO cell lines. This probably reflects the off target effect of kinase inhibition recently described to be caused by niraparib (31), while being olaparib much more specific to inhibit PARP, the effect would only be seen in a BRCA1-deficient context ( Supplementary Table 2 ).

Finally, we aimed to gain a better understanding of the molecular mechanisms behind the putative synthetic lethal interaction found between OGG1 and BRCA1. We hypothesized that the inhibition of OGG1 could promote the accumulation of oxidative DNA lesions that may progress to SSB and, similarly to PARP inhibition (3), triggering genomic instability with lethal consequences in BRCA1-deficient cells. To analyse this premise, we assessed by high-throughput microscopy the pan-nuclear phosphorylated H2AX (γH2AX) staining as a commonly used indicator of DSBs (32) and replication stress (33), in TNBC BRCA1-proficient cells and their derived BRCA1-KO clones. Under basal conditions, BRCA1-KO clones showed a significantly higher level of mean γH2AX signal intensity as well as a higher percentage of γH2AX positive cancer cells ( Figures 3C, D , and Supplementary Figure S1G ). Next, we incubated the cells with the already determined sublethal concentrations of olaparib and TH5487 for 72 hours. Interestingly, olaparib and TH5487 combined treatment increases the mean γH2AX signal intensity in both BRCA1-proficient and deficient cells, but the level of DNA damage was significantly more elevated in BRCA1-KO clones ( Figures 3C, D , and Supplementary Figure S1G ). This suggests that OGG1 inhibition, just like PARP1 inhibition, can lead to DSBs generation, especially in the context of BRCA1 deficiency. Finally, we assessed the molecular consequences caused by the synergistic interaction between olaparib and TH5487. The combined treatment generates higher γH2AX signal intensity values than single-drug treatments both in BRCA1-proficient and deficient cells, indicating that OGG1 inhibition intensifies the accumulation of DNA damage caused by the treatment with olaparib ( Figures 3C, D , and Supplementary Figure S1G ). Furthermore, the effect on DNA damage attributed to the combined treatment was significantly more pronounced in BRCA1-deficient clones. These results indicate that the impact on cell viability of PARP inhibition enhanced by TH5487 in BRCA1-deficient cells can be, at least, partially due to the accumulation of DNA damage resulting in selective cell death.