All experimental procedures were approved by the ethics committee of Xuzhou Central Hospital.

D-Hanks solution and PBS were obtained from Shanghai Genechem Technology Co., Ltd. (332 Edison Road, Zhangjiang Hi-Tech Park, Pudong New Area, Shanghai, China). Protein A/G PLUS-Agarose (Sc-2003) was purchased from Santa Cruz Bioengineering (Shanghai) Co., Ltd. Zhangjiang Hi-Tech Park, Pudong, Shanghai, China), and fetal bovine serum (FBS, VS500T) was purchased from Ausbia. Shanghai First Chemical Reagent Co., Ltd. (1317 Jianchuan Road, Minhang District, Shanghai, China). Dimethyl sulfoxide (DMSO, 130701), SDS, Tris, iodoacetamide, NH₄HCO₃, formic acid, acetonitrile, H₂O₂, Dulbecco’s minimum essential medium (DMEM, 10–013-CVR), paraformaldehyde, RPMI 1640 medium, streptomycin and penicillin. Pentobarbital sodium, dithiothreitol (DTT, 43819–5G), HCOONH₄ (17843) trifluoroacetate (TFA, T6508), propidium iodide (PI, P4170), and Giemsa staining solution (32884) were obtained from Sigma Company (Building C, 15–18, Front Beach World Trade Center, No. 3, Lane 227, Dongyu Road, Pudong New Area, Shanghai). Anti-GAPDH antibody, protein A/G PLUS-agarose, rabbit anti-human primary antibody (ERH, HPA002567), mouse anti-human primary antibody (EIF2α, L57A5, #2103), donkey anti-mouse IgG H&L (Alexa Fluor^® 488, ab150105) and goat anti-rabbit IgG H&L (DyLight^® 594, ab96885) secondary antibodies were purchased from Santa Cruz Biotechnology, Inc. (10410 Finnell Street, Dallas, Texas 75220, USA.). A BCA Protein Assay kit (P0010S) and RIPA lysis buffer (strong) (P0013B) were purchased from the Beyotime Institute of Biotechnology (No. 123, Rongle East Road, Songjiang District, Shanghai, China). Phosphotungstic acid (GZ02535), a prestained protein marker (00161543) and an ECL Plus Kit (M3121/1859022) were purchased from Thermo Fisher Scientific Co., Ltd. (Thermo Fisher Scientific, 168 Third Avenue, Waltham, MA, USA, 02451). X-ray film developer powder and fixing powder (P61–04–1) were obtained from the Shanghai Guanlong Photographic Material Factory (No. 221, Jinling East Road, Shanghai, China).

A stabilized power supply (EPS-300), SDS–PAGE protein electrophoresis instrument (VE-180) and the protein transfer equipment (VE-186) were purchased from Shanghai Tianneng Life Science Co., Ltd. (No. 10 Oasis Ring Road, Minhang District, Shanghai). A refrigerated high-speed centrifuge (Fresco 21) was provided by Thermo. An inverted fluorescence microscope (XDS-100, Shanghai Caikang Optical Instrument Co., Ltd.), a microplate reader (M2009PR, Tecan Infinite), a CO₂ incubator (SANYO, MCO-175), and a fluorescence microscope (IX71, Olympus) were used in this study.

Human T24 cells were purchased from Cell Resource Center, Shanghai Institutes for Biological Sciences, and Chinese Academy of Sciences. The cells were cultured in RPMI 1640 medium containing 10% FBS, streptomycin, and penicillin at 37°C in an incubator with 5% CO₂ (Sanyo, MCO-15A).

In this research, the ERH gene was used as a template to design overexpression primers and primers to amplify ERH gene fragments. The 5’ and 3’ end sequences of the amplified products were consistent with the end sequences of the linearized cloning vector. The recombinant product was transformed into cells and a single clone was PCR-identified to obtain high-purity fragment and used for viral packaging. The cloning site was set at the Age I/Nhe I, GV367 (purchased from Shanghai Genechem Co., Ltd.) was selected as the vector, and the sequence of elements was Ubi-MCS-SV40-EGFP-IRES-puromycin. The ERH gene amplification lentiviral vector was subsequently constructed.

The sequences of the ERH amplification primers were 3’-’ GAGGATCCCCGGGTACCGGCGCCACCATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAG-5’ and 3’-CACACATTCCACAGGCTAGCTTATTTCCCAGCCTGTTG GGCCTGC-5’. The two ERH primers used for PCR were 3’-GGGTCAATATGTAATTTTCAGTG-5’ and 3’-CGTCGCCGTCCAGCTCGACCAG-5’. We sequenced the clones and selected clones with the same sequencing results as the target for subsequent experiments.

We then used fluorescently labeled lentivirus with an overexpression vector to infect target cells and promote target gene expression in target cells.

For Western blot assays to analyze the overexpression of ERH proteins, cells were washed twice using cold PBS. The BCA approach was used to detect the protein concentration. Proteins (30–50 μg) were resolved by 10% Bis-Tris gradient SDS–PAGE under reducing conditions and transferred onto polyvinylidene fluoride (PVDF) membranes that were blocked with 5% skim milk for 1 hour. The membranes were sequentially incubated with primary antibodies (FLAG, Sigma) followed by an antibody against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) at room temperature for 2 hours. The membranes were then washed with TBST 4 times (8 min each) and incubated with fluorescein-linked secondary antibodies at room temperature for 1.5 hours. Then, the membranes were washed with TBST another 4 times (8 min each), and signals were detected using ECL and X-ray film.

For IP analysis, whole-cell extracts were prepared in NP-40 lysis buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 5 mM EDTA, 1% NP-40, 0.5% deoxycholate, 0.1% SDS), incubated with antibodies or IgG at 4°C for 2 hours, and then mixed with 100 μl protein A/G agarose overnight at 4°C. Recovered proteins associated with ERH or IgG were resolved by gel electrophoresis. The bands containing proteins that specifically bound to ERH were excised and added to 1 mL of 100 mM NH₄HCO₃/30% ACN to remove the color. The supernatant was removed and the samples were freeze-dried. Subsequently, 180 μL of 100 mM NH4HCO3 and 20 μL of 100 mM DTT was added, and the samples were incubated at 56°C for 30 min. The supernatant was removed, and 100 μL ACN was added. The μL ACN was aspirated after 5 min, and 140 μL 100 mM NH₄HCO₃ and 60 μL 200 mM IAA was added. The samples were then incubated in the dark for 20 min. The supernatant was removed, and 200 mM NH4HCO3 was added. The samples were subsequently incubated for 15 min. The supernatant was removed, and 100 μL ACN was added. The supernatant was removed after 5 min. The samples were then freeze-dried. Subsequently, 20 μL2.5~10 ng/μL Trypsin solution was added, and the samples were rehydrated in the refrigerator at 4°C for 30 min. Approximately 40 μL of 25 mM NH₄HCO₃ solution was added, and the samples were incubated at 37°C for 20 hours. The enzymolysis solution was then aspirated and transferred to a new EP tube, and 100 μL of 60% ACN/0.1% TFA was added to the original tube and subsequently ultrasonicated for 15 min. The solution was aspirated and added to the previous solution, freeze-dried and reconstituted in 0.1% TFA. A C18 cartridge was used to desalt the peptide. After freeze-drying the peptide, 10 μL 0.1% FA was used for the Q-Exactive test.

LC–MS/MS was performed using a Q-Exactive mass spectrometer coupled with an Easy nLC (Thermo Fisher Scientific, MA, USA). The peptide sample was first loaded onto a C18 reversed-phase analytical column (Thermo Scientific, Acclaim PepMap RSLC 50 µm x 15 cm, nano viper, P/N164943) in buffer A (0.1% formic acid in HPLC-grade water) and separated with a linear gradient of buffer B (80% acetonitrile and 0.1% formic acid) with a flow rate of 300 nL/min. A linear chromatographic gradient was achieved with a linear increase in buffer B percentage, which was set up as follows: 6% buffer B for 5 min, 6–28% buffer B for 40 min, 28–38% buffer B for 5 min, 38–100% buffer B for 5 min, and held in 100% buffer B for 5 min.

Subsequently, the peptide was transferred to the Q Exactive mass spectrometer (Thermo Fisher Scientific, MA, USA). The MS analysis was set for 60 min in the positive ion mode. MS data were acquired using a data-dependent top10 method dynamically choosing the most abundant precursor ions from the full scan (350–1800 m/z) for HCD fragmentation. Full scans were acquired at a resolution of 70000 at m/z 200 with an AGC target of 3e6 and a maxIT of 50 ms. MS2 scans were acquired at a resolution of 17500 for HCD spectra at m/z 200 with an AGC target of 2e5 and a maxIT of 45 ms. The scan range was 200–22000 m/z, and the isolation width was 2 m/z. Only ions with a charge state between 2–7 and a minimum intensity of 2e3 were selected for fragmentation. The dynamic exclusion for selected ions was 30 s. The microscan was 1. The normalized collision energy was 27 eV.

We used Proteome Discoverer 2.2 (Thermo Fisher Scientific) for protein identification in the raw data and the Mascot 2.6 app for the database search. The UniProt database (UniProt_HomoSapiens_20394_20210127) was used for the functional annotation and classification of identified proteins. The search parameters included peptides with a maximum of 2 missed cleavages, a precursor mass tolerance of 10 ppm, and 0.05 Da tolerance for MS2 fragments. The fixed modification was carbamidomethyl, and variable modifications were oxidation and acetylation. Proteins were considered positively identified if the peptide score of a specific peptide reached the significance threshold FDR = 0.01. The positive protein list of the ERH NC group was extracted from that of the ERH OE (overexpression) group to obtain a list of proteins that can interact with the ERH protein. In order to reduce the problem of interference, we performed a negative control experiment, and compared the ERH overexpression group with ERH normal group. Among the obtained binding proteins, we subtracted the binding protein list of the NC group from the binding protein list of the ERH-OE group, to exclude the non-specific binding proteins. Next, we conducted a series of comprehensive analyses on this list to identify the molecular biological role of ERH protein in human T24 cells. Finally, an ERH-IPL was obtained and bioinformatics analyses was performed.

In this study, various network bioinformatics analysis tools were used, such as GO and KEGG analysis, Metascape network, PPI-MCODE of Cytoscape, TCGA database, UALCAN, and GeneMINIA.

Immunofluorescence colocalization assay was used to explore the co-expression of ERH and the most important interacting protein in human T24 cells. Briefly, T24 cells were divided into ERH NC and ERH KD groups. A labeled rabbit anti-human EIF2α antibody was used, followed by red fluorescently labeled goat anti-rabbit IgG. ERH was labeled with mouse anti-human antibody and then localized with green fluorescently labeled donkey anti-mouse IgG. Nuclear staining was performed with DAPI staining. Cells at the logarithmic phase were used to prepare a 2 × 10⁴/ml single-cell suspension, seeded in a 96-well plate, and cultured in a carbon dioxide incubator for 1–3 days. The cells were fixed with 4% paraformaldehyde and rinsed with PBS. Then, 0.2% Triton was added, and the cells were rinsed with PBS for 30 min. The cells were incubated with primary and secondary antibodies, and fluorescence photography was performed with a fluorescence microscope.

Using the Discovery Studio 4.0 software, we analyzed the protein molecular structure of the two proteins and used the ZDOCK technology of the rigid protein docking algorithm based on the fast Fourier transform related technology to make a prediction. A simulated docking image of the two proteins was obtained along with docking scores and specific binding sites (hydrogen bonds). The fast Fourier transform correlation technique in the algorithm was used to search the translational and rotational spaces of the protein system, and these binding configurations were scored using an energy scoring function.

Statistical analyses were performed using SAS 9.43 (SAS Institute Inc., Cary, NC, USA). The statistical significance of differences in continuous data (mean ± SD) was estimated using Student’s t-test. For all the analyses, a p-value <0.05 indicated statistical difference (*), and a p-value <0.01 indicated a significantly statistical difference (**).

The ERH OE bladder cancer T24 cell line was established by lentiviral transfection. The transfection efficiency exceeded 70% (Figure 1A). The Western blot results showed that ERH expression was increased at the protein level in the ERH OE group compared to the control group, and the difference was significant (Figure 1B). To identify proteins that interact with ERH, we isolated ERH-interacting proteins using 3×FLAG-tagged ERH (Figure 1C). We obtained a list of 205 proteins that can directly or indirectly interact with ERH protein by mass spectrometry (Supplementary Table 1).

Referring to the Metascape website, we obtained the biological function enrichment results of GO (Table 1) and KEGG (Table 2) related to ERH-IPL which interacted with ERH protein in human T24 cells (Figure 2).

We analyzed the PPIs by Metascape and obtained a list of MCODEs. The main cluster of proteins interacting with ERH consisted of those with MCODEs related to “ribonucleoprotein complex”, “ATPase activity”, “nuclear speck”, and “translation factor activity, RNA binding”. The interactive data were visualized by Cytoscape software. A function of “MCODE” was used to find the tightest clusters. The criteria of MCODE to obtain the cluster were degree cutoff: 2, node score cutoff: 0.2, K-core: 2, max depth: 100. We obtained 7 clusters, and the top 5 are shown in Figure 3A. We analyzed the first and second clusters to rank the proteins by clustering coefficient (Figure 3B). With a review of previous literature and analysis of network resources, we finally identified 16 genes that may be the key genes related to the ERH gene in human T24 cells.

Using the UALCAN network TCGA database analysis tool, we obtained bladder urothelial carcinoma prognostic survival curves using the 15 key genes. The results showed that the expression levels of 12/15 of the key genes can predict the prognosis of bladder urothelial carcinoma (Figure 4A). We further analyzed the pathways and co-expression status of these 15 key genes using the GeneMINIA website (Figure 4B). As EIF2S1 is the key gene in the first cluster, we set EIF2S1 as the most important interactive protein and performed an immunofluorescence colocalization assay.

We identified EIF2α as an ERH-interacting protein by MS analysis. We tested the interaction between ERH and EIF2α by an IP assay and assessed the ability of 3×Flagged ERH and EIF2α to coimmunoprecipitate. The results showed that ERH and EIF2α were co-expressed and interacted in human T24 cells (Figure 5A).

As confirmed by immunofluorescence colocalization assay, ERH and EIF2α (the α-subunit of eukaryotic initiation factor 2) were co-expressed in some states of T24 cells (Figure 5B).

The fraction of docking with ERH protein with EIF2α protein is -88.969. There are 6 hydrogen bonds on the predicted bonding surface of the two proteins (Figure 5C).

qPCR analysis revealed that ATF4 and CHOP expression levels were increased in human T24 cells following ERH KD. The expression levels of ATF4 and CHOP in the ERH KD group were significantly increased compared to those in the ERH NC group (Figure 6).