Primary antibodies used in western blot analysis were: mouse anti-β-actin, mouse anti-α-tubulin, and mouse anti-α-smooth muscle actin (α-SMA), all from Sigma-Aldrich; goat polyclonal anti-CTGF and mouse anti-NHE1 (clone 54), anti-Poly-ADP Ribose Polymerase (PARP), anti-cleaved PARP (Asp214) and anti-pSer807/811-Rb, all from Santa Cruz Biotechnology; mouse anti-dynactin 1 (DCTN1) and mouse anti-E-cadherin, from BD Biosciences; rabbit anti-GAPDH, rabbit anti-Histone 3, rabbit anti-Merlin, mouse anti-p53, mouse anti-Ki67, and rabbit anti-β-catenin, all from Cell Signaling. Mouse anti- Ki-67 was from Dako (Glostrup, Denmark) and rabbit polyclonal anti-NBCn1 was a kind gift from Jeppe Prætorius, Aarhus University, Denmark. Secondary antibodies used in western blotting were horseradish-peroxidase-conjugated goat polyclonal anti-mouse or anti-rabbit and rabbit polyclonal anti-goat from Dako. Secondary antibodies for immunofluorescence analysis were AlexaFluor488-conjugated donkey anti-mouse or anti-rabbit, and AlexaFluor568-conjugted donkey anti-mouse or anti-rabbit, all from Invitrogen. Recombinant human TGFβ-1 (PHG9214) was from Life Technologies. Mouse monoclonal antibody against Proliferating cell nuclear antigen (PCNA) was from Cell Signaling Technology.

Human PDAC cell lines MIAPaCa-2, Panc-1, BxPC-3, and AsPC-1 were acquired from American Type Culture Collection (ATCC, Rockville, MD, USA) and maintained in RPMI medium 1640+GlutaMAX^TM-I or Dulbecco's Modified Eagle's medium (DMEM)+GlutaMAX^TM-I (both from Gibco) supplemented with 10% (v/v) fetal bovine serum and 100 U/ml penicillin and 100 μg/mL streptomycin at 37°C in a humidified atmosphere of 5% CO₂. MIAPaCa-2 cell medium was further supplemented with 2.5% (v/v) heat-inactivated horse serum. Immortalized human pancreatic ductal epithelial (HPDE H6c7) cells were a kind gift from Dr. Ming-Sound Tsao at Ontario Cancer Institute, Toronto, Canada (27, 28) and were cultured in kerantinocyte basal medium supplemented with epidermal growth factor and bovine pituitary extract.

siRNAs employed were: NHE1 siRNA: ON-TARGET SMART pool (Thermo Scientific); NBCn1 siRNA (SASI_Hs01_00030755, Sigma-Aldrich) sense sequence 5′-CAUUAACUGGGAUUGCCUA-3′, Merlin siRNA (SASI_Hs_01_00188862, Sigma) sense sequence 5′-CCUCAAAGCUUCGUGUUAA-3; SMAD4 (EHU018671 esiRNA siRNA mixture, Sigma). A 19-bp scrambled oligomer (sense: 5′-AGGUAGUGUAAUCGCCUUG-3′) (Eurofins MWG Operon, Ebersberg, Germany) was used for mock transfection. Cells were seeded to ~40% confluency in the relevant culture dishes and transfected with NHE1 siRNA (100 nM), NBCn1 siRNA (25 nM), Merlin siRNA (50 nM) or mock siRNA (50 nM), using Lipofectamine (Invitrogen) transfection reagent, according to the manufacturer's specifications. 48 h after transfection, cells were serum starved, and 24 h later, exposed to TGFβ treatment (or corresponding control conditions) for another 48 h before analysis for the relevant experiment as indicated below.

Total RNA was isolated using NucleoSpin® RNA II (Macherey-Nagel, Germany) according to the manufacturer's instructions, reverse-transcribed using Superscript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) and cDNA transcripts were amplified by qPCR using the SYBR Green technique (Applied Biosystems, Cheshire, UK). Amplification was performed in triplicate in an ABI7900 qPCR machine, using 40 cycles of (95°C for 30 s, 60°C for 1 min, 72°C for 30 s). Primer sequences were: NHE1-fw: 5′-CACACCACCATCAAATACTTCC-3′, NHE1-rv: 5′-GAACTTGTTGATGAACCAGGTC-3′; NHE2-fw: TTGGAGAGTCCCTGCTGAATGATG, NHE2-rv: tcagctgtgatgtaggacaaataactg, NBCn1-fw: 5′-GCAAGAAACATTCTGACCCTCA-3′, NBCn1-rv: 5′-GCTTCCACCACTTCCATTACzCT, NBCe2-fw: atcttcatggaccagcagatcac, NBCe2-rv: tgcttggctggcatcaggaag. mRNA expression was quantified using the comparative threshold cycle (Ct) method, using β-actin as reference gene (fw 5′- AGCGAGCATCCCCCAAAGTT-3′, rv 5′-GGGCACGAAGGCTCATCATT-3′), and is given relative to that in HPDE cells.

Cells were seeded to 60–70% confluency in 6-well culture dishes, lysed in lysis buffer [1% SDS, 10 mM Tris-pH 7.5, Na₃VO₄ 1 mM, and complete protease inhibitor cocktail (Roche)] and homogenized by sonication. SDS-PAGE was performed using Bio-Rad Criterion^TM TGX^TM precast 10% gels in Tris/Glycine buffer. Gels were run for 1 h at 150 V, followed by transfer to Trans-Blot® Turbo^TM 0.2 μm nitrocellulose membranes (Bio-Rad). Protein transfer was evaluated by Ponceau red staining, followed by blocking in 5% dry milk in TBST (0.01 M Tris/HCl, 0.15 M NaCl, 0.1% Tween 20) for 30 min at room temperature, incubation with primary antibodies overnight at 4°C, and finally washing in TBST and incubation with HRP-conjugated secondary antibodies for 2 h at room temperature. Blots were developed using the FUSION-Fx chemiluminescence system (Vilber Lourmat). Images were processed in Adobe Photoshop and band intensities were quantified using UN-SCAN-IT gel 6.1 software.

Cells were grown on glass coverslips in 6-well culture dishes, fixed in 4% paraformaldehyde for 15 min at room temperature, washed in icecold PBS, and permeabilized for 12 min in permeabilization buffer (0.2 % Triton X-100, 1% BSA in PBS). Unspecific fluorescence was blocked by a 30 min incubation in PBS plus 2% BSA, followed by incubation with primary antibody for 112 h at room temperature, three washes in 2% BSA blocking buffer, and incubation with secondary antibodies diluted in 2% BSA blocking buffer) for 45 min, washing in PBS containing 2% BSA, a 5 min incubation with (4',6-Diamidino-2-Phenylindole, Dihydrochloride) (DAPI) for nuclear staining, extensive washing in PBS and mounting in N-propyl-gallate mounting media (2% w/v in PBS/glycerin). Fluorescence images were captured on a fully motorized Olympus BX63 upright microscope with an Olympus DP72 color, 12.8-megapixel, 4.140 × 3.096-resolution camera and with a fully motorized and automated Olympus IX83 Inverted microscope with a Hamamatsu ORCA-Flash 4.0 camera (C11440-22CU). The software used was Olympus CellSens dimension, which is able to do deconvolution on captured z stacks, and images were processed for publication using Adobe Photoshop CS6.

Measurements of pH_i were carried out essentially as described previously (21). Briefly, cells seeded in WillCo glass-bottom dishes (WillCo Wells, Amsterdam, the Netherlands) were loaded with 2′,7′-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM, 1.6 μM) in growth medium for 30 min at 37°C. Cells were washed once in HCO3- containing Ringer solution [118 mM NaCl, 25 mM NaHCO₃, 5 mM KCl, 1 mM MgSO₄, 1 mM Na₂HPO₄, 1 mM CaCl₂, 3.3 mM 3-(N-morpholino)propanesulfonic acid (MOPS), 3.3 mM 2-[Tris(hydroxymethyl)-methylamino]-ethanesulfonic acid (TES), 5 mM HEPES, pH 7.4], placed in a 37°C imaging chamber equipped with gas and solute perfusion, at the stage of a Nikon Eclipse Ti microscope, and imaged using a 40X/1.4 NA objective and EasyRatioPro imaging software (PTI, NJ, USA). Emission was measured at 520 nm after excitation at 440 and 485 nm. Acidification was induced by exposure to 20 mM NH₄Cl for 10 min. Calibration to pH_i values was performed using the high K⁺/nigericin technique and a 4-point linear calibration curve.

Eighty percentage confluent Panc-1 and BxPC3 cells were trypsinized and resuspended in growth medium. Cells were seeded in 96-well plates (Celllstar®, cat # 655090). After 24 h incubation at 37°C/5% CO₂, plates were washed in PBS and 200 μl serum free medium was added. After 24 h, the cells were incubated with 10 ng/mL TGFβ, and/or 10 μM of the NHE1 inhibitor cariporide. Forty-eight hours later, a Cell Proliferation ELISA, BrdU (chemiluminescent) kit (Roche, cat # 11 669 915 001) was used for determining the proliferation status of the cells, according to the manufacturer's instructions. 20 μl BrdU labeling solution was added to each well and the plates were incubated for 4 h, followed by a fixation/denaturing step, and incubation with a peroxidase-coupled mouse monoclonal anti-BrdU antibody. The plates were washed extensively, incubated with substrate solution containing luminol, 4-iodophenol and peroxide for 4 min on a shaker, and luminescence measured using a BMG FLUOstar OPTIMA Microplate Reader.

Cell invasion was assessed using growth factor reduced corning® Matrigel® invasion chambers, 24-well plate and 8.0 μm pore size (Corning, BioCoat, MA, USA). Prior to the experiment, invasion chambers containing Matrigel were rehydrated by adding 500 μl serum free medium for 2 h at 37°C. Forty-eight hours after transfection with the indicated siRNAs, cells were serum starved, and 24 h later, treated or not with TGFβ for 48 h, before being washed with sterile PBS, trypsinized, washed 3 x in serum free medium, and 50,000 cells in this medium seeded into the upper chamber. Experiments were always done in duplicate. The lower chamber was filled with 10% serum containing medium. Chambers were incubated for 22 h at 37°C/5% CO₂ to allow cells to invade through the Matrigel. Non-invaded cells from the upper surface of the chamber were removed with a cotton swab. Invaded cells on the lower surface of the chamber were fixed for 30 min in ice-cold absolute methanol, and filters were stained with 30% Giemsa solution (Sigma-Aldrich) for 30 min and mounted on glass slides. Invaded cells (four images per filter per condition) were counted using bright-field microscopy.

Data are shown as individual representative experiments or as means of at least three independent experiments, with standard error of mean (SEM) error bars. Statistical significance was tested using Student t-test or one- or two-way ANOVA followed by Tukey's multiple comparison tests as appropriate, using GraphPad prism 6.

Our previous in silico analysis of RNA sequencing data from pancreatic cancer patient tissue indicated that a number of SLC9 and SLC4 family transporters are upregulated in PDAC patient tumor tissue compared to normal pancreatic epithelium (29). From these, we selected for widely expressed net acid extruders for initial analyses: two Na⁺/H⁺ exchangers, NHE1 and−2 (SLC9A1-2), and two Na⁺,HCO3- cotransporters (NBCs), NBCe2 (SLC4A5) and NBCn1 (SLC4A7). The relative mRNA levels of the transporters were determined by RT-qPCR analysis in immortalized pancreatic epithelial (HPDE) cells (27, 28), and in a panel of human PDAC cell lines of different genotypes: MIAPaCa-2, Panc-1, BxPC-3, and AsPC-1 cells. All PDAC cell lines studied exhibited increased mRNA levels of one or more of these transporters compared to HPDE cells, with the specific transporters upregulated differing between cell lines (Figures 1A,B). Thus, BxPC-3 and AsPC-1 cells showed elevated expression of NHE1 and−2, and MIAPaCa-2 cells predominantly showed upregulation of NBCn1 and NBCe2, while both NHE2 and NBCn1 were upregulated in Panc-1 cells. For further analyses, we focused on NHE1 and NBCn1, which play central roles in the development of PDAC and other cancers (21, 22, 24, 30–33). Consistent with the mRNA data, western blot analysis revealed that the NHE1 protein level was significantly increased in BxPC-3 cells and the NBCn1 protein level in MIAPaCa-2 and Panc-1 cells, compared to that observed in HPDE cells (Figures 1C,D).

These data show that net acid extruding proteins are upregulated in PDAC cells compared to normal pancreatic ductal epithelial cells, and that the specific pattern of upregulation is cell type dependent.

BxPC-3 and Panc-1 cells, which display a high levels of NHE1 and NBCn1 expression, respectively, were chosen for further analysis. We first assessed the ability of TGFβ ligand to induce EMT in the two cell lines. Cells were serum-starved for 24 h, followed by treatment with 10 ng/ml human recombinant TGFβ-1 for 48 h. After lysis, cells were subjected to western blot analysis for the epithelial marker E-cadherin as well as the mesenchymal markers α-smooth muscle actin (α-SMA) and connective tissue growth factor (CTGF) (Figure 2A). In Panc-1 cells, TGFβ-1 treatment significantly reduced the level of E-cadherin, and increased that of α-SMA and CTGF, consistent with induction of EMT (Figures 2A,B). In BxPC-3 cells, TGFβ-1 treatment elicited a small yet significant decrease in E-cadherin of about 25%, which was not accompanied by detectable changes in α-SMA and CTGF expression (Figures 2A,C). Immunofluorescence analysis was performed to assess the impact of TGFβ-1 treatment on cell morphology and protein localization in Panc-1 cells. TGFβ-1 treatment induced a marked internalization of both E-cadherin and β-catenin (arrows), a strong, predominantly membrane-associated increase in α-SMA, and increased intracellular CTGF expression (Figure 2D).

These data show that TGFβ-1 treatment elicited a marked EMT in Panc-1 cells, and a modest and partial EMT in BxPC-3 cells.

BxPC-3 cells are SMAD4-deficient (34), which has previously been shown to be responsible for their partial resistance to TGFβ-1-induced EMT (14), although the absolute requirement for SMAD4 for TGFβ-1-induced EMT is controversial (14, 35). To assess the role of SMAD4 in TGFβ-1-induced EMT in Panc-1 cells, we knocked down SMAD4 by siRNA in Panc-1 cells, followed by TGFβ-1 treatment for 48 h, and western blotting for E-cadherin and CTGF (Figures 2E–H). In mock-transfected cells, TGFβ-1 treatment almost doubled the level of SMAD4. Confirming efficient knockdown, the SMAD4 protein level was reduced by more than 80% in SMAD4 siRNA-treated cells (Figures 2E,F). Notably, the E-cadherin level was more than doubled by SMAD4 knockdown in the absence of TGFβ-1, and this was only marginally reduced by TGFβ-1-induced increase in CTGF expression was abolished in SMAD4-depleted cells (Figure 2G). Conversely, SMAD4 knockdown had no effect on the CTGF level under control conditions yet abolished the increase in CTGF induced by TGFβ-1 treatment (Figure 2H).

Collectively, these data show that TGFβ-1 induced EMT in Panc-1 cells is strongly dependent on SMAD4 and suggest that a basal level of SMAD4 signaling in the absence of TGFβ-1 treatment is responsible for the low basal E-cadherin level in these cells.

We next asked whether TGFβ-1 treatment altered NHE1 and NBCn1 expression in Panc-1 and BxPC-3 cells. The protein expression level of NHE1 increased by about 60%, and that of NBCn1 by about 40%, following TGFβ-1 treatment of Panc-1 cells (Figures 3A,B), and a similar, albeit non-significant trend was seen in BxPC-3 cells (Figures 3A,C). The mRNA level of NHE1 also tended to be upregulated by TGFβ-1 in Panc-1 cells, and that of NBCn1 in BxPC-3 cells (Figures 3C,D). The TGFβ-1-induced increase in NHE1 expression was strongly reduced by SMAD4 knockdown in Panc-1 cells (Figures 3E,F), whereas the modest increase in NBCn1 expression was not affected by SMAD4 knockdown (Figures 3E,G). This suggests that increased NHE1 expression is mainly mediated by canonical TGFβ signaling, whereas the effect of TGFβ-1 on NBCn1 expression appears to be mediated by non-canonical signaling events. Both transporters localize predominantly to the plasma membrane in both cell types. Interestingly, TGFβ-1 treatment caused a characteristic redistribution of NBCn1 to membrane ruffles in BxPC-3 cells (Figure 3I) whereas there was no detectable redistribution in Panc-1 cells (Figure 3H).

To determine whether NHE1 and NBCn1 played a role in the EMT process per se, we knocked down each transporter in Panc-1 cells and subjected the cells to 48 h of TGFβ-1 treatment as above, followed by western blotting for E-cadherin and CTGF. Although the protein level of both transporters was essentially abolished upon siRNA treatment, this did not detectably affect TGFβ-1–induced E-cadherin downregulation or CTGF upregulation (Supplementary Figure 1).

These results show that TGFβ-1 induced EMT is associated with increased expression of NHE1 and NBCn1 and increased localization of the transporters at the plasma membrane where they could increase net acid extrusion from the cells. However, neither transporter is required for induction of EMT per se.

To directly determine whether the changes in transporter expression upon TGFβ-1-induced EMT are associated with altered pH_i homeostasis, cells were subjected to TGFβ-1 treatment for 48 h, loaded with the pH_i sensitive fluorophore BCECF-AM, and steady state pHi determined by live imaging of BCECF fluorescence. Experiments were carried out in the presence of CO₂/HCO3- to allow contributions from bicarbonate-dependent transporters such as NBCn1. TGFβ-1 treatment significantly increased steady state pH_i in Panc-1 cells, from an average value of 7.06 ± 0.105 in control cells to 7.26 ± 0.043 after TGFβ-1 treatment (Figure 4A). In contrast, the steady state pH_i of BxPC-3 cells was 7.01 ± 0.062 in controls and 7.09 ± 0.066 after TGFβ-1 treatment, not significantly different (Figure 4B).

To evaluate whether cellular capacity for acid extrusion was increased by TGFβ-1 treatment, we next determined the pH_i recovery rate. Cells were pretreated with or without TGFβ-1 for 48 h as above, and subjected to an NH₄Cl-prepulse to acidify the cells: after equilibration in normal CO₂/HCO3- saline, cells were perfused with 15 mM NH₄Cl. Upon dissociation, NH₃ rapidly enters the cells by diffusion. Its association with cellular H⁺ to NH4+ causes near-instantaneous alkalinization, followed by slow return toward steady state pH_i as NH4+ from the solution enters the cells via ion transporters, shifting the equilibrium. When cells are again perfused with normal CO₂/HCO3- saline, all NH₃ rapidly diffuses out, and an excess of free H⁺ is left in the cells. The rate of recovery from this acidification is a measure of net acid extrusion capacity, determined as the slope of the initial, linear part of the curve under conditions where starting pH_i is similar (36). Experiments were again carried out in the presence of CO₂/HCO3-. Figures 4C,D shows representative traces of pH_i over time from the maximal acidification. As seen, TGFβ-1 treatment markedly increased the pH_i recovery rate in Panc-1 cells (Figure 4C) but not in BxPC-3 cells (Figure 4D). NHE1 and NBCn1 activity is posttranslationally regulated (37, 38), hence, their contributions to pH_i regulation are not predicted by their protein levels. Notably, in both Panc-1 and BxPC-3 cells, pH_i recovery in both control- and TGFβ-1 treated cells was abolished by the specific NHE1 inhibitor cariporide regardless of (Figures 4E,F).

Collectively, these results show that TGFβ-1-induced EMT in Panc-1 cells is associated with increased steady state pH_i and increased NHE1-dependent acid extrusion capacity.

Depending on the cell type and context, TGFβ signaling can counteract or stimulate cell proliferation, and this has been ascribed at least in part to SMAD2/3 signaling, which rely on SMAD4 (4, 6). We therefore assessed the impact of TGFβ-1 treatment on cell proliferation in Panc-1 and BxPC-3 cells. Cells treated for 48 h with or without TGFβ-1 were lysed and blotted for phosphorylated retinoblastoma protein (p-pRb) and proliferating cell nuclear antigen (PCNA) as markers of cell cycle entry and progression, respectively. Notably, TGFβ-1 treatment increased the p-pRb level in Panc-1 cells yet decreased it in BxPC-3 cells (Figures 5A,B), and similar results were obtained for PCNA (Figures 5A,C). This was confirmed by IFM analysis using Ki-67 as a proliferation marker: The fraction of Ki-67 positive cells was decreased in both cell types—although most dramatically in Panc-1 cells—by 48 h of serum starvation, and was increased in Panc-1 cells, yet decreased in BxPC-3 cells by TGFβ-1 (Figures 5D–F). Strikingly, TGFβ-1 treatment also increased p53 expression in Panc-1 cells, but not in BxPC-3 cells (Figure 5G). Co-staining for p53 and p-pRb confirmed these data and revealed that elevation of nuclear staining for p-pRb and p53 was detected within the same cells (Supplementary Figure 2). BrdU incorporation analysis confirmed that TGFβ-1 treatment increased proliferation of Panc-1 cells, yet decreased that of BxPC-3 cells, and showed that proliferation was unaffected by inhibition of NHE1 (10 μM cariporide) or NBCs (10 μM S0859), under both basal and TGFβ-1-treated conditions (Figures 5H,I).

Taken together, these results show that TGFβ-1 treatment stimulates proliferation of Panc-1 cells yet inhibits that of BxPC-3 cells. This occurs in parallel with a TGFβ-1-induced increase in p53 expression in the Panc-1 cells and is unaffected by inhibition of NHE1 or NBCn1.

Previous studies have demonstrated the involvement of acid-base transporters in cell motility and invasiveness, through roles of the transporters in cell adhesion, cytoskeletal dynamics,and matrix degradation (19, 25, 39–41). We therefore asked whether the TGFβ-1-induced upregulation of NHE1 and NBCn1 contributed to TGFβ-1-induced invasiveness of Panc-1 cells.

Stimulation with TGFβ-1 increased invasion of Panc-1 cells through Matrigel more than 4-fold (Figure 6B), consistent with the strong TGFβ-1-induced EMT induction in these cells (Figure 2). siRNA-mediated knockdown of NHE1 further increased TGFβ-1-induced invasiveness, whereas knockdown of NBCn1 or both transporters in combination had no effect (Figures 6A,B). The unexpected exacerbation of invasiveness by NHE1 knockdown prompted us to ask whether the impact of NHE1 on PDAC cell invasiveness was genotype-dependent. The tumor suppressor Merlin (aka Neurofibromatosis type 2, NF2), which is downregulated in many PDAC tumors (42), was reported to regulate EMT (43) and cell motility (44), and was recently shown to regulate NHE1 in melanoma cells (45). siRNA-mediated knockdown of Merlin (Figure 6A) increased basal invasion 4-fold and almost doubled TGFβ-1-induced invasiveness (Figure 6C). Notably, in Merlin-depleted cells, knockdown of either NHE1 or NBCn1 abolished the increase in invasion (Figure 6C).

These results show that Merlin depletion increases basal invasion and potentiated TGFβ-1-induced invasiveness. Invasion induced by Merlin depletion, but not that induced by TGFβ-1 alone, is dependent on NHE1 and NBCn1.