In a prospective setting, a cohort of 22 patients, diagnosed clinically and pathologically with locally advanced breast cancer at Sultan Qaboos University Hospital, was recruited. All 22 patients underwent NAC prior to surgery. Blood samples were collected from all 22 patients before and after the completion of NAC cycles and from 50 healthy controls. Tissue samples before (initial biopsy) and after treatment (excised tumor) were collected from all the 22 patients however, 12 out of the 22 tissue samples were only available for biomarker staining and the remaining 10 patients' tissue was not enough for research use therefore, we retrieved another 17 tissue samples from the pathology archive and were added in a retrospective setting to match the number of blood samples (22 prospective blood samples) + (12 prospective tissue + 17 retrospective tissue = 29 tissue samples). The study was approved by the ethical committee at the College of Medicine and Health Sciences, Sultan Qaboos University (License #SQU.EU/162/14, MREC#1018). Informed signed consent was obtained from all participants. All experiments were performed in accordance with institutional and national guidelines.

Patients' staging and response post NAC treatment (ypTN) were classified according to American Joint Committee on Cancer (AJCC). Patients were classified as pathological complete responders (pCR) when no invasive residual carcinoma (ypT0) was identified in either the breast or lymph nodes (ypN0). The presence of in situ carcinoma post NAC and the absence of residual invasive disease was also categorized as pCR. Therefore, these patients were staged as either ypT0 or ypTis, respectively. Pathological partial responders (pPR) were those cases in which residual invasive cancer was present with evidence of a response to treatment. These patients would therefore have ypT stage depending on residual tumor size. Changes indicative of response to chemotherapy included fibrosis, myxoid stroma, foamy macrophages, and chronic inflammation. Further response stratification was done to determine whether the molecules in test had any association with either tumor size (ypT) or lymph node status (ypN) according to the new definition of “Perfect Pathology Report” by national cancer institute NCI publication (19).

Regarding tumor grade after NAC, and based on cancer reporting guidelines by, the College of American Pathologists, USA (20), the American Joint Committee on Cancer (AJCC) (19), and the Royal College of Pathologists, UK (21) the grade post NAC was not considered for our comparative analysis since both guidelines clearly state that for most tumors the grade remains unchanged and the prognostic significance of a change in grade post NAC has not been determined. Hence the recommendation is to grade the tumor based on the pre-treatment core biopsy.

When the patient's outcome data during follow up was compared in respect to survival, the terms remission and relapse were used. Remission is defined as the absence of cancer in laboratory tests, physical examination, and radiological imaging after the completion of the prescribed treatment. Relapse is defined as the recurrence of cancer evidenced by the former tests. Patients' characteristics at diagnosis such as age, body mass index (BMI), hormone receptor status, breast cancer subtype, chemotherapy used, overall response, tumor size, and nodal status post NAC, disease status and survival are listed in Table 1.

Patient blood collected in EDTA-coated vacutainers was subjected to density gradient centrifugation with Histopaque (Sigma Aldrich, UK) at 400 g, with a break off for 30 min at room temperature. The separated plasma was frozen at −80°C until further analysis. The concentration of soluble NRP-1 and PlGF was measured in the plasma samples or conditioned media using ELISA kits (R&D systems, USA) according to the manufacturer's instructions. ELISA validation test was done in our previous related published article (17).

Anti-coagulated blood was subjected to density gradient centrifugation with Histopaque (Sigma Aldrich, UK) for 30 min at 400 g (breakoff) at room temperature. The buffy coat layer containing PBMCs was isolated, washed twice with cold PBS and pelleted at 250 g at 4°C. RNA was extracted from the PBMCs using TRI reagent (Ambion, USA), phase separation with chloroform and overnight isopropanol precipitation. The RNA pellet was washed twice in 70% ethanol in DEPC water, then dried completely and resuspended in DEPC-treated water (Ambion, USA). RNA was quantified using the NanoDrop™ 2000c spectrophotometer (Thermo Scientific, USA) and RNA quality, as indicated by the 260/280, was determined to be in the range of 1.8–2.0. One microgram of extracted RNA was treated with DNase I (Ambion, Lithuania) for 15 min at room temperature and converted to cDNA using the high-capacity reverse transcription kit (Applied Biosystems, USA). Synthesized cDNA was diluted to a final concentration of 5 ng/ul in DEPC-treated water and stored at −80°C until further analysis.

Real-time PCR was conducted using the SoAdvanced mastermix (Biorad, USA). Primers were designed using the Primer Express software (Applied Biosystems, USA) and are listed in Supplementary Tables 1, 2 in our previous report (17). Fifteen nanograms of cDNA was used per reaction. The CFX96 Real-time PCR Detection System (Biorad, USA) was used under the following conditions: enzyme activation at 95°C for 20 s, 40 cycles of denaturing at 95°C for 3 s, and annealing/extension at 63.4°C for 30 s. The specificity of PCR reactions was verified by the melt curve analysis of each amplified product. Each real-time PCR reaction was performed in duplicate. A no template control (NTC) was performed for each primer pair tested in all experimental runs. Commercially available reference cDNA (Clontech, USA) was utilized as an inter-plate calibrator to identify technical variations between experimental runs. The generated Ct results were analyzed using the QBase data analysis software to generate relative expression values using the 2^−ΔΔCt method of calculation. The GUSB gene was used for normalization in qRT-PCR since it was selected according to GeNorm analysis done in our previous study (17).

Immunohistochemical analysis was conducted on 29 (12 prospective+17 retrospective) pathologically confirmed locally advanced breast cancer tumors in formalin-fixed paraffin-embedded tissue. Briefly, tissue sections (3 μm) were deparaffinized using xylene and rehydrated in graded ethanol and H₂O. Antigens were retrieved using EDTA-pH 9 solution in 95°C water bath for 30 min. Endogenous peroxidases and residual blood were blocked/removed by 2% H₂O₂ and the slides were washed in PBS followed by a wash in 0.05% Triton-x100 to permeabilize the cells. The tissues were blocked in 5% goat serum (Dako, USA) and incubated with primary antibody (Anti-Neuropilin 1 antibody (ab81321) or anti-PlGF antibody (ab196666) (Abcam, UK) at 4 °C overnight. Following, the slides were washed in PBS and incubated with the EnVision™ + Dual Link System-HRP (Dako, USA) labeled secondary antibody for 1 h at room temperature and followed by incubation with substrate chromogen solution (DAB) chromogen (Dako). The sections were counterstained using hematoxylin solution and dehydrated and mounted using DPX (Sigma, USA). Tissues were visualized using (NikonH600L) light microscope. Immuno Reactive Scoring (IRS) was performed for the stained slides using the following formula: IRS = SI (staining intensity) × PP (% of positive cells). Independent validation of the staining was done on normal human placenta tissue with and without primary antibody (antiNRP-1) Supplementary Figure S1.

MDA-MB-231 breast cancer cell line was purchased from Cell Lines Services CLS, Germany in 2015. The cells were maintained in monolayer cultures in 5% CO₂ incubator at 37°C. The MDA-MB-231 cells were sustained in DMEM (Sigma, USA) supplemented with 5 mM sodium pyruvate (Sigma, USA). The cells media was supplemented with 10% fetal bovine serum (Gibco®, USA), and 2 mg/L gentamicin (Gibco, USA).

The treatment modalities of MDA-MB-231 cells was done to mimic the clinical NAC treatment of breast cancer patients. Briefly, MDA-MB-231 cells were treated in vitro with four cycles combination of 200 nM doxorubicin (Brand name Adriamycin, Pharmacia, Italy) and 600 nM cyclophosphamide (4xAC) (Brand name Cytoxan, Baxter, Germany) followed by four cycles of 50 nM paclitaxel (4xAC+4xPAC) (Brand name Taxol, EBEWE Pharma, Austria). Each treatment cycle was 72 h long. After each cycle, the cells which remained attached were left to proliferate until confluency and the following cycle of treatment was initiated right after.

CRISPR-Cas9 system was used to knockdown NRP-1 in MDA-MB-231 cells. Pre-designed NRP1 gRNA primers using the GeneArt™ CRISPR Search and Design tool (Thermo-Fisher) were used to synthesize gRNA for NRP1 knockdown (IVT-NRP1-gRNA-T2-F2: TAATACGACTCACTATAGACCAGGAGATGTAAGG and IVT-NRP1-gRNA-T2-R2: TTCTAGCTCTAAAACGGTACCTTACATCTCCTGG. The gRNA was synthesized using GeneArt™ Precision gRNA Synthesis Kit (Thermo-Fisher). The gRNA Cleanup kit (Thermo-Fisher) was used for the purification of the generated gRNA before transfection. The concentration of the purified gRNA was measured using Nanodrop (Nanodrop 2000, USA) and the gRNA band was further checked in agarose gel (100 bp). A day before transfection, 6 × 10⁵ cells were seeded in 6-well plate. GeneArt Platinum Cas9 Nuclease kit (Thermo- fisher) was used for the transfection by mixing the Cas9 Nuclease and gRNA in addition to the transfection reagent lipfectamine™ CRISPRMAX in Opti-MEM media. The mixed complex was added to transfect the cells for 48 h in 5% CO₂ incubator at 37°C. Subsequently, the cells were diluted into 1:5, 1:10, and 1:50 to isolate the clones carrying the NRP1 knockdown. Using the colony disk isolation method, two NRP-1 knockdown clones # 15 and # 22 were selected according to the level of NRP-1 knockdown determined by western blot.

NRP-1 protein expression was measured using western blotting technique. Briefly, the cells were washed with cold PBS, incubated with lysis buffer for 1–2 min (Cell Signaling technology, USA) in the presence of phenylmethylsulfonyl fluoride (PMSF) protease inhibitor (Sigma, Germany) (Sigma, Germany). Protein cell lysate was vortexed and centrifuged for 20 min at 4°C. The supernatants were collected, and protein quantification was done using Pierce bicinchoninic acid (BCA) protein assay kit (Thermo Fisher). Protein lysate samples were all adjusted to have 100 μg of total protein per sample and were electrophoretically separated using 7.5% sodium dodecyl sulfate polyacrylamide gel electrophoresis and then transferred onto polyvinylidene difluoride membranes (BioRad, USA). The immunoblots were then blocked with 5% non-fat milk and subsequently probed with rabbit primary monoclonal antibodies, NRP-1 (Ab Cam, UK Catalog #ab81321) or GAPDH as a normalizing internal control (cell signaling technologies catalog #2118) at a 1:1,000 dilution, incubated at 4°C overnight. The blots were then washed three times for 5 min with PBS and incubated with goat anti-rabbit IgG horseradish peroxidase conjugated secondary antibody at 1:5,000 dilutions (Abcam, UK) for 2 h at room temperature and developed using the clarity western ECL substrate (BioRad, USA). The densitometric analysis of the protein bands was performed using the Image lab software (BioRad, USA).

The ability of the MDA-MB-231 cells parental or NRP-1 Knockdown variants to form colonies before and after treatment was tested. The cells were treated with combination of both 200 nM Adriyamicin (doxorubicin) and 600 nM cyclophosphamide or 50 nM paclitaxel [IC₅₀ (22)] for 72 h. Then, the cells were seeded at a density of 1,000 cells/well in 6-well plates (Corning, USA) and incubated for 14 days at 37°C in 5% CO₂ incubator and the media was changed twice during this period. After the 2 weeks of incubation, the colonies were washed with PBS and stained with 25% crystal violet/methanol solution for 15 min at room temperature. Crystal violet stain was removed, and the wells were washed with tap water.

The paired t-test was used as a gold standard test for the differential expression of plasma or tissue proteins before and after NAC. The Shapiro–Wilk test for normality was conducted to determine the distribution of breast cancer patients in the cohort studied. While the distribution of the plasma protein dependent variables was confirmed to be normal, the PBMC gene expression data indicated non-normal distribution. Considering the heterogeneity in the population distribution and the unequal and limited number of cases among the subgroups studied, the PBMC gene expression data set was log₁₀-transformed to attain normality in the population distribution. The results that were significant using the paired t-test were further tested by univariate analysis to compare the measured values in patient samples, before and after treatment, to the levels measured in the healthy controls used in our previous study, with Tukey used as a post-hoc test. The Kaplan–Meier curve was generated to calculate the overall survival of patients regarding the low or high immunoreactive score (IRS) for NRP-1 tissue expression and the log-rank test (Mantel-Cox) was used to indicate significance. Associations where p < 0.05 were considered significant (95% confidence interval). Poorly represented subgroups (n < 3) were excluded from the analysis to avoid interpretation errors. The IBM SPSS software (Version 22) was used for all statistical analyses and graph preparations.

The univariate analysis comparing plasma NRP-1 levels in healthy controls (n = 50), patients with locally advanced disease prior to the initiation of NAC (pre-NAC) (n = 22), and post-treated patients (post-NAC) (n = 22) indicated that there was a significant increase in plasma NRP-1 levels in post-treated patients, compared to their initial level (p = 0.017) and the level of the healthy normal controls (p = 0.00001) (Figure 1A). The paired t-test was used to determine the differential levels of plasma NRP-1 pre- and post-NAC. The analysis of data indicated that the levels of plasma NRP-1 were increased significantly (p = 0.026) in patients who remained with a large tumor size (n = 9, ypT1&2) and partially responded to the treatment (p = 0.018) (n = 13, pPR) (Figures 1B,C). However, no significant change was observed in the NRP1 level in patients who had no tumor post NAC (n = 11, ypT0) or in patients who showed complete response to NAC (n = 8, pCR). In addition, NRP-1 plasma levels, post-NAC, were significantly higher (p = 0.003) in young patients (n = 6, 20–35 years) and in cases with a low or a medium BMI [(n = 5, BMI 18.5–24.9 (p = 0.009) and n = 6, BMI 25–29.9 (p = 0.01)] (Figures 1D,E).

Univariate analysis showed that tissue NRP-1 expression was reduced in post-NAC specimens (p = 0.05) of patients under remission (n = 19), while there were no changes in relapsed patients (n = 10) (Figure 2A). Similarly, tissue NRP-1 expression, post-NAC, was significantly decreased (p = 0.03) in all surviving patients (n = 11), but not in patients who died (n = 7) (Figure 2B). A Kaplan–Meier graph indicated that patients who received NAC and remained with high tissue NRP-1 levels (n = 8) had lower overall survival compared with patients whose tissue NRP-1 decreased post-NAC (n = 10), (log-rank p = 0.049) (Figure 2C). Representative immunohistochemistry images for tissue NRP-1 expression indicated a dramatic decrease in tissue NRP-1 levels, post-NAC, in the patients who survived, compared to those who died (Figure 2D).

Univariate analysis indicated that the basal levels of plasma PlGF, pre-NAC (n = 22), were significantly lower (p = 0.034) than the levels found in healthy controls (n = 50) (Figure 3A). The paired t-test indicated a relative increase in plasma levels of PlGF in patients who showed complete tumor regression (n = 11, ypT0) (p = 0.013) and a pathological complete response (n = 8, pCR) (p = 0.014) after NAC (Figures 3B,C). Increased plasma PlGF was observed in older and patients [n = 13, 36–50 years (p = 0.007) and n = 3, 50–71(p = 0.029)] and in patients with a high BMI [n = 9, BMI >30(p = 0.009)] (Figures 3D,E).

SNAI1 levels measured in patients PBMCs indicated that this transcription factor is significantly increased in patients who had no residual tumor (n = 11, ypT0) (p = 0.025) or diseased lymph nodes (n = 13, ypN0) after NAC and in pathological complete responders (n = 8, pCR) (p = 0.018) (Figures 4A–C). Univariate analysis showed a significant decrease (p = 0.042) in the initial expression (pre-NAC) of SNAI1 in patients who showed a partial response (n = 13, pPR) to NAC, compared to the expression in the healthy controls (n = 50) (Figure 4D). Additionally, a trend of increased SNAI1 expression post-NAC was observed in patients with pCR (n = 8) similar to the levels detected in the healthy controls (Figure 4E). SNAI1 expression in PBMCs was significantly increased in young patients (n = 6, 20–35 years old) (p = 0.047) (Figure 4F).

The resistant MDA-MB-231 cells to chemotherapies 4xAC+4xPAC expressed higher levels of soluble NRP-1 in the conditioned media and exhibited increased levels of cellular NRP-1 as represented by the increase in the intensity of the protein band on western blot (Figures 5A,B).

NRP-1 was efficiently knocked down in MDA-MB-231 cells using CRISPR Cas-9 as described in the materials and methods section. Two different clone variants; MDA- NRP-1 knockdown clone # 22 (58% knockdown) and MDA- NRP-1 knockdown clone # 15 (99% knockdown) were isolated (Figure 6). The quantification of NRP-1 expression was determined by measuring the density of the expressed bands as represented in the graph from three independent experiments (Figure 6). Clonogenic assay showed that NRP-1 knockdown caused a reduction in the ability of the cells to form colonies. Treating NRP-1 knockdown variants with combination of Adriamycin and cyclophosphamide (AC) or paclitaxel differentially reduced the ability of the cells to form colonies, however. Treating control parental MDA-MB-231 cells with AC didn't not affect the formation of the colonies only paclitaxel reduced its clonogenic ability.

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.