Pigs were raised and maintained on an experimental farm in Jiangsu Province, China. All animal care procedures in the experiment were operated according to the Chinese Experimental Animal Care and Use guidelines, and were approved by the Animal Care and Use Committee of Nanjing Agricultural University. A total of twenty-four weaned Landrace barrows, 28 d of age, were randomly allocated into three groups based on body weight: the control group (a basal diet, shown in Table 1), ICA100 group (the basal diet supplemented with 100 mg/kg ICA), and ICA200 group (the basal diet supplemented with 200 mg/kg ICA). The indole-3-carboxaldehyde compound (catalog number: 129445) was purchased from Sigma Inc, MO, USA. Animals were placed into individual pens with free access to feed and water. The body weight, feed intake, and diarrhea scoring were recorded during d 0 to d 14 of the trial. Scores were 0 = normal, firm feces; 1 = soft feces, possible slight diarrhea; 2 = definitely unformed, moderately fluid feces; 3 = very watery and frothy diarrhea. The diarrhea rate and diarrhea index were calculated according to the formulas (12): diarrhea rate (%) = Σ (the number of pigs with diarrhea per pen × days of diarrhea) / (total number of piglets × 14 d) × 100; diarrhea index = sum of diarrhea scores of pigs per pen / (number of piglets per pen × total days). Pigs from the control group and the ICA100 group were slaughtered at d 14. Organs and intestinal segments were isolated and weighed, samples including serum, jejunum, ileum, colon, and colonic digesta were collected. A small segment of jejunum and ileum were fixed in 4% paraformaldehyde for subsequent histological and immunofluorescence analyses. Other samples were stored at−80°C for further analyses.

The intestinal porcine epithelial cell (IPEC-J2) line was used in this study. IPEC-J2 cells were cultured in Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12; #L310KJ, Shanghai Basalmedia Technologies Co., Ltd., Shanghai, China) supplemented with 10% fetal bovine serum (FBS). Cells were incubated at 37°C in a mixture of 5% carbon dioxide and 95% air. The cell culture medium was changed every 2 days. Indole-3-carboxaldehyde (Sigma Inc, MO, USA) was dissolved in DMSO and then diluted with DMEM/F12 medium to prepare the ICA treatment solution. IPEC-J2 cells were treated with 0, 1, 2, 5, 10, 15, and 20 μM ICA, respectively. After 24 h of ICA treatment, the cell viability and proliferation ability were detected, and the cells were collected to analyze the expression of cell proliferation-related proteins.

Cell viability and proliferation ability were measured by using cell counting kit 8 (CCK8) assay and 5-ethynyl-2'-deoxyuridine (EdU) incorporation assay (#C0075S; BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 555) according to the manufacturer's instructions, respectively. Briefly, cells were seeded into 96-well-culture plates, and exposed to different doses of ICA solutions for 24 h. CCK8 reagent was added to each well, and the absorbance was evaluated by a microplate reader at 450 nm wavelength. Cell viability was expressed by cell survival rate, which was calculated according to the provided formula. EdU working fluid was added to each well, and fluorescence staining was observed under a Zeiss confocal laser microscope. The average intensity of fluorescence images was evaluated by ImageJ 1.53 m. Cell proliferation ability was assessed by the ratio of EdU-positive cells to 4′,6-diamidino-2-phenylindole (DAPI) cells per well.

Serum antioxidant capacity was reflected by Total superoxide dismutase (T-SOD), glutathione peroxidase (GSH-Px), catalase (CAT), Total antioxidant capacity (T-AOC), and Malondialdehyde (MDA) activities. These indicators were determined in serum by using colorimetric kits purchased from Nanjing Jiancheng Institute of Bioengineering following the manufacturer's protocol.

Serum D-lactic acid content, diamine oxidase (DAO) activity, and endotoxin content was analyzed using commercial ELISA kits (Nanjing Jiancheng Institute of Bioengineering, Nanjing, China) of Porcine D-lactic acid, Porcine diamine oxidase, and Porcine endotoxin, respectively. All procedures were performed according to the manufacturer's instructions. The absorbance values were detected by the enzyme labeling analyzer (Rayto RT-6100, Shenzhen Rayto Life Science Co., Ltd, Guangdong, China).

The intestine samples were stained with hematoxylin and eosin (H&E) for histological analysis, and stained with immunofluorescence for statistics of target protein expression and distribution. After fixation in 4% paraformaldehyde, the intestine tissue was dehydrated, embedded in paraffin wax, and sectioned at 4 μm. Tissue sections were dewaxed in xylene and rehydrated to water through a series of graded ethanol, then stained with hematoxylin and eosin, and sealed with neutral gum. The morphology of the intestine was observed by a microscope (Nikon ECLIPSE BOi, Japan). The villus height and crypt depth were measured by the Nis-Elements 4.20 software (Nikon, ECLIPSE BOi, Japan). Briefly, the immunofluorescence staining process of jejunum tissue was mainly dewaxing to water, antigen retrieval, circle drawing, serum blocking, first antibody incubation, second antibody incubation, DAPI counterstaining the nucleus, autofluorescence quenching, and mounting. Finally, the slices were photographed with a confocal laser scanning microscope (Zeiss LSM 900 META, Jena, Germany), and images were processed with the ZEN software (Zeiss).

Total RNA was extracted from the jejunum using an RNAeasy kit (Aidlab Bio CO.Ltd, Beijing, China) following the manufacturer's protocols. PrimerScript TM RT Reagent kit (TaKaRa, Japan) was used to convert RNA to cDNA. QPCR assays were performed on the Step One Plus real-time PCR System using SYBR Premix Ex Taq dye (TaKaRa, Japan). Primer sequences are listed: claudin-1 (F: GAGGATGGTCACACCGTGGT, R: GGAGGATGCTGTTGTCTCGG), occludin (F: ATGCTTTCTCAGCCAGCGTA, R: AAGGTTCCATAGCCTCGGTC), ZO-1 (zonula occludens 1) (F: ACAGGAGGGAAGCCATTTTCA, R: ATTTAAGGACCGCCCTCTCC), β-actin (F: AGAGCGCAAGTACTCCGTGT, R: ACATCTGCTGGAAGGTGGAC).

Total bacterial DNA was extracted from the colonic digesta using a bead-beating and phenol-chloroform method as previously described by Zoetendal et al. (13). DNA concentration was measured by a Nano-Drop 1000 spectrophotometer (Thermo Scientific Inc, Wilmington, DE, USA). The extracted DNA samples were sent to Biozeron Biotechnology Co., Ltd (Shanghai, China) for 16s rRNA gene sequencing. The V3-V4 regions of the bacterial 16S rRNA gene were amplified by PCR using universal primers 341F (5′-CCTAYGGGRBGCASCAG-3′) and 806R (5′-GGACTACNNGGGTATCTAAT-3′). The Qubit 3.0 fluorometer was used to quantify each PCR product for uniform mixing. The Illumina Truseq DNA Library Construction Kit was used for the library construction of mixed samples. Sequencing was conducted on an Illumina platform.

Total protein of IPEC-J2 cells were extracted with RIPA protein lysate (Beyotime Technology, Shanghai, China) containing 1% protease inhibitor. Protein concentrations were measured by a bicinchoninic acid (BCA) protein assay kit (#A045-4-2, Nanjing Jiancheng Bioengineering Institute, Jiangsu, China). Equivalent amounts of protein with 4 × loading buffer were denatured at 98°C for 10 min, followed by cooling on ice. The denatured protein was separated by 12% SDS-PAGE gel and transferred to the PVDF membrane (Millipore, Bedford, MA, USA). Then, the PVDF membrane was blocked with 5% skim milk for 1 h at room temperature, and incubated with the primary antibodies PCNA (#GB11010, Servicebio Technology Co., Ltd., Wuhan, China), Cyclin-D1 (#GB111372, Servicebio Technology Co., Ltd.), AHR (#A00225-4, BOSTER Biological Technology Co., Ltd.), and β-actin (#20536-1-AP, Proteintech Group, Inc., IL, USA) at 4°C overnight. After being washed three times with TBST, the PVDF membrane was incubated with the secondary antibody for 1 h at room temperature. Similarly, the PVDF membrane was washed three times with TBST. Finally, the target protein bands were visualized by using a chemiluminescence system (Tanon, Shanghai, China). Band intensities were quantified using ImageJ 1.53 m software, and all results were expressed as target protein/β-actin protein ratio.

All statistical analyses were performed using Statistical Product and Service Solutions (version 26.0, SPSS, Inc., IBM, Chicago, IL, USA). Figures were generated using GraphPad Prism 8 software (San Diego, CA, USA). Data are presented as mean ± standard error of the mean (SEM), and compared using one-way analysis of variance (ANOVA) for multiple comparisons and independent samples t-test for two-group comparisons. All differences were considered significant at P < 0.05.

The effects of dietary ICA treatment on ADG, ADFI and F:G are presented in Table 2. There were no significant differences in ADG and ADFI among the three groups (P > 0.05). However, compared with the control group, the ICA100 had a lower F:G during the experimental period (P < 0.05). In addition, no significant difference was observed in the diarrhea rate and diarrhea index among dietary treatments (P > 0.05).

The weight and indexes of the major organs, including heart, liver, spleen, kidney, and pancreas, did not differ between the control and ICA100 groups (P > 0.05) (Figures 1A,B). Nevertheless, dietary ICA supplementation changed the indexes of digestive organs in piglets. Compared with the control group, the ICA100 group had significantly higher total ileal weight, total ileal and colonic indexes, net ileal index, and net jejunal, ileal and colonic indexes (P < 0.05) (Figures 1C–F).

The intestinal morphological characteristics are shown in Table 3. Dietary ICA supplementation did not alter the villus height, crypt depth, and villus height/crypt depth ratio in the jejunum and ileum of piglets (P > 0.05). To evaluate the effect of ICA on intestinal permeability, serum diamine oxidase activity (DAO), D-lactic acid, and endotoxin concentration were measured. No significant difference was observed in these indicators between the control and ICA100 groups (P > 0.05) (Figure 2). In addition, the mRNA levels of claudin-1, occludin, and ZO-1 in the jejunum showed no difference between the two groups (P > 0.05) (Figure 3).

To determine whether ICA affected oxidative stress in weaned piglets, we examined antioxidant enzyme activities in serum. The results showed that the levels of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), total antioxidant capacity (T-AOC), and malondialdehyde (MDA) were no significant differences between the control and ICA100 groups (P > 0.05) (Figure 4).

Since dietary ICA supplementation increased intestinal tissue weight, we analyzed the expression of proliferation marker protein by using immunohistochemical staining. As shown in Figure 5, the jejunal proliferating cell nuclear antigen (PCNA) levels was significantly increased in piglets fed diet with ICA compared to the control group (P < 0.05).

We further assessed the effects of ICA on the proliferation of intestinal epithelial cells in the cell model of IPEC-J2. Cells were treated with 0, 1, 5, 10, 15, and 20 μM ICA for 24 h. ICA at the concentration of 10, 15, and 20 μM promoted cell viability of IPEC-J2, determined by CCK 8 assay, with 15 μM significantly higher than the control (P < 0.05) (Figure 6A). Meanwhile, the EdU incorporation assay showed that 15 μM ICA led to a significant increase in the number of EdU⁺ cells in IPEC-J2 cells (P < 0.05), indicating accelerated cell proliferation (Figures 6B,C).

Furthermore, we analyzed the expression of aryl hydrocarbon receptor (AHR, the ICA receptor) and the proliferation markers PCNA and Cyclin D1 by using western blot. The results showed that ICA treatment significantly up-regulated their expression in the intestinal epithelial cells (P < 0.05) (Figure 6D).

Colonic microbiota composition was evaluated by 16S rRNA gene sequencing (OTUs listed in the Supplementary Material). The results showed that ICA supplementation significantly increased the richness estimators (abundance-based coverage estimator [ACE] and Chao1) (P < 0.05) (Table 4). The ICA100 group also had an increased α diversity with a higher Shannon index and a higher Simpson index compared with the control group (P < 0.05). Principal-coordinate analysis (PCoA) plots based on Bray-Curtis index showed a significant separation between the two groups with PC1 and PC2 at 23.8% and 14.2% of the explained variance, respectively (Figure 7A). At the phylum level, Firmicutes and Bacteroidota were the most dominating phyla in the colon from piglets (Figure 7B). The ICA100 group showed a lower relative abundance of the phylum Fibrobacterota compared with the control group (P < 0.05) (Figure 7C). At the genus level, Rikenellaceae RC 9 gut group, Limosilactobacillus, Alloprevotella, and Prevotella were the dominant genera (Figure 7D). Dietary ICA supplementation significantly increased the abundance of Butyrivibrio (P < 0.05). Conversely, ICA treatment reduced the abundances of Alloprevotella, Prevotella, and Parabacteroides (Figure 7E).