The University of New Mexico Health Sciences Center (UNM HSC) Institutional Animal Care and Use Committee (IACUC) approved all of the procedures involving the use of live rodents. All experiments were in compliance with the ARRIVE guidelines. The Long-Evans rats used in these studies were purchased from Envigo Corporation (Indianapolis, IN, USA). Upon arrival at our UNM HSC Animal Resource Facility, the rats were single housed in static micro isolator cages with Envigo Tek-Fresh bedding at 22°C on a reverse 12-h dark/12-h light schedule (lights on from 2100 to 0900 h). They were provided irradiated Teklad Global 2920 Soy Protein Free rodent diet (Envigo) and water (chlorine dioxide treated in water bottles, autoclaved prior to use) ad libitum. Female rats arrived at around 6–7 weeks of age (125–150 g) and were approximately 9–10 weeks old at the time of breeding. The males were established breeders, 12 weeks old upon arrival, and 15 to 16 weeks old at the start of the breeding protocol. After one-week acclimation to the animal facility, baseline body weights for each female were obtained prior to the start of the pre-pregnancy drinking phase of the PAE paradigm.

The breeding and prenatal alcohol exposure (PAE) procedures for rats employed in this study were the same as described previously (Hamilton et al., 2014; Davies et al., 2023). Pre-pregnancy drinking levels in female rats were evaluated by gradually acclimating them to drinking 5% ethanol in 0.066% saccharin in tap water 4 h each day. The saccharin water contained 0% ethanol on the first and second day, 2.5% ethanol (v/v) on the third and fourth day, and 5% ethanol on the fifth day and thereafter. The drinking tubes were placed in the cages 1 h. after the onset of the dark phase. Daily ethanol consumption was measured using 55 mL volume conical beaded glass test tubes (25 mm × 150 mm; Fisher Scientific International, Waltham, MA, USA) with millimeter graduated markings, topped with a metal sipper tube with a stainless steel ball (Ancare Corporation, Bellmore, NY, USA) inserted in a white #4 rubber stopper (The Plasticoid Company, Elkton, MD, USA). Drinking tubes were filled daily to the 20 mm mark. At the end of each drinking session, the volume consumed was noted as a net change in the mm scale and converted to the volume consumed. The amount of ethanol consumed, expressed as g/kg body weight, was calculated using a daily weight extrapolated from weight data collected at the start and the end of each week. Upon completion of the pre-pregnancy drinking phase, the mean and standard deviation in 5% ethanol consumption from pre-pregnancy Day 5 to Day 14 was calculated. Any females whose drinking was more than one standard deviation below the group mean (usually less than 10% of the group) was removed from the study at this point.

Subsequently, females were assigned to either a saccharin control or 5% ethanol drinking group and matched such that the mean pre-pregnancy ethanol consumption by each group was similar. Females were then placed with alcohol-naïve proven male breeders until pregnant, as indicated by the presence of a vaginal plug. Female rats did not consume ethanol during the breeding procedure, which averaged about 2 days in length. Beginning on Gestational Day 1 (GD1), rat dams were provided saccharin water containing either 0% or 5% ethanol for 4 h each day, from 1000 to 1400 h. The volume of saccharin water provided to the control group (16 mL) was matched to the mean volume of 5% ethanol in saccharin water consumed by the ethanol prenatal treatment group during gestation. Daily four-hour ethanol consumption was recorded for each dam through GD21, after which ethanol consumption was discontinued. Rats were weighed weekly to assess maternal weight gain. At birth, the number of live births were recorded and the pups weighed. Subsequently the litters were culled to 10 pups by Postnatal Day 2 (PD2). Offspring were weaned at PD 23–26, at which time the numbers of each sex was confirmed.

Seven pairs of seven-month-old control and PAE rats of each sex were sacrificed by decapitation and their brains dissected, frozen in isopentane chilled in a dry ice/methanol bath, and then stored in airtight containers at −80°C until sectioning. Sixteen-μm-thick horizontal sections were collected at Figure 107 (Bregma: – 4.60 mm; Interaural: 5.40 mm) according to the Paxinos and Watson rat stereotaxic atlas (Paxinos and Watson, 1998) and stored in airtight containers at-80°C until incubation. Oligonucleotide probes (Thermo Fisher Scientific, Waltham, MA, USA) were designed to specifically recognize rH_3A and rH_3C mRNA, as previously described (Drutel et al., 2001). The probes (2.5–5 pmol) were labeled with 62.5 μCi of [³⁵S]-deoxyadenosine 5′-α (−thio) triphosphate (Perkin Elmer Inc. Boston, MA, USA), at their 3′ ends using terminal deoxynucleotidyl transferase for 2 h. Non-incorporated nucleotides were removed by purification through QIAquick columns (Qiagen Sciences, Germantown, MD, USA). Hybridization was carried out using quintuplicate sections from each rat brain at 52°C for 20 h in a humidified chamber. After post-hybridization washing, the sections were dried and then placed along with ¹⁴C standards in x-ray cassettes to expose Hyperfilm (GE HealthCare Technologies Inc. Chicago, IL, USA) for 14 days at 4°C. The film was then developed manually in Kodak D-19 (1:1, 18°C) for 2 min, fixed and then mounted onto microscope glass slides. Microdensitometric measurements of rH_3A and rH_3C mRNA were performed using Media Cybernetics Image Pro Plus® on an Olympus BH-2 microscope. An optical density standard curve, expressed in picoCuries/10⁵μm², was established based on autoradiograms of ¹⁴carbon standards. Measurements were made in six different brain regions (see Figure 1) at 3.125X total magnification. The density of rH_3A mRNA expression and rH_3C mRNA expression were each corrected against an off-section background density in each brain region measured in each rat.

We contracted GenScript (Piscataway, NJ, USA) to develop a polyclonal antibody against a fourteen amino acid sequence within the third cytoplasmic loop of the rH_3A isoform, a sequence not present in other functional rH3 isoforms (see Figure 2). A FASTA search indicated this sequence is only present in rH_3A of different species and not present in other receptors. Antibody specificity was characterized using human HEK-293 cells cultured in T175 cell culture flasks (Avantor™, Radnor, PA, USA) in DMEM media containing 0.584 g/L glutamine (Sigma-Aldrich, Inc., St. Louis, MO, USA) 5% penicillin–streptomycin (Thermo Fisher Scientific) and 10% Fetal Bovine Serum (FBS, Sigma-Aldrich, Inc.) in a humidified atmosphere with 5% CO₂ until 65–75% confluence on the day of transfection. As described by Bakker et al. (2006), the cells were transfected with cDNAs encoding each of six rH3 isoforms (A-F) from GenScript (cDNA sequences are provided at the GenScript website: www.genscript.com/search?q=rat+histamine+receptor+isoforms&g=orf), labeled with a C-terminal DYKDDDK tag (FLAG tag) detectable via immunoblotting, using the LipofectaminePlus method, according to the manufacturer’s protocol (Thermo Fisher Scientific). Briefly, on the day of transfection, the cells were trypinized with 0.05% trypsin–EDTA (Gibco™, Thermo Fisher Scientific) and washed with media to collect the HEK-293 cells and centrifuged for 5 min at 300× g to pellet the cells. The cDNAs (rH_3A-_C: 46 μg and rH3_D-F: 90 μg) and Lipofectamine (92–180 μL) were diluted in Opti-MEM media without serum (Sigma-Aldrich, Inc.) and, after 5 min incubation, were mixed together and incubated for 20 min at room temperature to allow complex formation to occur. The complex was added directly to each well containing cells and mixed gently by rocking the plate back and forth. The media was changed after 6 h. The cells were incubated for 24–48 h and harvested by centrifugation.

Protein was extracted from the transfected HEK 293 cells with isotonic homogenization buffer (320 mM sucrose, 10 mM Tris HCl, 1 mM NaVO₄, 5 mM NaF, 1 mM EDTA, 1 mM EGTA, 1 mM DTT) containing 1× protease and phosphatase inhibitors (Sigma-Aldrich, Inc.). The cells were then homogenized in a glass Dounce homogenizer with six up and down strokes each using a loose fitting and then a tight fitting pestle. The resulting homogenate was then centrifuged at 1000× g for 6 min at 4°C. The supernatant (S1) was then centrifuged again at 10,000× g for 15 min at 4°C. The resulting P2 fraction was resuspended in homogenization buffer. Proteins were quantified using a BCA Protein Assay Kit (Pierce, Rockford, IL, USA) according to manufacturer’s instructions. The fraction was aliquoted, flash frozen in liquid nitrogen and stored at −80°C until use.

Subsequently, 5 μg of sample protein were loaded onto a 4–12% NuPage gradient gel (Invitrogen™, Thermo Fisher Scientific Inc.) and run at 150 V for 2 h. The proteins were transferred onto a PVDF membrane (Millipore Sigma, Burlington, MA, USA). The membranes were blocked using I-block (Applied Biosystems, Foster City, CA, USA) in 1X PBS at room temperature for 1 h, then incubated with the GenScript anti-rH_3A (H3RA) polyclonal antibody (1:5000) and the GenScript anti-FLAG tag (1:2500, A00187) overnight at 4°C in I-block plus 0.1% Tween-20. Membranes were then washed three times for 10 min in 1X PBS-T, incubated in secondary antibodies at 1:15,000–1:20,000 dilution (LI-COR Biosciences, Lincoln, NE, USA) in I-block containing PBS plus 0.1% Tween-20 and 0.01% SDS for 1 h at room temperature. Membranes were then scanned using the LI-COR Odyssey Infrared Imaging System using the 700 nm wavelength channel to visualize the Tag and Actin and the 800 nm channel for H3RA antibody binding. The optical densities were quantitated using LI-COR Odyssey Application Software version 3.0.

As another strategy for confirming H3AR specificity, we acquired the B6.129P2-Hrh3^tm1TwlJ line of transgenic mice from The Jackson Laboratory (JAX stock #023433; Bar Harbor, ME, USA). These mice carry a targeted mutation of the Hrh3, histamine receptor H3R gene, with a cassette containing a neomycin resistance gene replacing a 0.7-kilobase region covering part of the first intron and the 5′ end of the second exon of the gene (Toyota et al., 2002). Jackson Labs provided male and female heterozygote breeding pairs for our experiments. Breeding pairs were maintained in the UNM HSC Breeding Barrier. The mice were kept in ventilated standard cages with autoclaved recycled cardboard bedding with low lights on from 0600 to 1800 h and provided irradiated Teklad Global 2920 Soy Protein Free rodent diet (Envigo) and sterilized water pouches ad libitum. Offspring mouse genotype was determined with tail biopsies using real-time PCR with specific probes designed for HrH3 (Transnetyx, Cordova, TN, USA). The three genotypes generated were Wild type (WT – mH3R^+/+), heterozygous (HT – mH3R^+/−) and pan H3R Knockout (KO – mH3R^−/−).

Medial frontal cortex was collected from five pairs of ~five-month-old adult WT (all female) and KO (two male and three female) mice, flash frozen and stored at −80°C until RNA extraction. Total RNA was extracted using TRIzol™ (Invitrogen™, Thermo Fisher Scientific). RNA quality was determined using a NanoDrop 2000 (Thermo Fisher Scientific), using absorbance at 260, 280 and 230 nm. One μg of total RNA was reverse-transcribed using SuperScript III reverse transcriptase (Invitrogen™, Thermo Fisher Scientific) following the manufacturer’s protocol and qRT-PCR carried out with a Model 7500 fast real-time PCR system (Applied Biosystems™, Thermo Fisher Scientific) using PowerUp SYBR Green master mix (Thermo Fisher Scientific). Primer sequences for qRT-PCR for mouse mRNAs were made by Invitrogen (Thermo Fisher Scientific) to detect mouse H3R Transcript Variant 1 (Forward primer sequence: CTTCCTCGTGGGTGCCTTC, Reverse primer sequence: CAGCTCGAGTGACTGACAGG) and the GAPDH gene (Forward primer sequence: TGTGATGGGTGTGAACCACGAGAA, Reverse primer sequence: GAGCCCTTCCACAATGCCAAAGT). For each sample, the GAPDH cycling time (CT) was subtracted from mH3R CT and then the relative expression of mH3R was determined using the comparative 2-ΔCt method (Livak and Schmittgen, 2001). All 2-ΔCt values were normalized to the mean of WT mH3R expression and the normalized values expressed as the mean ± SEM.

As described above for the ISH studies in Section 2.3, four ~ten-week-old mice, two male and two females from each of the three genotypes, were sacrificed, their whole brains dissected, frozen in isopentane and stored in airtight containers at −80°C until sectioning. Eight-μm-thick cryostat sections were collected in the sagittal plane corresponding to Figure 113 (Lateral: - 1.44 mm) in the Paxinos & Franklin stereotaxic atlas of mouse brain (Paxinos and Franklin, 2013), thaw-mounted onto pre-cleaned Superfrost-Plus® microscope slides and stored at −80°C in airtight containers until incubation. Tissue sections were pre-incubated for 10 min in incubation buffer (50 mM Tris–HCl, 100 mM NaCl, 5 mM MgCl₂, 0.2 mM EGTA, 2 mM GDP, 1 mM DTT, and 100 nM DPCPX; pH 7.4 at 25°C), and then incubated with 100 pM [³⁵S]-GTPγS (Perkin Elmer, specific activity = 1,250 Ci/mmole) for 90 min at 25°C with the H3R agonist immethridine (3 μM) in the absence or presence of 30 μM unlabeled iodopotentidine (IPP), a H3R antagonist. After incubation, sections were rinsed twice for 15 s each in ice-cold incubation buffer, dipped in ice-cold distilled water, air-dried, and vacuum desiccated overnight. Sections were then exposed to Kodak Biomax MR film for 4 days, and the film developed in Kodak D-19 (1:1, 18°C), fixed and then mounted onto microscope glass slides. Measurements of [³⁵S]-GTPγS binding were performed using Media Cybernetics Image Pro Plus® on an Olympus BH-2 microscope at 3.125X total magnification. An optical density standard curve, expressed in picoCuries/10⁵ μm^2, was established based on autoradiograms of ¹⁴carbon standards. Immethridine-stimulated [³⁵S]-GTPγS binding was expressed as percent of GTP binding above GTP binding in the presence of iodopotentidine. The mean ± the SEM percent agonist-stimulated GTP binding was computed for each brain region for each genotype.

Protein was extracted from frontal cortical brain tissue of ~seven-week-old female untreated control rats or from ~eleven-week-old WT and H3R KO mice of both sexes using isotonic homogenization buffer containing protease and phosphatase inhibitors as described for HEK-293 cells in Section 2.4. We ran varying amounts of sample protein (2–50 μg) on 4–12% gradient gels and optimized the primary antibody concentrations as follows: GenScript H3RA (1:5000), and β-Actin (1:80,000, Sigma-Aldrich Inc.) as the reference protein. Secondary antibodies used were donkey anti-rabbit IRDye® 800CW (1:20,000, LI-COR Biosciences) for H3RA, and goat anti-mouse IRDye® 630RD (1:40,000, LI-COR Biosciences) for β-actin. The fluorescence images of the western blots were analyzed as described previously (Section 2.4).

HEK-293 cells were transfected with rH_3A mRNA and Lipofectamine only, as described in Section 2.4. Protein was extracted and varying concentrations of protein (20–50 μg) were run on a 4–12% gel which was stained with Coomassie Brilliant blue R-250. Western blotting was conducted as described above in Section 2.4 and the ~48 kDa band was excised from the corresponding gel and sent for LC–MS analysis as described in Section 2.9 above.

All statistical procedures and graphical illustrations were performed using SigmaPlot® 11 (Systat Software Inc., San Jose, CA, USA). All data are expressed as the mean ± SEM with a p value <0.05 deemed as statistically significant. A Mann–Whitney Rank Student’s two-tailed t-tests was used to compare differences in maternal weight gain and pup birthweight and Mann–Whitney rank sum test was used to test differences in litter size (Table 1). Two-way ANOVAs were used to test for differences in the individual rH3A mRNA and rH3C mRNA expression data in each brain region unless the data was not normally distributed, in which case a Kruskal-Wallis ANOVA on ranks was employed (Figure 3). A Mann–Whitney rank sum test was used to compare the qRT-PCR data (Figure 4). A two-way ANOVA was used to test differences in GTP binding data in the absence and presence of the H3R antagonist iodopotentidine (Figure 5).

Rat dams in the 5% ethanol group consumed a mean of 1.81 ± 0.05 grams of ethanol each day during gestation (Table 1). In a separate set of rat dams, this level of consumption produced a mean serum ethanol concentration of 25.1 ± 3.3 mg/dL when sampled 2 h after the introduction of drinking tubes (Davies et al., 2023). This moderate prenatal ethanol exposure paradigm resulted in a 14% reduction in maternal weight gain that was statistically significant. However, the reduction in maternal weight gain did not significantly affect offspring litter size or offspring birth weight (Table 1).

As illustrated in Figure 1, both rH_3A mRNA and rH_3C mRNA were heterogeneously distributed across brain regions in patterns similar to the distribution of H3Rs and H3R agonist-stimulated [³⁵S]-GTPγS binding (Varaschin et al., 2018). The density of rH_3A binding appears to be greater than the rH_3C signal. Figure 3 summarizes the impact of PAE and sex on the expression of rH_3A mRNA and rH_3C mRNA in six brain regions. No prenatal treatment or sex-related effects were consistently observed across the six brain regions analyzed. Significant interactions between prenatal treatment and sex were observed for rH_3A mRNA expression in the dentate gyrus (3A) and entorhinal cortex (3B) and for rH_3C RNA expression in entorhinal cortex (3B) and hippocampal CA3 region (3E). In each of these four cases, along with non-parametric assessments of rH_3C mRNA in dentate gyrus (3A) and cerebellum (3F), a sex-related effect was detected in control but not PAE offspring. Further, a significant main effect of sex was noted for rH_3A mRNA in the hippocampal CA3 region (3E). A significant main effect of prenatal treatment was only observed in the parietal cortex (3D) and a significant difference based on prenatal treatment was observed for males but not females in dentate gyrus (3A) and entorhinal cortex (3B). No significant effects were observed in the medial frontal cortex (3C).

We developed a polyclonal antibody against a fourteen amino acid sequence within the third cytoplasmic loop of the rH_3A isoform, a sequence not present in other functional rH3 isoforms (Figure 2) for use in our Western blotting studies. Figure 6 illustrates a representative western blot of HEK-293 P2 samples prepared from six different overexpressing H3R isoform derived cell lines (A–F). Green bands represent H3RA antibody binding, red bands are binding by the Tag peptide, and the yellow band represents binding by both the H3RA antibody and the Tag peptide. The yellow band detected at ~48 kDa in Lane A representing the rH3A-overexpressing HEK-293 cells of Figure 6, confirms the specificity of the GenScript polyclonal antibody for detecting rH_3A protein. While sufficient H3R protein was available to visualize Tag peptide binding (red bands) for rH_3B (Lane B) and kDa for rH_3C (Lane C), the H3RA antibody did not recognize these proteins, as evidenced by the absence of yellow bands. Note that the band positions in Lane B and Lane C are consistent with the shorter amino acid sequences for rH_3B (413 aa) and for rH_3C (397 aa). However, as the non-functional rH_3D (Bakker et al., 2006) has a similar amino acid sequence to rH_3A, a faint green band of H3RA antibody binding was noted. Anti-FLAG tag antibody labeling was not observed for H3R isoforms D–F (Lanes D–F) due to the relatively low abundance of these isoforms compared to the A, B, and C isoforms.

As a second approach for confirming antibody specificity, we obtained heterozygote pan H3R transgenic mouse breeding pairs and then generated and confirmed mouse offspring with the WT (mH3R^+/+), HT (mH3R^+/−) and KO (mH3R^−/−) genotypes. Subsequently, we conducted a qRT-PCR analysis of pan-mH3R mRNA expression in medial frontal cortical membranes prepared from WT and KO mice. GAPDH mRNA expression, whose expression was not different between WT and KO mice, was used as the reference gene. However, as shown in Figure 4, we observed a significant 25-fold reduction in pan H3R mRNA expression in KO mice compared to WT mice.

We also employed H3R agonist-stimulated [³⁵S]-GTPγS (GTP) binding as a measure of H3R function in all three genotypes. Autoradiograms of immethridine-stimulated GTP binding in sagittal sections of WT mice (Figure 5A) showed a relatively higher level of agonist-stimulated GTP binding in external pyramidal layer of medial frontal cortex with more moderate and diffuse levels of binding in the dorsomedial caudate nucleus, as well as other regions of the cerebral cortex (Figure 5A) and hippocampal formation (not shown). H3R agonist-stimulated GTP binding was virtually abolished in the presence of the H3R antagonist iodopotentidine (IPP; Figure 5B). A fainter degree of agonist-stimulated GTP binding was noted in the medial frontal cortex and caudate nucleus of sections collected from a H3R HT mouse (Figure 5C) and was not present in sections from H3R KO mice (Figure 5D). The H3R agonist-stimulated GTP binding data, expressed as percent increase in GTP binding above the mean binding in the presence of IPP from four mice of each of the three genotypes is summarized for medial frontal cortex (Figure 5E) and caudate nucleus (Figure 5F). A two-way ANOVA of the GTP binding in medial frontal cortex revealed a significant interaction between genotype and the presence of IPP in the incubation medium (Figure 5E). Agonist-stimulated GTP binding was not different among the three genotypes in the presence of IPP nor between the GTP binding in the absence and presence of IPP in the H3R KO group, indicating the absence of H3R agonist-stimulated GTP binding in the H3R KO mice. However, agonist-stimulated GTP binding was significantly greater in the HT group compared to the KO group and significantly greater in the WT group compared to the two other genotypes. Similar results were observed in the caudate nucleus except the agonist-stimulated GTP binding in the HT group was not significantly greater than the H3R KO group (Figure 5F).

As illustrated in Figure 7A, western blots of increasing protein concentrations of P2 membranes prepared from rat frontal cortical tissue identified a single higher molecular weight band (~55 kDa) in contrast to the ~48 kDa band observed with HEK-293 cells overexpressing rH_3A (Figure 6). Subsequent studies employing higher quantities of protein (30, 50 and 100 μg) along with higher concentrations of the primary (1:5,000–1:500) or secondary (1:20,000–1:5,000) antibody failed to detect a ~ 48 kDa band in rat frontal cortex. Our preliminary interpretation of these results was that either the rH_3A isoform undergoes post-translational modifications in native membranes that increase its molecular weight or, that the H3RA antibody was binding to another, possibly higher abundance, protein. Subsequently, with confirmation of the mouse H3R phenotypes, we repeated this experiment comparing frontal cortical membranes from rat as well as WT and KO mice. As illustrated in Figure 7B, we observed that the H3RA antibody labeled a ~ 55 kDa band in all three sample types suggesting the ~55 kDa band was not rH_3A protein.

Subsequently, frontal cortical membranes of rat and H3R WT and KO mice were prepared and sent to Kendrick Laboratories along with our GenScript H3RA antibody. Western blotting was performed as before except that Enhanced chemiluminescence (ECL) was used to detect the bands on X-ray film. As before, a single band of antibody binding was observed at ~55 kDa in all three tissue types. The ~55 kDa bands were excised from the mouse WT and KO samples, as illustrated in Figure 8, and sent to the Clarkson Proteomic Facility for protein identification. LC/MS analysis of the ~55 kDa band identified the presence of the highly abundant β-subunit of ATPase in both WT and KO mice, with no evidence of the rH_3A protein isoform.

Subsequently, western blotting experiments were repeated in our laboratory, as described in Section 3.3 above, using higher amounts (20–50 μg) of P2 membranes from rH_3A mRNA-transfected HEK 293 cells than used in earlier studies (Figure 6). Figure 9A illustrates a Coomassie-stained gel of increasing amounts of protein. Figure 9B is the fluorescence image of the western blot illustrating increasing amounts of rH_3A protein at ~48 kDa (yellow bands). In addition, we noted yellow bands near the ~100 kDa and ~ 150 kDa molecular weight markers, suggesting the possibility of rH_3A dimers and trimers in this preparation (Figure 9B). Finally, the antibody also bound to another protein (green band) just above the ~48 kDa rH_3A band, but below the ~55 kDa band observed in western blots of rodent membranes (Figure 7). This protein, whose identity is uncertain at this point, had not been observed in earlier studies using lower amounts (5 μg) of HEK-293 membrane protein. Subsequently, the ~48 kDa band was excised from the 50 μg lane of the gel (white box in Figure 9A) and sent to the Clarkson Laboratory where LC/MS analysis detected the presence of rH_3A protein from the excised band. However, the level of rH_3A protein detected was below the limit of quantitative reliability (LOQ), even in rH_3A overexpressing HEK-293 cells, suggesting that it would not be possible to quantitate rH_3A in rodent membranes.