This study was conducted in accordance with the Declaration of Helsinki and the guidelines for the conduction of research involving human subjects, as established by the Ethics Committee of Xinqiao Hospital, Army Medical University. FCD IIb and TSC-induced pediatric drug-resistant epilepsy were diagnosed according to the current international consensus classification proposed by the ILAE. Invasive depth electrode recordings were performed if the epileptic lesions could not be precisely located by scalp electroencephalogram before the surgery. Only epileptogenic tissues that were identified with the dysplastic cortex by magnetic resonance imaging and further confirmed post-hoc by neuropathological correction were used in the study. Informed written consent was obtained from all participants or legal guardians for the use of the dissected tissue for research purposes only.

In the present study, 15 FCD IIb and 24 TSC lesions were examined. The general clinical information of all the patients is summarized in Table 1, and detailed clinical information of each patient is presented in Supplementary Tables S1, S2. Among the 26 control cortex (CTX) used in this study, 23 control tissues were obtained from patients with craniocerebral tumors in accordance with the criteria reported in previous studies during surgery (31, 32). None of any other neurological diseases or history of seizures were detected in these patients, and only the normal-appearing tissues without reactive astrogliosis, inflammation, or necrosis were included in the study. The other three control cortical specimens were obtained from individuals who were diagnosed with increased intracranial pressure due to traumatic brain injury and without any neurological disease in history. The samples distant from the directly injured area were obtained in <6h after brain injury (33) after comprehensive presurgical assessment, including history, neuroimaging studies, and neurological examination according to the criteria (27, 34). The detailed information of each control subject is shown in Supplementary Table S3.

Sprague–Dawley rats were obtained from Army Medical University and housed under standard conditions with room temperature of 23 ± 1°C, humidity of 60%, and 12-h light/12-h dark cycle with food and water ad libitum. Randomly chosen female rats were exposed to X-ray (145 cGy, 60 s) (RS-2000, Rad Source Technologies) at post-pregnancy day 17 to disrupt the normal development of cortex in utero, and newborn rats were weaned at postnatal day 21 (P21) after normal delivery according to previous procedures (9). A total of 58 rats (both male and female) were used in this study, including 16 rats at 7 days: male/female: 7/9, 22 rats at 14 days: male/female: 12/10, and 20 rats at 28 days: male/female: 10/10. The number ratio of male to female was close to 1:1.

All experimental procedures were conducted in accordance with the guidelines of the Ethical Committee of Army Medical University and approved by the Internal Animal Care and Use Committee of Army Medical University.

The total RNA was extracted from each specimen using the TRIzol reagent following the manufacture protocol (Invitrogen, Carlsbad, CA). RNA concentration was determined using a nanodrop spectrophotometer (Ocean Optics, Dunedin, FL) at 260/280 nm with a ratio of 1.8–2.0. Single-stranded cDNA was reverse-transcribed from 1 μg RNA using oligo dT primers (Takara, Otsu, Japan). The primers used in this study were as follows: human α-syn (forward: 5'GACAGCAGTAGCCCAGAAGACAG3', reverse: 5'GCATTTCATAAGCCTCATTGTCAG3'); human GAPDH (forward: 5'CACTCCTCCACCTTTGACGC3', reverse: 5'CTGTTGCTGTAGCCAAATTCGT3'), rat syn (forward: 5'GTTTTGTCAAGAAGGACCAGATG3', reverse: 5'GGCATTTCATAAGCCTCACTG3'); rat GAPDH (forward: 5'AAGTTCAACGGCACAGTCAAGG3', reverse: 5'CGCCAGTAGACTCCACGACATA3').

The PCR cycle was set as follows: 95°C for 30 s (one cycle), and 95°C for 5 s and 60°C for 40 s (49 cycles) to denaturation, 65°C for 5 s to anneal, and 95°C for 5s to extension. Each quantitative PCR reaction was repeated three times, and the quantitative PCR analysis was repeated by at least two independent experiments. The relative expression of α-syn mRNA in each sample was determined by the 2^−ΔΔCt method with GAPDA as internal control.

Protein of each specimen was extracted by the homogenizing tissue in RIPA lysis buffer supplemented with a mixture of protease and phosphatase inhibitors (cat.no: P0013B, Beyotime Biotechnology), and the concentration was determined using the Bradford protein assay (cat.no: P0010, Beyotime Biotechnology). An equal amount of protein (40 mg/ lane) was separated on 12% SDS-polyacrylamide gels and transferred to polyvinylidene fluoride membranes with a pore size of 0.2 μm. Membranes were blocked in 5% non-fat milk for 1 h and incubated with primary antibody overnight at 4°C (α-syn: 1:500, cat.no: 10842–1-AP, Proteintech; GAPDH:1:5000, cat.no: HRP-60004, Proteintech). Membranes were washed three times with Tris-buffered saline containing 0.1% Tween-20 (TBST) and then incubated with a peroxidase-conjugated goat anti-rabbit secondary antibody (1:1.000, cat.no: SA00001–2, Proteintech) for 1 h at 37°C. The signal was detected using chemiluminescent substrates (cat.no: SQ201L, Epizyme Biomedical Technology) after washing three times with TBST. GAPDH was used as the loading control. Densitometric analysis was performed using ImageJ to quantify the optical density (OD value) of each protein band.

Paraffin-embedded tissues were sectioned at a thickness of 4 μm and mounted on polylysine-coated slides. Antigen retrieval was performed by heating sections in citrate buffer solution (0.01 M, pH 6.0) at 100°C for 30 min after deparaffinization and rehydration. After cooling to room temperature, the sections were washed with PBS. Sections were treated with 0.3% H₂O₂ to remove endogenous peroxidase activity. After blocked with 0.3% H₂O₂ for 10 min at 37°C, sections were incubated with primary antibodies: α-syn (1:200, cat.no:10842–1-AP, Proteintech, Wuhan), p-α-syn antibody (1:200, cat.no: PA5118553, Thermo Fisher) or NMDAR2A (1:100, cat.no: #M264, Sigma-Aldrich), or NMDAR2B (1:100, cat.no: 21920-1-AP, Proteintech) overnight at 4°C. Sections were incubated with HRP-conjugated secondary antibody (ZLI-9018, ZSBIO) for 1 h at 37°C and developed with the DAB Chromogenic Kit (ZLI-9018, ZSBIO) after washing three times with PBS. Counterstaining was performed with hematoxylin. For hematoxylin and eosin (HE) staining, sections were incubated with hematoxylin for 5 min and eosin for 20 s consecutively after deparaffinization and rehydration. An inverted bright-field microscope (BX63, OLYPUS, Japan) was used to acquire images.

For immunofluorescent staining, paraffin-embedded sections were blocked in 10% goat serum after deparaffinization and antigen retrieval and incubated with corresponding primary antibodies: α-syn (1:200, cat.no: 10842-1-AP, Proteintech), p-α-syn antibody (1:200, cat.no: PA5118553, Thermo Fisher), vesicular glutamate transporters 2 VGLUT2 (1:200, cat.no: ab211869, Abcam), vesicular GABA transporters VGAT (1:50, cat.no: ab211534, Abcam), vimentin (1:500, cat.no: 60330-1-Ig, Proteintech), NeuN (1:5000, cat.no: ab104224, Abcam), GFAP (1:400, cat.no: C9205, Sigma-Aldrich), Iba1 (1:500, cat.no: OB-PGP049, Biofarm), and Olig2 (1:500, cat.no:OB-PGP040-02, Biofarm) overnight at 4°C. After washing three times with PBS, the sections were incubated with Alexa Fluor 488-conjugated anti-rabbit antibody (1:1000, cat.no: #A-11008, Thermo Fisher Scientific), Alexa Fluor 555-conjugated anti-rabbit antibody (1:1000, cat.no: #A-21428, Thermo Fisher Scientific), Alexa Fluor 555-conjugated anti-mouse antibody (1:1000, cat.no: #A-21422, Thermo Fisher Scientific), or Alexa Fluor 488-conjugated anti-Guinea pig antibody (1:1000, cat.no: ab150185, Abcam) for 1 h at 37°C. Sections were subsequentially nuclear stained by Hoechst 33258 and photographed by a confocal microscope (LSM880; ZEISS, Germany).

Notably, the distinct morphology of BCs and astrocytes helps to distinguish them in FCD samples. BCs have eccentric nuclei, a ballooned cytoplasm, and do not exhibit clear axonal or dendritic processes (35). However, astrocytes exhibit a morphology of several stem branches that give rise to many finely branching processes in a uniform distribution. Additionally, Vimentin is generally used as a marker of immature glia and neurons during development (36) and was also used as a maker for BCs traditionally, which were demonstrated to be immature neurons in FCD lesions (37–40). However, GFAP is commonly used as a mature astrocytic marker (41, 42) and rarely detected in BCs in FCD lesions (27, 43, 44).

In brief, proteins were extracted from cortical tissues of FCD patients and rats using the Universal Magnetic Co-IP Kit protocol (cat. no: 54002, Active motif) under manufacturer's instructions. Protein extracts were incubated with protein G PLUS-Agarose (Santa Cruz, Biotechnology) for 1 h at 4 °C to eliminate non-specific binding. After incubation, the precleared supernatants containing 1 mg of protein were incubated with corresponding primary antibodies: α-syn (cat.no: #4179S, cell signaling technology), NMDAR2A (cat.no: #M264, Sigma-Aldrich), NMDAR2B (cat.no: #14544, cell signaling technology), or IgG (cat.no: #5127, cell signaling technology) overnight at 4 °C. Lysates were incubated with protein G PLUS-Agarose for 3 h at 4 °C with rotation. Beads were washed four times with complete Co-IP/wash buffer. Pre-IP lysates and bound proteins eluted from the immune complexes were denatured by heating to 95 °C for 5 min and used for Western blot analysis (12% gel for α-syn, 6% gel for NMDAR2A and NMDAR2B).

The immunoreactivity of α-syn and p-α-syn in DNs, BCs, and GCs was evaluated following an evaluation scheme reported previously (45), and the relative number of positive cells within cortical lesions was semi-quantified according to a three-point frequency score: 1: 0–10% (rare); 2: 11–50% (sparse); 3: > 50% (high), and the staining intensity was semi-quantified to a 4-point scale: 0 (absence), 1 (weak), 2 (moderate), and 3 (strong). The product of these two scores (frequency and intensity) yielded the total score. All the areas of the slices were evaluated, and the score represents the predominant cell staining intensity in each section.

The immunoreactivity of α-syn in neuropils, p-α-syn, NMDAR2A, and NMDAR2B was evaluated with image J in consistent with our previous study (46). In short, non-overlapping fields (400 × magnification, 0.3481 mm × 0.2621 mm width) were defined in the center of the lesions. Three sections from each specimen were selected, and three visions were captured in each section, and the ODs of the nine areas were averaged for the specimen. The immunoreactivity was evaluated by two histologists who were blind to the clinical data.

The proper sample size and study power were estimated according to the previously established experimental settings (47). Data acquisition and analysis were done blindly and were presented as mean ± SEM. For comparisons between two independent groups, the unpaired two-tailed t-test was used. Spearman's rank correlation test was used for bivariate correlation analyses. Statistical methods and the number of replicates were indicated when used. Normality and equal variance tests were performed for all statistical analyses. GraphPad Prism 7 software was used for data plotting and analysis. A p-value of < 0.05 was considered as statistically significant.

We first examined the expression differences of α-syn between FCD IIb, TSC lesions, and control cortex (CTX) individually. RT-PCR results showed the expression of α-syn mRNA was significantly reduced in FCD IIb lesions (Figure 1A, ^**p < 0.01, unpaired two-tailed t-test), α-syn band was detected at approximately 18 kDa by Western blotting, and quantitative analysis showed the expression of α-syn was significantly reduced in FCD IIb lesions (Figure 1B, ^*p < 0.05, unpaired two-tailed t-test). Interestingly, RT-PCR results showed α-syn mRNA was significantly increased in TSC lesions (Figure 1C, ^*p < 0.05, unpaired two-tailed t-test), while α-syn protein was reduced (Figure 1D, ^**p < 0.01, unpaired two-tailed t-test). α-syn protein expression was increased gradually along with the development in the brain (48, 49). We found that both the mRNA and protein expression of α-syn were positively correlated with the ages of control subjects by Spearman's correlation analysis (Figure 1E). However, the positive correlation between α-syn and age was lost in patients with FCD IIb (Figure 1F) and TSC (Figure 1G).

We investigated the cellular expression and distribution of α-syn in FCD IIb and TSC lesions with IHC. Moderate-to-strong immunoreactivity of α-syn was observed in the neuropils of CTX, while the immunoreactivity of α-syn was barely detected in the cytoplasm of neurons (Figure 2A). However, weak-to-moderate α-syn immunoreactivity was detected in DNs (double arrows) and BCs (arrows) in FCD IIb lesions (Figure 2B). Interestingly, α-syn immunoreactivity was barely observed in DNs (double arrows) in TSC lesions nor GCs (arrows) (Figure 2C). Additionally, weak α-syn immunoreactivity was observed in the neuropils of FCD IIb and TSC lesions (Figures 2B, C). Statistical analysis showed that the average optical density (OD) of α-syn was significantly reduced both in FCD IIb and TSC lesions (Figure 2D, ^***p < 0.001, unpaired two-tailed t-test).

Additionally, we evaluated the immunoreactivity score of α-syn in the cytoplasm of control neurons, DNs, BCs, and GCs of FCD IIb and TSC lesions with methods reported in previous studies (35, 45) and summarized the information in Table 2. Specifically, α-syn immunoreactivity was not observed in the cytoplasm of neurons in CTX and was scored zero, but it was significantly increased in DNs, BCs of FCD IIb lesions and scored 3.67 ± 0.44, 3.33 ± 0.33, respectively (^***p < 0.001, unpaired two-tailed t-test), and α-syn was not observed in DNs and GCs of TSC lesions and scored zero individually.

Double immunofluorescent staining results showed that α-syn was expressed in vimentin-positive BCs in FCD IIb lesions (arrows in Figure 2E). α-syn was intensively expressed in the neuropils of CTX and sparsely co-localized with VGLUT2, a marker of excitatory neurons in CTX (Figure 2F). However, the immunoreactivity of VGLUT2 was intensely increased in the neuropils of both FCD IIb and TSC lesions, as shown by the co-expression of α-syn and VGLUT2 (Figures 2G, H). Importantly, co-expression of α-syn and VGLUT2 was observed in DNs (double arrows) and BCs (arrows) in FCD IIb lesions (Figure 2G) but not in the GCs of TSC lesions (Figure 2H). In TSC lesions, α-syn signal was not detected in vimentin-positive GCs (Figure 2I) nor in VGAT-positive inhibitory neurons in the CTX (Figure 2J). However, the co-expression of α-syn and VGAT was intensified in DNs and BCs of FCD IIb lesions (Figure 2K) and neuropils of TSC lesions (Figure 2L). Thus, these results suggested that α-syn might contribute to regulating the excitatory and inhibitory synaptic transmission both in FCD IIb and TSC lesions.

α-syn was expressed both in the cytoplasm of NeuN-positive neurons and nearby neuropils (Figure 2M) but not in GFAP-positive astrocytes (Figure 2N), Iba1-positive microglia (Figure 2O), and Olig2-positive oligodendrocytes (Figure 2P) in FCD IIb lesions. Interestingly, α-syn was not expressed in NeuN-positive neurons (Figure 2Q) in TSC lesions, GFAP-positive astrocytes (Figure 2R), Iba1-positive microglia (Figure 2S), and Olig2-positive oligodendrocytes (Figure 2T).

p-α-syn, in which α-syn is phosphorylated at Ser129, is the major pathological form of α-syn. The aggregation of p-α-syn in the cytoplasm and nuclei of neurons was identified as pathological markers of Parkinson's disease and multiple system atrophy in the central nervous system, respectively (50). We evaluated the immunoreactivity score of p-α-syn in the DNs, BCs, and GCs of FCD IIb and TSC lesions as well. As illustrated in Table 2, weak p-α-syn immunoreactivity was observed in the neurons of CTX and scored 2.86 ± 0.13. However, the immunoreactivity score of p-α-syn was significantly increased in the DNs and BCs of FCD IIb lesions, which scored 6.88 ± 0.67 and 7.86 ± 0.56, respectively (^***p < 0.001, unpaired two-tailed t-test), and DNs and GCs of TSC lesions, which scored 8.14 ± 0.86 and 5.43 ± 1.09, individually (^***p < 0.001, unpaired two-tailed t-test).

As shown by the representative images, weak-to-moderate immunoreactivity of p-α-syn was observed in neurons of CTX specimens (Figure 3A). In contrast, moderate-to-strong p-α-syn immunoreactivity was observed in DN (arrow), BC (double arrow), and glia-like cells (arrowheads) of FCD IIb lesions (Figure 3B). Strong p-α-syn immunoreactivity was detected in the cytoplasm and nuclei of DN (arrow) and glia-like cells (arrowheads) in TSC lesions (Figure 3C), while the intensity was relatively reduced in GC (double arrow) of TSC lesions (Figure 3D). Additionally, statistical analysis indicated the overall OD value of p-α-syn was increased in FCD IIb and TSC lesions (Figure 3E, ^***p < 0.001, unpaired two-tailed t-test), suggesting that α-syn was abnormally aggregated in the dysplastic neurons in cortical lesions of patients with FCD IIb and TSC.

Double immunofluorescent staining results showed that p-α-syn was identified in vimentin-positive BC (Figure 3F) and NeuN-positive neurons in FCD IIb lesions (Figure 3G). Additionally, p-α-syn was detected in the GFAP-positive astrocytes (Figure 3H) but not in Iba1-positive microglia (Figure 3I) and Oligo2-positive oligodendrocytes (Figure 3J) in FCD IIb lesions. Furthermore, co-expression of α-syn and p-α-syn was observed in DN (arrow) and BC (double arrows) in FCD IIb lesions (Figure 3K). Intense p-α-syn signal was detected in vimentin-positive BC in TSC lesions (Figure 3L), NeuN-positive neurons (Figure 3M), and GFAP-positive astrocytes (Figure 3N). However, p-α-syn signal was not detected in Iba1-positive microglia (Figure 3O) and Olig2-positive oligodendrocytes (Figure 3P) in TSC lesions. Additionally, p-α-syn was barely co-expressed with α-syn in TSC lesions (Figure 3Q).

N-methyl-D-aspartic acid receptor (NMDAR) plays important role in mediating glutamate-induced excitatory synaptic transmission in the central nervous system (51). The molecular composition of NMDAR was found to be altered in the cortical samples of patients with FCD and relevant animal models (31, 52–54). Studies have shown that α-syn could alter synaptic transmission and plasticity by interfering with different NMDAR subunits (55–58). Therefore, we wondered whether α-syn regulates the expression of primary NMDAR subunits NMDAR2A and NMDAR2B in the cortical lesions of patient with FCD IIb and TSC and of FCD rats.

First, we investigated the expression profiles of NMDAR2A and NMDAR2B in cortical lesions of patients with FCD IIb and TSC. As shown by the representative images (Figures 4A–C, E–G), in comparison with the immunoreactivity of NMDAR2A and NMDAR2B in CTX, NMDAR2A and NMDAR2B immunoreactivity were intensively increased in the dysplastic neurons of FCD IIb and TSC lesions. Statistical analysis results showed that the immunoreactivity of both NMDAR2A and NMDAR2B was significantly increased in FCD IIb and TSC lesions (Figures 4D, H). Furthermore, we verified the interaction of α-syn with NMDAR2A and NMDAR2B in cortical lesions of patients with FCD IIb and TSC with Co-IP. Representative images and immunoblotting bands (Figure 4I) showed that the interaction of α-syn/NMDAR2A was not significantly altered, but the α-syn/NMDAR2B complex was augmented in FCD IIb and TSC lesions. However, reverse verification bands showed that the NMDAR2A/α-syn complex was significantly augmented both in FCD IIb and TSC lesions (Figure 4J, upper panel). In comparison with the blotting bands of NMDAR2A, the expression of NMDAR2B was relatively weak in the homogenates of CTX, FCD IIb, and TSC lesions (Figure 4J, bottom panel). However, the NMDAR2B/α-syn complex was significantly strengthened both in FCD IIb and TSC lesions, suggesting strong interactions of α-syn with NMDAR2A and NMDAR2B in the cortical lesions of patients with FCD IIb and TSC.

Consistent with previous studies (9, 27), we utilized in utero X-ray radiated rats to replicate the pathological characteristics of FCD. We used RT-PCR to determine α-syn mRNA expression in the FCD rats first. Statistical analysis showed that α-syn mRNA was significantly reduced in FCD rats from 7, 14, to 28 days after birth (Figure 5A, ^**p < 0.01, unpaired two-tailed t-test). Pyramidal neurons in layer V are the principal output neurons in the cortex (59, 60). Thus, we explored the expression profiles of α-syn and p-α-syn in layer V of cortical lesions. IHC results showed that α-syn immunoreactivity was significantly reduced in layer V of cortical lesions in FCD rats from 7, 14, to 28 days after birth (Figures 5B, C). Conversely, IHC results showed that p-α-syn immunoreactivity was significantly increased in layer V of cortical lesions in FCD rats from 7, 14, to 28 days after birth (Figures 5D, E). As shown by the representative images, the appearance of the brain of X-ray-radiated rats (FCD rats) at 28 days after birth was dramatically deformed, illustrated by an apparent reduction in bulk volume, telencephalon, and cerebellum (Figure 5F). Furthermore, HE-staining results showed that the cortical structure was significantly disrupted, as shown by a much thinner cortex (indicated by the occurrence of corpus callosum) and non-obvious lamellar structure (Figure 5G), which was highly similar to the pathological characteristics of cortical dyslamination in FCD patients. Additionally, Western blotting results showed that α-syn protein expression was significantly reduced in FCD rats at 28 days after birth (Figure 5H).

Consistent with the experiments performed in FCD IIb and TSC patients, we investigated the expression of NMDAR2A and NMDAR2B in cortical neurons of layer V in FCD rats. IHC results showed that both the immunoreactivity of NMDAR2A and NMDAR2B were increased in the cortical neurons of FCD rats, as shown by the representative images and statistical results (Figures 6A–D) (^**p < 0.01, unpaired two-tailed t-test.). To test whether α-syn interacts with NMDAR2A and NMDAR2B, we performed Co-IP to investigate the interaction between α-syn and NMDAR2A and NMDAR2B. As shown by the representative immunoblotting bands (Figure 6E), this qualitative approach suggested an augmentation in the levels of the α-syn/NMDAR2A and α-syn /NMDAR2B complex in FCD rats at 28 days after birth, and IgG was used as negative control. Reverse Co-IP was performed to confirm the interaction of NMDAR2A and NMDAR2B with α-syn. As shown by the representative immunoblotting bands (Figure 6F), the NMDAR2A/α-syn complex did not significantly differ between control and FCD rats by pulling down NMDAR2A, whereas the NMDAR2B/α-syn complex was intensified in FCD rats at 28 days after birth.

We also investigated the interaction of α-syn and NMDAR in FCD and control rats at postnatal 7 days and 14 days. At 7 days after birth, as shown in representative immunoblotting bands (Supplementary Figure S1A), α-syn/NMDAR2A complex and α-syn/NMDAR2B complex were reduced in the FCD rats. Reverse immunoblotting bands (Supplementary Figure S1B) showed that the NMDAR2A/α-syn complex did not significantly differ between the control and FCD rats by pulling down NMDAR2A, while the NMDAR2B/α-syn complex was augmented. At 14 days after birth, the immunoblotting bands (Supplementary Figure S1C) indicated that both α-syn/NMDAR2A complex and α-syn/NMDAR2B complex were intensified in the FCD rats, while reverse Co-IP immunoblotting bands (Supplementary Figure S1D) showed that NMDAR2A/α-syn and NMDAR2B/α-syn complex were reduced in the FCD rats. Together, these results suggested that α-syn might contribute to regulating the synaptic transmission in FCD rats by interfering with NMDAR from an early developmental stage.