Fibroblasts (GM22369, GM21752, and GM22600) were purchased from The Coriell Institute (Table 1). All diseased VCP/p97 iPSC were derived from R155H/+ patients’ own fibroblast cells and were compared to a related, unaffected control group (GM22246).

Human iPSCs (hiPSCs) were generated using episomal plasmids containing the following genes: Oct4 (pCE-oct3/4, Addgene #27076), Sox2 and Klf4 (pCE-hSK, Addgene #27078), c-myc and LIN28 (pCE-hUL, Addgene #27080), Dominant-negative p53 (pCE-mp53DD, Addgene #41856) and EBNA1 (pCXB-EBNA1, Addgene #41857). Nucleofection was performed using the Amaxa Human Stem Cell Nucleofector kit (Lonza, VPH 5002). Post-transduction cells were cultured in TeSR™-E7™medium (Stem Cells # 5914) for 10 days before culture in mTESR basal medium (Stem Cells #05850). Colonies were picked and expanded in mTESR basal medium in matrigel-coated plates (Corning #354277).

Human iPSCs were fixed with 4% paraformaldehyde (PFA) at room temperature (RT) prior to staining using the Alkaline Phosphatase (AP) detection kit (Cell Biolabs Inc. # CBA-300) according to the manufacturer’s instructions.

Human iPSCs were fixed in 4% PFA at room temperature and then stained with antibodies against the following makers: Oct3/4 (1:500 dilution Abcam #ab27985) and SSEA-4 (1:100 dilution Abcam# ab16287) and AlexFluor-488 conjugated antibodies against human TRA-1-60 (1:100 dilution BD Pharmigen #560173) in 0.1% Triton (Fisher X-100) and and 1% Fetal Bovine Serum (FBS) in PBS. For secondary antibodies goat IgG (1:250 in PBS, Invitrogen #A11055) and mouse IgG (1:250 in PBS, Invitrogen #A11055) were used to detect Oct3/4 and anti-SSEA-4, respectively. Cell nuclei were counterstained with Hoechst 33342 (10 ng/mL of Thermo Scientific #H1399).

gRNA and DNA templates were purchased from Integrated DNA technology (IDT) as follows: Guide RNA 5′-CCACAGCACG CATCCCACCA-3′), H155R-Reverse Complement 5′-ATCTGTTT CCACCACTTT GAACTCCACAGCACGCATGCCACCACGTACA AGAAAAATGTCTCCTGCGAGAGCAAACAGTA-3′), (R155H- Reverse Complement 5′-ATCTGTTTCCA CCACTTTGAACTC CACAGCACGCATGCCACCA TGTACAAGAAAAATGTCTCC TGCGAGAGCAAACAGTA-3′. Briefly, a pre-annealed mixture of Atl^® CRISPR-Cas9 crRNA Guide 1, tracrRNA ATTO™550 [(200 μM each, IDT #1075928), and Atl^® S. p. HiFi Cas 9 Nuclease V3(IDT, cat #1081061] were prepared following manufacturer instructions. The Ribonucleoprotein (RNP) complex was prepared by mixing 240 pmol of Atl′ CRISPR-Cas9 crRNA Guide 1 + CRISPR-Cas9 tracr RNA ATTO^™550, 208 pmol of Alt-R^® Cas9 enzyme, and 240 pmol of 100 μM Ultramer DNA Oligo (Integrated DNA Technology). Before nucleofection, 10.8 μM of Alt-R^® Cas9 Electroporator Enhancer was added to the nucleofection mixture and integrated into cells. The emission of red light indicates the introduction of the CRISPR/Cas9 complex into the cells by the tracrRNA-ATTO and the yield of the transfection. The cells were let to grow for a few days and then dissociated into single cells for clonal selection.

iPSC DNA (~310 bp) was amplified by PCR (Platinum SuperFi PCR Master Mix, Invitrogen #12358) using custom Reverse primers (IDT). Primers (VCP-Ex5-F 5′-TGGAGTTGGGGAGAGGTAGGG-3′, and VCP-Ex5-R 5′-AAAATCGGATACTGGAATCAGGGAGA-3′). PCR product was digested with Sph1 HF (New England Biolabs #R3182L), and clones positive for the Sph1 digestion were purified using agarose gel (Qiagen, #28704). Before sequencing, amplicons were treated with Exonuclease I (10 U Thermo Fisher Scientific # EN0581) and FastAP™ Thermosensitive AP (1 U, Thermo Fisher Scientific #EF0654). The samples were mixed and incubated at 37°C for 15 min, followed by incubation at 85°C for 15 min. Samples were sent for sequencing and analyzed using the software FinchTV (Geospiza, Inc., WA, United States) (23).

The doxycycline (Dox)-inducible PAX7 system consisted of two lentiviral vectors: the rtTA-FUGW lentivirus that carries the reverse tetracycline transactivator and hPAX7-pSAM2 that carries the tetracycline response element (TRE-promoter) to control hPAX7 induction and ires-GFP (19). Viruses were generated by cotransfection with packaging plasmids in 293 T cells (24). The virus supernatant was collected at 24- and 48 h post-transfection and concentrated by centrifugation (22,000 g for 2 h). iPSCs were transduced using 13 MOI for pSAM2-PAX7 (calculated on 293 T cells) using spin infection (centrifugation at 2,600 g for 1.5 h and 4 h recovery). A transduction rate greater than 20% GPF-positive cells was used in the downstream experiments.

For skeletal muscle differentiation we used previously published method (20). Briefly, embryoid bodies (EBs) were generated in mTESR and then grown using EB differentiation medium (IMDM (1X) + GlutaMAX^™-I, Gibco #31980-030) supplemented with 15% FBS (Atlanta #S11150), 10% Horse Serum (Gibco #26050-088), 4.5 mM Monothyoglycerol (Alfa Aesar), 25 mg of Ascorbic Acid (Acros, Organics), 100 mg of human Holo-Transferrin (RD System #2914-HT), and 1% Penicillin/Streptomycin. To perform myoblasts differentiation, we induced Pax7 expression using 0.75 mg/mL Doxycycline for 4 days (Millipore Sigma # D9891) in EB medium. After 7 days of differentiation, EBs were plated as a monolayer culture, and we isolated GFP and PAX7-positive myoblasts using FACS sorting (BD FACS Aria III). Cells were then expanded and terminally differentiated into myotubes using the myotube differentiation medium: DMEM low glucose (Gibco #11885–084), supplemented with 20% of KnockOut SR (Gibco, #10828–028), 10 mM of SB431545 (Cayman Chemical #13031), 10 m of DAPT (Adipogen), and 1% Penicillin/Streptomycin.

To evaluate the efficiency of myoblast formation, we stained the expanded myoblasts with α-Alpha 7 integrin-PE (AbLab, Cat #67–0010-05) and α-human CD29-APC (eBioscience #17–029942) as previously described (25).

Myotubes were fixed in PFA 4%, permeabilized with 0.3% Triton X-100 in PBS for 20 min at room temperature and stained using a primary antibody against MF-20 (1:20, Developmental Studies Hybridoma Bank – DSHB) and an Alexa-Fluor 555-tagged secondary antibody anti-mouse (1:250, Invitrogen #A28180). Nuclei were stained with Hoechst, and imaging was performed using Evos FL Fluorescence microscope.

Total RNA was extracted using the kit Direct-zol^™ RNA Miniprep Plus (Zymo Research #R2072) following the manufacturer’s protocol. The cDNA was synthesized using 1 μg of the total RNA with the reverse transcriptase (Bioline, Sensi FAST Kit). Gene expression levels were measured by RT-PCR using the cDNA with the Sensi-Fast Hi-Rox Kit (Bioline #Bio-82,020). The target genes’ relative expression was normalized to that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH Hs02786624-g1 20x Applied Biosystem). The expression of the following genes was analyzed PAX3 (Hs00240950), Myf5 (Hs00929416-g1), MyoD1(Hs02330075-g1), and Myogenin (Hs01072232-m1, Applied Biosystems).

Data were expressed as mean +/− SEM, and statistical significance was measured using the unpaired Student’s t-test. The statistical significance was set at p ≤ 0.05.

Protein samples and dual plus molecular weight ladders were separated by SDS-PAGE using Precast Gels with a 4–15% gradient (Bio-Rad #4561083). Proteins were transferred to nitrocellulose membranes (Bio-Rad #170–4,159) using the Bio-Rad Trans-Blot Turbo Transfer System for 7 min. Total proteins on membranes were detected using the Ponceau S staining. Membranes were blocked with 5% non-fat milk in TBS-T and incubated with primary antibodies against human Myf5 (Abcam #125301), and MyoD1 (Abcam #16148) in TBS-T with 2.5% non-fat milk at 4°C overnight. HRP-conjugated secondary antibodies (1:3000), anti-rabbit-HRP (Invitrogen #31460), and anti-mouse HRP (Invitrogen #31430) were used, were incubated with the membrane in TBST with 2.5% non-fat dry milk for 1 h at room temperature. Membranes were exposed to the chemiluminescence reagent (Millipore #WBKLS0500) for 2 min at room temperature and visualized using Chemidoc (Bio-rad).

Myotubes from each Group were lysed using a lysis buffer (10 M Urea, 40 mM HEPES pH 7.5, 200 mM NaCl) containing a Protease & Phosphatase Inhibitor Cocktail (Fisher #78440) and 10 mM MG132. Proteins were digested in MS buffer (0.1 M Tris–HCl, Boston BioProducts #BT-P-920) containing 0.5 M TCEP (Fisher #20491, prepared in MS buffer), 0.5 M 2-chloroacetamide (MP Biomedicals #ICN15495580), 0.25 μg/μL Lys-C (FujiFilm Wako Chemicals United States Corporation #125–05061, prepared in MS grade water), incubated at 37°C for 4 h with shaking at 750 rpm; 100 mM CaCl₂ and 0.5 μg/μL Trypsin (Fisher #90058) were added to the samples and incubated at 37°C for 20 h with shaking at 750 rpm. The digested samples were then desalted using C18 columns (Fisher #89870) and dried using a vacuum centrifuge. Before running mass spec samples, samples were dissolved in 0.2% FA solution, and peptide concentration was tested through Pierce Quantitative Fluorometric Peptide Assay (Fisher #23290). LC–MS/MS experiments were performed using an EASY-nLC 1,000 connected to a Q Exactive Orbitrap Mass Spectrometers (Fisher). 0.25 μg sample was loaded onto an Easy Spray Column (25 cm x 75 μm, 2 μm C18, ES802, Fisher) and separated over 195 min at a flow rate of 0.5 μL/min with the following gradient: 2–35% B (180 min), 35–85% B (5 min), and 85% B (10 min). Solvent A consisted of 99.9% H₂O and 0.1% formic acid, and solvent B consisted of 19.9% H2O, 80% ACN, and 0.1% formic acid. A full MS scan was acquired at 70,000 resolutions with a scan range of 350–2000 m/z, the AGC target was 1 × 106, and the maximum injection time was 100 ms. MS2 scan was acquired at 17,500 resolutions with a scan range of 200–2000 m/z, the AGC target was 5 × 104, the maximum injection time was 64 ms, and the isolation window was 2.0 m/z. System control and data collection were performed by Xcalibur software.

Proteomic data processing was performed through Proteome Discoverer 1.4 (Fisher) using the Uniprot human database and the Sequest HT Search Engine. The search allowed for a precursor mass tolerance of 10 ppm, a minimum peptide length of 6, and a minimum peptide sequence number of 1. Upon identification of dysregulated protein expression levels from the control sample and correction for false discovery rate (t-test <0.05), we analyzed interaction protein using the STRING program.

We generated hiPSCs from three human fibroblasts harboring the p97/VCP ^{R155H +/−} mutation and from one unaffected related control. Successfully reprogrammed hiPSCs were validated with Alkaline Phosphatase assay and the SSEA-4, TRA-1-60, and Oct4 markers, confirming their pluripotency (Figures 1A,B and Supplementary Figures S1A,B). All clones derived from a specific patient were labeled as belonging to the same Group. Selected hiPSC p97/VCP^R155H+/− clones were corrected to p97/VCP^isoWT using the CRISPR/Cas9 and homology recombination (HR) as previously described (26–28). The mutation R155H/+ is in the exon 5 of the VCP/p97 gene (Figure 1C). We used a homologous recombination DNA template containing a Guanidine (G) in codon CGT (coding for Arginine) to replace the Adenine (A) in codon CAT. The DNA template also had a missense mutation for Glycine to introduce the Sph1 digestion site and a missense mutation for Valine, V (GTA) to disrupt the PAM sequence (Figure 1D). To generate p97/VCP R155H from isogenic Control, we prepared a similar DNA template containing the CAT codon to replace histidine in the arginine 155 (Figure 1E). Successful modifications were verified through sequencing (Figure 1F).

hiPSC clones from Control and R155H/+ groups (for a total number of 8 lines) were differentiated into skeletal muscle following a multi-step schematic protocol that included transduction of the hiPSCs with an inducible PAX7 expression, Embryoid Bodies (EBs) formation, purification, and expansion of myogenic precursors, and finally the formation of the multinucleated muscle fibers or myotubes (Figure 2A) (20). Diseased and isogenic control iPSCs were successfully differentiated into myoblast expressing PAX7 (GFP+ cells), CD29, and alpha-7 integrin (Figures 2B,C). Further differentiation was performed to generate multinucleated myofibers expressing skeletal muscle marker MHC (Figure 2D). The same procedure was applied to the cells of all other iPSC groups 2–4 (Supplementary Figures S2A–I).

Next, we measured gene expression of the myoblast’s progenitor markers PAX3 and MYF5 and of differentiated myoblasts MYOD1 and MYOGENIN in both Control vs. diseased myoblast. Our results reveal that p97/VCP^{R155H +/−} myoblasts had lower expression of PAX3 and MYF5 than controls and that p97/VCP^{R155H +/−} myotubes had a significative lower expression of MYOD1 (Figure 2E). We obtained similar results with all 4 groups (Supplementary Figure S2J). Using Western Blot analysis, we assessed MYF5 and MYOD1 protein levels in myoblasts and myotubes in Group 1 cells. We detected higher levels of MYF5 protein in the p97/VCP^{R155H +/−} lines, but it did not reach statistical differences. MYOD remained unchanged (Figures 2F,G). The proteins MYF5 (28KDa) and MYOD1 (35KDa) are shown in cropped blot images (Figures 2F,G), and their corresponding full-length blot images are shown as well (Supplementary Figures S5A,B).

To investigate the global differences in IBMPFD/ALS myotubes, we performed an unbiased proteomic analysis in group 1. Proteomic analysis revealed dysregulated protein (p value < 0.05) shown in the Volcano plot. Red dots represent upregulated proteins, and the green dots are down-regulated proteins (Figure 3A). Similar pattern of dysregulated myotubes is present in groups 1–4 (Supplementary Figure S3A). Pathway analysis showed that many dysregulated proteins are involved in skeletal muscle, intracellular organelles, cytoskeleton organization, cellular communication, and signaling. Each pathway comprises serial sub-pathways that specify the protein functions (Figure 3B and Supplementary Figure S3B).

The myopathy described in IBMPFD/ALS leads to muscle weakness (1, 2). We found that several constituents of the skeletal muscle architecture, including myosin, troponins, and tropomyosin, as well as several involved in muscle contraction, were downregulated in p97/VCP^{R155H +/−}. Other proteins involved in muscle filament sliding, sarcomere organization, myosin complex, and phosphatase activity were downregulated. In addition, several proteins required in the reuptake of cytosolic calcium into the sarcoplasmic reticulum and in calcium-binding function were downregulated. In contrast, proteins involved in actin stress, a mechanism of myosin and actin contraction in non-muscle fibers, were upregulated (Figure 4A). It was also proposed that the actin stress function as the template for sarcomere formation in cardiac cells, suggesting that diseased cells may not fully differentiate into mature sarcomere (29, 30). A similar protein expression pattern was found in the myotubes of groups 1–4 (Supplementary Figure S4A).

p97/VCP is crucial for autophagosome maturation (4, 8), and multiple studies report that VCP/p97 mutants impair autophagy mechanisms (9, 16). We found several proteins involved in lysosomal homeostasis and endosome recycling that were downregulated in diseased myotubes. On the contrary, proteins involved in vesicular trafficking and clathrin endocytosis were upregulated (Figure 4B). Our data show that mutation of VCP/p97 in IBMPFD disrupts mTOR signaling, a serine/threonine kinase that contributes to myopathy and which has been showing to worsen the severity of the disease (18) (Figure 4B). Proteins with very similar biological functions were also found in the myotubes groups 1–4 (Supplementary Figure S4B).

Dysfunction in mitochondria, unique organelles essential for various cellular processes such as energy metabolism, calcium homeostasis, lipid biosynthesis, and apoptosis, is a known prevalent feature of many neurodegenerative diseases and motor neuron disorders such as ALS. Disruption of mitochondria structure, dynamics, bioenergetics, and calcium buffering has been extensively reported in ALS patients (31). In diseased myotubes, we found that several proteins involved in the formation of mitochondrial respiratory complexes were downregulated. In contrast, proteins involved in glycolysis and assembly of complex 1 were upregulated, suggesting an enhancement of glycolysis mechanisms as compensation for dysfunctional mitochondria. In addition, proteins relevant for mitochondrial translation, DNA inheritance, and protein import were downregulated, indicating dysfunctional mitochondria (Figure 4C and Supplementary Figure S4C). Finally, proteomic data of diseased myotubes revealed that proteins involved in cellular stress responses, such as DNA repair, protein degradation, and protein folding, were dysregulated (Supplementary Figure S4D) (12, 14, 32). p97/VCP also has a chaperone function, and its mutations interfere with cellular methylation, affecting numerous protein features such as turnover, activity, and molecular interactions (13). Some dysregulated proteins promote p53/TP53 degradation and protein degradation (Supplementary Figure S4D).