α-Asarone, lipopolysaccharide (LPS), lithium chloride, pilocarpine, methylscopolamine, and 3-(4,5-dimethylimidazole-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) were provided by Sigma-Aldrich (St. Louis, MO, USA). Phosphatase inhibitor and protease inhibitor cocktail tablets were purchased from Roche (Indianapolis, IN, USA). Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco-BRL Technologies (Carlsbad, CA, USA). NF-κB pathway sampler kit was purchased from Cell Signaling Technology (Danvers, MA, USA).

Adult male Sprague-Dawley (SD) rats weighing 200–250 g were supplied by Chongqing Medical University (Chongqing, China). The rats were housed under controlled standard conditions (23 ± 2°C; 55 ± 20% humidity; 12:12 light/dark cycle with lights on at 7 a.m.). Food and water were available ad libitum. All efforts were made to minimize animal suffering and reduce the number of animals used in the experiments. All experiments were performed in accordance with the rules established by the Experimental Animal Administration Committee of the University and with the National Institutes of Guide for Care and Use of Laboratory Animals (NIH Publications no. 80-23, revised 1985).

All SD rats were divided randomly into the control group, the SE-induced group (SE group) and SE-induced α-asarone pretreated group (SE-asarone group). The SE and the SE-asarone group rats were injected with lithium chloride (127 mg/kg of body weight, i.p.). Methylscopolamine bromide (1 mg/kg of body weight, i.p.) was administered approximately 20 h later to limit the peripheral effects of pilocarpine. Pilocarpine hydrochloride (40 mg/kg of body weight, i.p.) was injected 30 min after methylscopolamine administration. Seizure activity associated with SE commenced 20–40 min after pilocarpine administration. Behavioral changes were recorded and graded according to the Racine’s scale (28). To improve survival, diazepam (DZP, 2 mg/kg of body weight, Hubei, China) was injected 2 h after SE induction. The rats in the SE-asarone group were administered α-asarone (100 mg/kg, i.p.) 1 h before administration of pilocarpine as described by Chen et al. (24). On the other hand, the rats in the control group were injected with lithium-methylscopolamine followed by saline as a substitute to pilocarpine. These rats also were administered with the same dose of DZP injection after saline injection 2 h, similarly to the other two groups. All SD rats were injected with 0.9% saline (10 ml, twice a day, i.p.) as well as fed water-soaked feed until they were able to eat normal dry food pellets (29) to restore volume loss associated with SE. SD rats which did not develop class 4 or 5 seizures according to Racine’s scale or died were excluded from follow up analysis.

Spatial learning and memory were assessed using the Morris water maze (MWM) task, 4 weeks after pilocarpine treatment. The MWM apparatus consists of a black circular pool (180 cm diameter, 45 cm high) filled with water (30 cm depth) at 26 ± 1°C. The pool is virtually divided into four equivalent quadrants, with a submerged escape platform (12 cm diameter) placed in the middle of one of the quadrants, equidistantly from the sidewalls, and the center of the pool, 1 cm below the water surface. Styrofoam pieces are afloat on the water to make the platform invisible. All rats were trained to escape the water by finding the platform in a series of four training sessions in 5 consecutive days and a final test was performed 24 h after the last training session. For each training session, all rats were randomly placed into one of the four quadrants facing the wall by a blinded observer. Each rat was given 120 s to find and mount the platform. The training session was considered finished after the rat successfully reached and climbed onto the hidden platform, where it was allowed to rest for 20 s. For each rat, the escape latency was recorded. Alternatively, the trial was also terminated if the rat failed to reach and/or climb onto the platform within the 120 s. In these cases, the blinded observer rescued the rat onto the platform an escape latency of 120 s was recorded. One day after the last training session, a probe trial was conducted in which the escape platform was removed from the pool. Each rat was allowed to swim for 120 s and the time spent in each quadrant was recorded.

Seven days after SE inducement, all rats were video monitored daily from 8 a.m. to 18 p.m. for a 4-week period, in order to record the occurrences of spontaneous recurrent seizures (SRS). The severity of the seizures was assessed using the Racines scale and the Veliskova scoring system (28, 30). The latency period (days), seizure frequency (times per day), and behavioral score were also recorded. All video recordings were done during the light period, only Racines’ class 4 or 5 seizures were analyzed. The recordings were analyzed by two experimental observers who were blind to group allocation.

Three days after SE, brain tissues of five rats were grinded with 1 ml/g 0.9% NaCl. Subsequently, 0.5 ml homogenate was taken and extracted by 1.5 ml methyl alcohol, then the brain tissue extractions were dried by nitrogen at 40°C, the dried powders were dissolved to solutions by methyl alcohol (internal standard by 10 µg/ml 4-methoxybenzophenone). After that, the solutions were centrifugated and the liquid supernatants were finally retained. Meanwhile, α-asarone solutions with concentrations of 0.4, 4, 8, 16, 32, and 64 µg/ml (dissolved by methyl alcohol and internal standard by 10 µg/ml 4-methoxybenzophenone) were also prepared. The solutions were analyzed by high performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS, HP110, Shanghai, China), each peak area of α-asarone was recorded. Linear regression of peak area vs. concentration was conducted, and the concentration of α-asarone in the brain was calculated by the regression equation.

Microglial cells were isolated from cultures of newborn rat brains according to a method previously described (31, 32), with minor modifications. Briefly, cerebral cortices were isolated from 1 to 2 days old SD rats, stripped of the meninges, dissociated by trituration, and digested in the presence of 0.25% trypsin for 30 min at 37°C. The cortical fragments were resuspended in DMEM containing 10% FBS, 100 IU/ml penicillin, and 100 mg/ml streptomycin. Fragments were made into single cell suspensions by repeated pipetting. The cell suspensions were plated in 75 cm² flasks at a density of 4 × 10⁶/ml at 37°C under a humidified 5% CO₂ and 95% air atmosphere for 10–14 days with medium replaced every 3 days. Microglia were harvested by gentle shaking at 37°C for 4 h. Cultures with >95% purity of microglia (identified by a CD-68-specific antibody) were used for follow-up experiments.

Cell viability was determined by the salt 3-[4,5-dimethylthiazol-2-yl]-2, 5-diphenylα-asaronerazolium bromide (MTT) assay. Briefly, microglial cells were plated into 96-well plates at a density of 1 × 10⁵ cells per well for 24 h and incubated with various concentrations of α-asarone (25, 50, and 100 µg/ml) for 1 h before treatment with LPS (1 µg/ml) for another 24 h. Then the cells were incubated with MTT (0.5 mg/ml added to each well), 4 h at 37°C, 5% CO₂. After this incubation period, the supernatant was removed from each well; the colored formazan crystal produced from MTT was dissolved in 0.15 ml DMSO, The absorbance values were measured at 570 nm using a multiscanner autoreader.

The electrophoresis mobility shift assay (EMSA) for nucleoprotein extracts (10 µg) was performed using the Odyssey Infrared EMSA Kit (LI-COR, USA) according to the manufacturer’s instructions (33). Two oligonucleotides probes (wild-type NF-κB consensus-forward and repetitive SET NF-κB-forward) were labeled with IR700 dye (Bioneer Corporation, USA) and annealed to generate double-stranded probes at a final concentration of 0.01 pmol/μl. The binding reactions were incubated with NF-κB specific probe or mutant probe for 20 min at room temperature, and the mixture were isolated in a 4% Tris-glycine-EDTA gel for 70 min run at 70 V in darkness. Then the gel was scanned using the LI-COR Odyssey system (LI-COR, USA) at a wavelength of 700 nm. The wild-type NF-κB consensus oligonucleotides (forward: agttgaggggactttcccaggc and reverse: gcctgggaaagtcccctcaact) and mutant NF-κB consensus oligonucleotides (forward: agttgaggccactttcccaggc and reverse: gcctgggaaagtggcctcaact) probes were a gift from Dr. Song Weihong (Chongqing Medical University, China).

The content levels of TNF-α and of IL-1β in the brain tissue supernatant of rats (n = 5 at each time point) and in the protein lysate of cultured microglia from the control and the SE and SE-asarone groups (in vivo and in vitro) were determined with ELISA kit (USCN, Wuhan, China), according the manufacturers’ to instructions. Total protein samples were extracted and total protein concentration was determined using an enhanced BCA Protein Assay kit (Beyotime, Harman, China) before the ELISA. Protein concentration measures obtained by ELISA were in assessed in duplicates and normalized using the samples initial total protein concentration. The results were expressed as pg/mg of protein.

Total protein was extracted from the hippocampus and the adjacent cortex as well as from cultured microglia with RIPA Lysis Buffer (Beyotime, Harman, China) containing protease inhibitors. A total of 30 µg of total protein was loaded onto the sodium dodecyl sulfate-polyacrylamide gel and separated by electrophoresis (Bio-Rad, CA, USA). The protein bands were transferred onto 0.20 µm polyvinylidene difluoride (PVDF) membranes (Bio-Rad, CA, USA) and then probed with different primary antibodies: p-IKK (1:500), IKK (1:1,000), p-IκB-α (1:500), inhibitor kappa B-alpha (IκB-α, 1:1,000), iNOS (1:500), and COX-2 (1:500) (CST, USA). The PVDF membrane was incubated with the respective antibodies overnight at 4°C. Subsequently, the membranes were incubated with the appropriate secondary antibodies for 1 h at room temperature after washings with Tris-buffered saline with Tween (Sigma-Aldrich, USA). As a protein loading control, the membranes were incubated with monoclonal rat anti-GAPDH (1:10,000) (Sigma-Aldrich, USA). Immunoreactive bands were visualized by enhanced chemiluminescence (Bio-Rad, USA).

At various time-points after SE induction, the rats were deeply anesthetized with pentobarbital sodium (50 mg/kg) and heart perfused with ice-cold 0.9% NaCl followed by chilled 4% paraformaldehyde in 0.01 M PBS as described previously (34). After perfusion, brains were removed promptly and postfixed (paraformaldehyde) for 24 h at 4°C. After overnight incubation in a solution of 30% sucrose in 0.1 M PBS for cryoprotection, transverse 30 µm thickness sections were cut from frozen blocks with a sliding microtome. Serial coronal sections were cut through the dorsal-ventral extension of the hippocampus (at a level corresponding to 2.8–4.5 from Bregma). Every sixth section of the hippocampus was selected for quantitative immunohistochemical analysis as previously described (35).

Immunohistochemical staining was performed using the avidin–biotin peroxidase complex detection kits (Zhongshan Golden Bridge, Beijing, China) according to the manufacturer’s instructions. Sections were incubated with CD-68 (Abcam, USA) overnight at 4°C. Negative control samples were also prepared by incubating the sections with PBS without antibodies and appropriate avidin–biotin complex solutions at 37°C for 20 min for IHC detection.

Images of the hippocampal CA1, CA3, and the adjacent cortex areas were captured using an OLYMPUS PM20 automatic microscope (Olympus, Tokyo, Japan). Cells were viewed with a 100× objective. A blinded operator oblivious to the identity of the section, assessed the total number of CD-68 cells stained in the predefined areas (400 μm × 400 μm) using an image analysis system (Image-Pro Plus Media Cybernetics, Silver Spring, MD, USA) to generate an automated cell count. An average of 10 sections per rat were analyzed. In all regions, cells which were morphologically intact and clearly identifiable were counted. The cell values of counted in the right and left hemispheres of the section were averaged as there was no significant difference in cell configuration between the two hemispheres. The number of positive cells in 10 sections was averaged to obtain a mean value for each animal. Two observers blinded to group allocation collected the data.

All data were presented as the mean ± SE for each independent experiment. Differences between groups and conditions were assessed using the Tukey multiple comparison test. One-way analysis of variance (ANOVA) was used to detect differences between groups. All statistical analyses were performed using the software SPSS 19.0, and the level of significance was set at p < 0.05.

The effect of α-asarone on the SE-induced cognitive function was evaluated using a water maze test 4 weeks after the pilocarpine injection. Results showed that the escape latency of the SE-induced rats was significantly higher than that of the saline-treated rats (control group), whereas pretreatment with α-asarone (SE-asarone, 100 mg/kg, i.p.) dramatically shortened escape latency, from the first training session (Figure 1A). We normalized escape latency values of each training session against the escape latency values observed on the first training session. Twenty-four hours after the last learning trial, a probe test where the submerged platform had been removed from the pool, was performed. The results showed that the SE rats pretreated with α-asarone spent much more time (SE-asarone, 40.5 ± 3.4 s) in the target quadrant (where the submerged platform had been placed during the training sessions) than the rats in the SE group (27.5 ± 2.6 s) (Figure 1B). These results indicate that α-asarone significantly improved the cognitive impairment induced by SE.

All the rats were monitored to record SRSs, and no seizures were recorded at any time in the control group. The latency, frequency and behavioral score of SRSs were recorded in the SE group and in the SE-asarone groups. As shown in Figure 2, the average latency of seizure was 12.13 ± 1.41 s in the SE group and 18.36 ± 1.62 s in the SE-asarone group, respectively (Figure 2A). Compared with the SE group, pretreatment with α-asarone significantly reduced the behavioral score (5.27 ± 0.38 and 3.06 ± 0.27 in the SE and SE-asarone group, respectively, Figure 2B) and the frequency of seizures (15.16 ± 2.13 and 11.07 ± 1.67 times per day in the SE and SE-asarone group, respectively, Figure 2C). Together, these results indicate that α-asarone dramatically alleviate epilepsy.

To determine the influence of SE on the activation of microglia in the hippocampal CA1, CA3, and the adjacent cortex, we used microglia marker CD-68 to stain microglia in all groups at 3 days after SE induction. Results showed that CD-68-positive cells significantly increased in the SE group (Figures 3B,E,H) compared to the control group (Figures 3A,D,G), whereas pretreatment with α-asarone before SE induction (Figures 3C,F,I) dramatically decreased CD-68-positive cells, even though the number of CD-68-positive cells in this group was still much higher than that of the control group. These results indicate that pretreatment with α-asarone greatly alleviated the activation of microglia after SE induction in the predefined areas of the hippocampal CA1, CA3 and the adjacent cortex (Figures 3J–L).

The NF-κB pathway activation requires degradation of IκB-α, I kappaB kinase-β (IKK-β), and a subsequent nuclear translocation of the free NF-κB (p65). Here, the free NF-κB activates of genes with NF-κB binding sites. Therefore, the effect of α-asarone on the activation of NF-κB pathway in the hippocampus and cerebral cortex following SE induction was investigated by EMSA and Western blot analysis. Our results show an increase in degradation of IκB-α, IKK-β after SE induction, following by translocation of the NF-κB p65 subunit to the nucleus. Pretreatment with α-asarone restrained IκB-α, IKK-β degradation, thus blocking the translocation of the NF-κB p65 subunit to the nucleus (Figure 4).

The iNOS and COX-2 protein expression were assessed in the brain tissue at 3 days after SE induction by Western blot. Our results show that iNOS and COX-2 protein expression in the SE group were significantly higher than those of the control group. Levels of iNOS and COX-2 protein expression in the SE group pretreatment with α-asarone were significantly lower than those of the SE group, though still much higher than those of the control group (Figure 5). These results indicate that α-asarone might significantly decrease iNOS and COX-2 expression after SE induction.

The proinflammatory cytokine (IL-1β and TNF-α) production in the brain tissue at 3 h, 24 h, 3 days, and 7 days after SE was examined by ELISA. Our results showed that at 3 days following SE, the IL-1β and TNF-α concentration markedly reached a high level in the SE model group compared with the control group (Figures 6A,B). On the other hand, the protein expression levels of IL-1β and TNF-α in the SE-asarone were significantly decreased in the brain region examined (Figures 6C,D).

Concentrations of α-asarone in the brain of the rats were measured by HPLC-MS/MS. Each peak area of α-asarone in brain tissue extraction solutions and α-asarone solutions with various concentrations was recorded during the measurement. Then linear regression of peak area ratios of α-asarone solutions vs. concentrations was conducted (as shown in Figure 7). The regression equation was as follows: Y=0.1801X+2.246.

The concentration of α-asarone in brain tissues was calculated by plugging the recorded peak area of α-asarone in brain tissues extraction solution in to the regression equation. And the calculated concentration was 34.9 ± 2.1 μg/ml, which was in line with the range of dose in vitro.

The cytotoxic effects of α-asarone were examined with an MTT assay by measuring the cell viability of primary rat microglia. Cells were incubated with various concentrations of α-asarone (25, 50, and 100 µg/ml) for 1 h in the presence or absence of LPS (1 µg/ml). There was no significant difference in cell viability between the microglia in the serum-free DMEM-treated controls and the microglia treated with α-asarone or LPS (Figure 8), which confirms that the inhibitory effect of α-asarone on microglia activation was not due to cytotoxicity.

In general, CD-68 only mark activated microglia. Once activated, the cells could be presented clearly under fluorescent. As we can see in Figure 8, after LPS (1 µg/ml) stimulation, cells were activated and pretreatment with α-asarone (25, 50, and 100 µg/ml) could alleviate LPS-stimulated microglia activation (Figures 9C–E). Comparison between groups using ANOVA revealed that the number of activated microglia in the LPS-induced group (Figure 9B) was significantly increased compared to that in the control group (Figure 9A). However, this increase was reversed in the LPS-asarone group (Figure 9F), which means that α-asarone can effectively block the LPS-stimulated microglia activation.

An increasing number of studies have shown that LPS increases NF-κB subunit activation (36). In order to measure the effect of α-asarone on the DNA binding activity of NF-κB in LPS-induced primary rat microglia, we undertook an EMSA assay. Our results show that NF-κB activation was only markedly induced in the LPS group and that α-asarone significantly reduced LPS-induced NF-κB activation in a dose-dependent manner compared with the control group (Figure 10). These results demonstrate that α-asarone alleviates NF-κB activation in LPS-stimulated primary microglia which might help to explain the mechanism underlying the anti-inflammatory effect of α-asarone.

Next, we focused our attention on the upstream targets of the NF-κB signaling pathway. Western blots showed a significant increase in the phosphorylation levels of IκB-α and IKK-β and an increase in degradation of IκB-α, as well as an increase in IKK-β (kinase) in primary rat microglia at 3 h after LPS exposure which returned to basal levels almost at 24 h later (Figure 11A). However, upon pretreatment with α-asarone, the protein expression levels of phosphorylated IκB-α decreased, the enzyme activation level of IKK-β decreased, followed by a reduction in degradation of the NF-κB/IκB-α dissociation products (p-IκB-α) (Figure 11B).

To determine the effect of α-asarone on iNOS and COX-2 expression in primary microglia stimulated with LPS, we measured levels of iNOS and COX-2 expression by western blot. As shown in Figure 12, LPS exposure significantly increased iNOS and COX-2 protein expression. Treatment with α-asarone before LPS stimulation significantly decreased significantly decreased protein expression of iNOS and COX-2.

To determine the effect of α-asarone on the proinflammatory cytokines in primary microglia stimulated with LPS, we measured levels of IL-1β and TNF-α by ELISA. As shown in Figures 13A,B, LPS exposure significantly induced IL-1β and TNF-α expression at different time points, with levels of IL-1β and TNF-α peaking at 3 h. Pretreatment with α-asarone before LPS stimulation significantly decreased IL-1β and TNF-α expression (Figures 13C,D).