Thirty male Wistar rats (260–320 g) were used for this protocol. Rats were maintained under controlled conditions of temperature (22 ± 2° C), humidity (52%), and light (12:12 light–dark cycle). Food and water were available ad libitum. All animal experiments were approved (no. 92/20) by the Institutional Committee for Care and Use of Laboratory Animals (CICUAL-INNN). Treatments and euthanasia were carried out according to Mexican Official Norms for the production, care, and use of laboratory animals (NOM-062-Z00-1999).

Human brain endothelial cells (HBEC-5i) and human cardiomyocytes derived from pluripotent stem cells (hPSC-CMs) obtained as reported by Lin and Zou (2020) and Wang et al. (2021) were maintained with culture medium under normoxic conditions (37° C, 5% CO₂, and 18% O₂) in an incubator INCO108med (Memmert, Germany). For oxygen and glucose deprivation (OGD), cells were incubated with a glucose-free medium under hypoxic conditions (1% O₂, 94% N₂, and 5% CO₂) at 37° C for 2 h. After OGD, the glucose-containing medium was restored and the cells were incubated for 24 h (recovery period) under normoxic conditions. Cells from the control group were maintained in a glucose-containing medium and normoxic conditions throughout the experiment.

SUR1 exons expression in tissues and brain regions was evaluated using 5 μg RNA extracted with TRIzol^™ reagent followed by RT-PCR performed using the SuperScript^™ III One-Step RT-PCR System (Cat. 125740 Invitrogen). Reactions were executed in triplicate following the manufacturer’s guidelines. Seven pairs of primers in exons coding for different domains of the complete protein were used to identify truncated regions (Supplementary Table 1).

Methylation in the brain and heart was analyzed using the methylation-sensitive restriction enzymes PCR method. DNA was extracted from rat tissues using the DNeasy^® Blood & Amp Tissue Kit (Qiagen, Netherlands). DNA quality was determined using a Multiplex PCR kit (Qiagen, Netherlands) (Valdez-Salazar et al., 2020). Then, DNA was restricted with Aci1 and BstU1, and the distal region of the promoter (517 to −196 bp relative to the transcription start site) amplified. The endpoint PCR reaction mixture contained 1X Go Taq Flexi Buffer 5X Colorless (Cat. M890A Promega, United States), GoTaq G2 Hot Start Polymerase (Cat. M7408B Promega, United States), 250 uM deoxyribonucleotides, 1.5 mM MgCl₂, 0.2 μM each oligonucleotide (forward 5’ ATCACCACAAGGGAAGAGAGC -3′ and reverse 5′-GGTGTCTGAGTGGGAGTCGT-3), 10 ng DNA, and nuclease-free water. Amplification was performed in a MasterCycler GSX1 (Eppendorf, Germany) as follows: 95°C for 5 min, followed by 35 cycles of 94°C for 30 s, 59°C for 30 s, 72°C for 45 s, 72°C for 10 min, and a final stage at 4^o C indefinitely.

PCR products were separated by electrophoresis on a 2% agarose gel with a 100 bp DNA ladder (Promega, United States), stained with 1X GelRed^™ (Biotium, Inc., United States), and visualized under an ultraviolet light transilluminator and imaging system (Syngene, United States).

Tissues (pancreas, kidney, liver, lung, testis, intestine, brain, and heart) were homogenized in RIPA buffer containing a cocktail of protease inhibitors (Sigma Aldrich, United States) with the Sonics vibra cell at 60% amplitude for 10 s. For harder tissues, the process was repeated 2 to 3 times. For the heart, a Polytron homogenizer PT-MR2100, Kinematica AG (Switzerland) was used in Figure 1A. The homogenates were centrifuged, and the protein concentration was measured using the BCA method. Proteins (50 μg) were separated by SDS-PAGE (8%), transferred onto nitrocellulose membranes (Bio-Rad, United States), and blocked with 5% nonfat dry milk diluted in TBST. Following, membranes were incubated overnight at 4°C with anti-SUR1 sc-293436 (1:100). Clonality: monoclonal clone number 3G5. Isotype: IgG2a. Predicted molecular weight: 180 kDa; Immunogen: aa 611–710. Specificity: reacts with rat and human. Positive control for WB: human recombinant SUR1 fusion protein. Santa Cruz Biotechnology, United States. Or anti-SUR1 ab134292 (1:100). Clonality: monoclonal clone number N289/16. Isotype: IgG1. Predicted molecular weight: 177 kDa; Immunogen: fusion protein corresponding to Rat SUR1 aa 1,500 to the C-terminus. Database link: Q09429. Specificity: reacts with rat and human and does not cross react with SUR2B. Positive control for WB: rat brain membrane lysate. Abcam, UK. After washing with TBST, membranes were incubated with anti-mouse IgG HRP conjugated (1:3000, JIR-115-035-062, Jackson ImmunoResearch, United States). The visualization of protein bands was performed by chemiluminescence using Luminata Forte (Millipore, United States) and an imaging system (Fusion Solo S, France). After stripping, membranes were incubated with anti-α tubulin (1:1000, T9026, Sigma-Aldrich, United States) for the brain or anti-GAPDH (1:1000, 14C10, Cell Signaling, United States) for the heart as loading proteins reference. A Ponceau staining was used as a loading reference when different tissues were analyzed.

HBEC-5i and hPSC-CMs cells were seeded on 12 mm round coverslips at 10,000 cells/coverslip density. After OGD, cells were fixed with cold methanol, washed, and kept in cold PBS until use. Cells were blocked with 10% goat serum and then incubated with primary antibodies against SUR1 (1:200 dilution, SC-293436, Santa Cruz Biotechnology, United States) or NKX 2.5 (1:100 dilution, PA5-4943, ThermoFisher Scientific, United States) or GAPDH (1:600, SC-25778, Santa Cruz Biotechnology, United States) at 4°C overnight. After washing with PBS, cells were incubated with antibodies anti-IgG conjugated with DyLight^™ 488 (JIR-315-485-044) or Alexa Fluor^® 594 (JIR-711-585-152) for 2 h. Then, cells were incubated with DAPI. Images were acquired with an inverted microscope (Olympus 1×71, Olympus Corporation, United States).

As previously described (Alquisiras-Burgos et al., 2024), cells (HBEC-5i) were seeded on 24 mm diameter round coverslips (20,000 cells/coverslip), washed with KHB solution and immediately incubated at 37°C, 5% CO₂, with a fluorescent probe (CoronNa Green, 5 μM) (Sigma-Aldrich, United States), diluted in KHB + glucose (10 mM) for 45 min. Then, cells were transferred to a perfusion chamber on the plate of the upright microscope with a 20×, 0.95 NA water-immersion objective (Eclipse Ni. Nikon, Japan). The Na⁺ concentration changes were evaluated after the emission of illumination pulses at 488 nm (50- to 100-ms exposure) with a disk-spinning scanning confocal system (CSU-X1, Solamere Technology Group, United States). Images were acquired with a cooled digital camera (Prime 95B, Photometrics, United States), and time-lapse recordings (approximately 1,600 images) were acquired at 500 ms intervals. A physiological solution followed by Diazoxide (100 μM) was applied for 5 min. The analysis was performed with Image J software 1.8.0. Fluorescence was reported in arbitrary units (a.u).

hPSC-CMs were seeded on 18 mm round glass coverslips and incubated with 2.5 μM of the fluorescent calcium indicator Fluo-4 AM (Sigma-Aldrich, United States) for 30 min at 37°C. Coverslips were transferred to a perfusion chamber on the plate of an upright Nikon Eclipse 80i microscope equipped with a 20×, 0.95 NA water-immersion objective. Fluo-4 AM was excited at 488 nm with a solid-state Coherent Obis laser, coupled to a CSUXM1Yokogawa spin-disk confocal scan head. Emitted fluorescence was band-passed (460/50), and images were collected with a sCMOS camera (Prime 95B, Photometrics). The acquisition and illumination were controlled with Micro-manager software. Time-lapse recordings (approximately 1,600 images) were acquired at 175 ms intervals and analyzed with Fiji (Image J) software. A physiological solution was perfused first into the chamber, followed by 5 min of Diazoxide (100 μM) containing solution. Fluorescence data is reported in arbitrary units (a. u).

MCAO was performed according to the technique previously described by Longa et al. (1989). Rats were anesthetized with 3% isofluorane (Pisa, México) and placed under a surgical microscope (Olympus Optical, Japan). A neck incision was made to visualize the common carotid artery (CCA), the internal carotid artery (ICA), and the external carotid artery (ECA). ECA was ligated distally with a 6–0 silk suture; ICA was also ligated but right at CCA bifurcation to stop blood flow. A small incision was made in the CCA to insert a 3–0 nylon monofilament (~17 mm) directed toward the ICA. In this way, the monofilament reached and occluded the middle cerebral artery. The occlusion was maintained for 2 h. After, the animals were re-anesthetized, and the filament was removed to allow reperfusion. Control rats underwent the same surgical procedure except the MCAO. Rats were sacrificed after 24 h of reperfusion.

Rats were deeply anesthetized, and oro-tracheal intubation was performed, allowing artificial ventilation (RF: 70′, TV: 8 L/min) (Ugo Basile, Italy). A skin incision was made between the third and fourth ribs, and the left anterior descending coronary artery was ligated with a 6–0 polypropylene suture and a polypropylene tubing (PE-10) for 30 min. Then, the tubing was removed, allowing myocardium reperfusion (Oidor-Chan et al., 2016). The thoracic cavity was sutured, and negative pressure was restored. Rats were administered with a single dose of analgesic (tramadol 5 mg/kg) and allowed to recover from anesthesia. Control rats underwent the same procedure but without coronary artery ligation. Twenty-four hours later, subjects from both groups were anesthetized and sacrificed, and cardiac hearth samples were obtained.

Statistical analyses were performed using GraphPad Prism 9.0. We used a t-test to compare the results from the experiments of monitoring intracellular Na⁺ and intracellular calcium recordings. Other experiments were compared with one-way ANOVA; the Tukey test was used to compare the means of three or more groups. A value of p < 0.05% was considered as significant.

We used two different anti-SUR1 antibodies from Santa Cruz Biotechnology (sc-293436) and Abcam (ab134292) for the Western blot analysis. Similar results were obtained with both antibodies; therefore, we used the antibody sc-293436 for all the experiments. We detected that two SUR1 isoforms (170 and 60–75 kDa) are abundantly expressed in most rat tissues, except for the brain and testis, where basal expression of these isoforms is low. We also detected a band of 100 kDa in the testis and brain (Figures 1B,C). The SUR1 protein displays strong expression in cardiac chambers, with a higher expression level in the atrium than in the ventricles (Figures 1D,E). We hypothesized that the significant difference in SUR1 expression in the heart compared to the brain could be associated with epigenetic regulation. Accordingly, using the Meth Primer program (Li and Dahiya, 2002), we identified two CpG islands in the Abcc8 gene promoter, which possess binding sites for multiple transcription factors (Figure 1F). Then, we compared the methylation of the distal region of the Abcc8 promoter in the brain and heart through the methylation-sensitive restriction enzymes method; nonetheless, no amplification product was obtained (Figure 1G). This result demonstrates that the AciI and BstUI sites at the analyzed region were not methylated.

We used seven pairs of primers situated in exons coding for the functional domains of the complete protein to identify truncated regions and to determine whether the SUR1 isoforms found in rat tissues originated from mRNAs of different sizes (Figure 2A). Our results showed that SUR1 mRNAs expressed in all the tissues analyzed contain each of the selected exons, except for exons 1 and 2 (E1-E2), which did not amplify in the pancreas, E17-E18 in the liver, and E35-E36 in the heart and pancreas (Figure 2B). We also found that all exons were amplified in each brain region analyzed (cortex, hippocampus, hypothalamus, cerebellum, and olfactory bulb) (Figure 2C), even though the expression level of SUR1 protein observed in the brain is relatively low (Figures 1B,C). Additional primers were designed to detect exon 1 because the first pair used did not amplify in any of the tissues tested. Thus, with these additional primers, exon 1 was amplified in all tissues and brain regions analyzed except the pancreas (Figures 2D,E).

We induced transient MCAO in the rat for 2 h, followed by 24 h of reperfusion. This experimental model of stroke significantly augmented the level of both SUR1 isoforms in the brain (Figures 3A,B). Similarly, 2 h OGD followed by a 24 h recovery period induced SUR1 expression in the brain micro endothelial cell culture (Figure 3C).

SUR1 binds to the transient receptor potential melastatin 4 channel (TRPM4) and aquaporin 4, forming a complex that regulates the influx of Na⁺ and water (Stokum et al., 2023). Accordingly, we observed that the brain micro endothelial cells exposed to OGD followed by 24 h recovery period rise intracellular Na⁺ compared to control cells (cumulative Na⁺) (Figures 3D–F). Additionally, when these cultures were stimulated with the SUR1 activator (Diazoxide) they showed an augmented content of cellular Na⁺ compared with basal conditions (Figures 3D,E,G).

SUR1 was abundantly expressed in the heart under control conditions. To find out if hypoxia changed this situation, we induced myocardial infarction for 30 min followed by 24 h of reperfusion. Surprisingly, we found that SUR1 expression in the heart was significantly reduced after ischemia/reperfusion, and this effect was observed with both SUR1 isoforms (170 and 60–75 kDa) (Figures 4A,B). Similarly, cultured human cardiomyocytes exposed to OGD showed a notable reduction in SUR1 expression levels (Figure 4C).

Examining Ca²⁺ influx into the intracellular space with fluorescent Ca²⁺-sensitive dyes can be a surrogate for electrophysiological recording of action potential waveforms and firing rate in cardiomyocytes to test for the possible effects of compounds on intracellular Ca²⁺ homeostasis and beating patterns. Under control conditions, hPSC-CMs show spontaneous, regular Ca²⁺ transients. Contractility, action potential generation, and Ca²⁺ transients are common findings in studies with hPSC-CMs because these cells remain immature in culture and resemble heart cells of mid-gestation human fetuses (Veerman et al., 2015).

We evaluated the frequency and amplitude of spontaneous Ca²⁺ transients generated by human cardiac myocytes. After exposure to ODG, cardiomyocytes showed a decrease in the frequency of spontaneous Ca²⁺ transients. Upon incubation with the SUR1 activator (Diazoxide) Ca²⁺ signals increased in frequency and amplitude. These changes in the Ca²⁺ signalling pattern elevate the integral of the intracellular Ca²⁺ fluctuations (cumulative Ca²⁺) in OGD-treated cardiomyocytes more than in the control, untreated ones (Figures 4D–G).