Sprague Dawley male rats (weighting 220–300 g) were purchased from the Experimental Animal Center, Chinese Academy of Sciences (Shanghai, China). Rats were housed 2–3 per cage on a 12/12-h light/dark cycle with free access to food and water. All the animals used in this study were maintained in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80-23, revised 1996) and experiments were approved by the Institutional Animal Care and Use Committee of Chinese Academy of Sciences (Shanghai, China).

METH was provided by China Academy of Military Medical Science. The primary antibodies include anti-GABA_Aα1 (1:1000, Millipore), anti-GABA_Aα2 (1:1000, Millipore), anti-GABA_Aα3 (1:1000, Santa Cruz), anti-GABA_Aα5 (1:1000, Abcam), anti-GABA_Aβ2 (1:1000, Millipore), anti-SYVN1 (1:1000, Abcam), anti-Gp78 (1:1000, Abcam), Anti-CHOP (1:1000, Abcam), Glucose-regulated protein 78 (GRP78; 1:1000, Abcam), anti-Ubiquitin (1:1000, Cell Signaling) and anti-Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH; 1:20,000, Bio Legend).

The CPP apparatus (Jiliang Software and Instruments) consists of two square compartments of the same size [40 cm (length) × 40 cm (width) × 60 cm (height)], separated by removable doors (10 × 10 cm), allowing rats free access to each compartment. One compartment has black and white horizontal stripes walls with an iron wire floor and the other has black and white vertical stripes walls with a steel bar floor.

CPP procedure has been described in our previous studies (Jiao et al., 2016). The place conditioning procedure consists of the following phases: Habituation, Preconditioning, Conditioning and Testing. During Habituation phase, rats were allowed access to the entire apparatus for 30 min. In the Preconditioning phase, rats were allowed access to both compartments of the apparatus for 15 min. The duration spent in each compartment was recorded. The animals showing strong unconditioned aversion (one compartment >720 s) for one of the compartments were excluded. Following the Preconditioning, rats went through 8 days of conditioning. On the first day, the rats were intraperitoneally injected with either METH (1 mg/kg,) or saline (1 mL/kg.) and then confined to the non-preferred compartment for 45 min. On alternate days, rats were received saline and placed immediately in the preferred compartment. The procedure was repeated four times in the conditioning phase. During Testing phase, 24 h after the conditioning trial, the doors were opened and the rats were allowed to explore the entire apparatus for 15 min. The time spent in each compartment was recorded. The CPP score was the time spent in the drug-paired compartment during the testing phase minus the time spent in that compartment during the preconditioning phase. To minimize the basal stress, all rats were gentled by handling twice a day till the start of behavioral experiment. METH treated rats and saline-treated rats were individually housed in different cages with same standard conditions.

Rats were sacrificed and the brains were removed immediately after CPP conditioning. The brain was dissected into coronal slices (1 mm thick) using a rat brain slicer (Braintree Scientific), and the dorsal striatum was punched by a bluntend, 17-gauge syringe needle. The homogenate was centrifuged at 1000× g for 10 min at 4°C, and the supernatant was collected for analysis.

Equal amounts of protein were loaded on 10% sodium dodecyl sulfate polyacrylamide gels for electrophoresis. Separated proteins were then transferred on nitrocellulose membrane. GABA_Aα1, GABA_Aα2, GABA_Aα3, GABA_Aα5, GABA_Aβ2, Gp78, SYVN1, C/EBP homologous protein (CHOP) or GRP78 was detected with primary antibody at a 1:1000 dilution in TBS containing 5% non-fat dried milk and 0.05% Tween-20. After incubation with secondary antibody (HRP-conjugated goat anti-rabbit IgG or goat anti-mouse IgG) at a 1:2000 dilution, immunoreactive bands were detected with chemiluminescent substrate (RPN2232, GE Healthcare). The immunoreactive signals were quantified by quantity analysis software (Bio-Rad).

Brain homogenate was incubated overnight with antibodies (anti-GABA_Aα1 or anti-SYVN1; dilution 1:100) and with Protein A or Protein G agarose beads (Sigma) at 4°C. Beads were washed three times by centrifugation and bound proteins were analyzed by Western blotting.

Total RNA was isolated from rat Dstr using a commercially available kit (RNeasy Plus Mini Kit, Qiagen). QRT-PCR was performed on a ABI7500 Real-Time PCR system (ABI) using SYBR^® Premix Ex Taq™ kit (TaKaRa Bio Group, Japan). A typical reaction of a total volume of 20 μl consisted of 2 μl Template DNA, 10 μl 2× SYBR Green Reaction Mix, 0.4 μl PCR Forward Primer (10 μM), 0.4 μl PCR Reverse Primer (10 μM), 0.4 μl ROX Reference Dye II and 6.8 μl DEPC treated water. PCR amplification was done with an initial incubation at 95°C for 30 s, and then followed by 40 cycles of 95°C for 5 s, 60°C for 34 s, and final melting curve from 95°C for 5 s, 60°C 60 s. Primer specificity was confirmed by melting curve analysis. The mRNA for GABA_Aα1 and SYVN1 was normalized to a control gene (GAPDH). Primers utilized were as follows: GABA_Aα1 (GABA_Aα1, Fwd—CCTGGACCCTCATTCTGAGCA, Rev—ATCCTCGTGAAGACAGTGGTGTTG; GAPDH, Fwd—AACTTTGGCATTGTGGAAGG, REV—ACACATTGGGGGTAGGAACA; Genewiz, China).

Rats were anesthetized using sodium pentobarbital (50 mg/kg, i.p.) under aseptic conditions, and then a stereotaxic instrument (Narishige) with the incisor bar set at 3.3 mm was used for Cannula implantation and microinjection. For dorsal striatum infusion, guide cannula (26 gauge) was bilaterally implanted in the dorsal striatum (anteroposterior: +0.6 mm; mediolateral: ±2.7; dorsoventral: −2.0 mm). After recovering from surgery and anesthesia for 1 week, animals were placed in a stereotaxic apparatus again for drug infusion. Bilateral microinfusions were made through 31-gauge injection needles (2 mm below the tip of the guide cannulae), which was connected to a 10 μl microsyringe mounted in the microinfusion pump (Harvard Apparatus). During the injection, the animals were gently restrained by hand.

Mg132 and Lactacystin were dissolved in dimethylsulfoxide (DMSO) to stock concentration (50 μg/μl) and then diluted in PBS to a work concentration (0.25 μg/μl, DMSO concentration ≤20%). During the conditioning session, 10 min before METH administration (1 mg/kg, i.p.), Mg132 or Lactacystin (0.5 μg/side) was bilaterally microinjected into the dorsal striatum. Each infusion volume was 2 μl per side infused at a rate of 0.4 μl/min. After injection, rats were given an additional 2 min to allow drug diffusion.

Animals were deeply anesthetized with sodium pentobarbital and received a transcardial perfusion with 0.9% saline followed by 4% paraformaldehyde in PBS. The brains were removed and post fixed in 4% paraformaldehyde for 24 h and then kept in a 30% sucrose/PBS solution for 3–5 days to dehydration. The brains were cut coronally in 30 μm thickness on a cryostat (Leica). The tissue was stained with cresyl violet, and examined by light microscopy to detect the injection sites. Only animals with right injection sites were included for data analysis.

The SYVN1 lentivirus and adeno-associated virus (AAV) were purchased from Obio Technology (Shanghai) Co., Ltd. The lentiviral stocks (1.5–2.0 × 10⁸ integration units (IU)/ml) were used to infect cultured neurons. The fluorescence was examined and the lysates were collected at 96 h after infection.

The AAV stocks (3.0–3.5 × 10¹² IU/mL) were used to infect rodent Dstr. Rats were anesthetized and the guide cannula (26 gauge) was bilaterally implanted in the dorsal striatum (anteroposterior: +0.6 mm; mediolateral: ±2.7; dorsoventral: −2.0 mm). Bilateral microinfusions were made through 31-gauge injection needles (2 mm below the tip of the guide cannulae), connecting to a 10 μl microsyringe mounted in the microinfusion pump (Harvard Apparatus). AAV (1.5 μl/site) was microinjected into the dorsal striatum over 15 min. The microinjection needle was retained for another 5 min for drug diffusion. Two to three weeks after AAV-injection, animals were deeply anesthetized and received a transcardial perfusion. The brains were collected, dehydrated and cut for fluorescence examining.

The ER was isolated from rat dorsal striatum using a commercially available kit (Endoplasmic Reticulum Isolation Kit, Sigma) according to the supplier’s instructions. Isolated ER was stored at −20°C for analysis.

The data were analyzed with one-way or two-way analysis of variance (ANOVA), and then followed by Newman-Keuls or Bonferroni post hoc tests. Differences with p < 0.05 were considered statistically significant. The results are presented as mean ± SEM.

We previously found that conditioned METH rewarding reduced GABA_Aα1 protein expression in the Dstr. This result was confirmed in the present study (p < 0.01 vs. control group; Figure 1A). And we did not find any significant changes in the other subunits protein levels of GABA_Aα2, GABA_Aα3, GABA_Aα5 and GABA_Aβ2 in Meth-CPP rat (p > 0.05; Figures 1B–E). We further detected the GABA_Aα1 mRNA expression in the Dstr, and we found that there were no expression changes of the GABA_Aα1 mRNA (p > 0.05; Figure 1F). These results indicated that GABA_Aα1 levels were lower in the Dstr after METH pairing, and it occurred at the post-translational level.

ERAD has been reported to be involved in the degradation of un- or misfolded GABA receptors (Kang and Macdonald, 2004; Gallagher et al., 2005). The mammalian ERAD systems are organized primarily by two E3 ubiquitin ligases: SYVN1 and Glycoprotein 78 (Gp78; Christianson et al., 2011). We thus examined the protein expression levels of SYVN1 and Gp78, and we found that the SYVN1 level, but not Gp78 level, was significantly increased (p < 0.05 vs. control group; Figure 2). These results suggested that the SYVN 1 might be a key component that associated with degradation of GABA_Aα1.

We sought to investigate whether SYVN1 could interact with GABA_Aα1 and be responsible for the GABA_Aα1 degradation. As shown in Figure 3A, SYVN1 was detected in GABA_Aα1 immunoprecipitates, but not in the control IgG. The interaction was further verified using a reciprocal approach, where GABA_Aα1 co-purified with SYVN1, but not with a control IgG. The data indicated that GABA_Aα1 interacted with SYVN1 in the Dstr of METH pairing rat.

We then used SYVN1-shRNA to examine the causal relationship between SYVN1 and GABA_Aα1 degradation. Infection of primary Dstr neurons with Lenti-SYVN1 (Figure 3D) significantly decreased SYVN1 expression level (PBS, 100 ± 2.713%; Lenti-Con, 107.4 ± 9.653%; Lenti-SYVN1, 39.25 ± 11.20%; F_(2,11) = 18.58, p = 0.0006; Figure 3B), indicating the effectiveness of the lentivirus system. As shown in Figure 3C, SYVN1 knockdown resulted in a significant increase in GABA_Aα1 expression (PBS, 100 ± 11.02%; Lenti-Con, 116.8 ± 17.10%; Lenti-SYVN1, 180.0 ± 21.74%; F_(2,11) = 6.025, p = 0.0218).

In order to improve the in vivo viral infection efficiency, we used AAV expressing shRNA (AAV-SYVN1). We found that infection of striatum neurons with AAV-SYVN1 (Figure 3G) significantly decreased SYVN1 expression level (PBS, 100 ± 10.27%; AAV-Con, 110.4 ± 6.599%; AAV-SYVN1, 61.23 ± 5.510%; F_(2,17) = 11.22, p = 0.0010; Figure 3E). As shown in Figure 3F, SYVN1 knockdown significantly increased GABA_Aα1 protein levels (PBS, 100 ± 9.781%; AAV-Con, 91.80 ± 8.823%; AAV-SYVN1, 152.0 ± 19.13%; F_(2,17) = 5.918, p = 0.0127), which was consistent with our in vitro data. These results indicated that SYVN1 was involved in regulating GABA_Aα1 degradation.

SYVN1, as an E3 ubiquitin ligase, significantly increased in the Dstr, suggesting that ubiquitin-proteasome system (UPS) might be involved in METH-induced CPP formation. We thus tested the level of ubiquitin protein in Dstr of METH-CPP rat, and we found that the expression level of ubiquitin protein was remarkably enhanced after conditioned METH pairing (p < 0.05 vs control group; Figure 4A). We further found that intra-Dstr injection of proteasomal inhibitor MG132 and Lactacystin could reverse the change of GABA_Aα1 expression induced by METH pairing (Con, 100 ± 7.408%; CPP, 68.14 ± 6.145%; MG132+CPP, 92.10 ± 9.942%; Lactacystin+CPP, 95.73 ± 9.668%; F_(3,27) = 3.034, p = 0.0497; Figure 4B). These data demonstrated that UPS, as part of ERAD, was involved in the degradation of GABA_Aα1.

Increased misfolded and unassembled membrane proteins may induce ERS, which is always associated with increased expression of the ER resident chaperone GRP78 and CHOP. We thus examined the expression level of GRP78 and CHOP in the Dstr of METH pairing rat, and we found there were no changes of either GRP78 or CHOP compared with the control group (p > 0.05, Figures 5A,B). However, in vivo knockdown of Dstr SYVN1 significantly increased the level of GRP78 (PBS+CPP, 100 ± 16.84%; AAV Con + CPP, 108.6 ± 4.813%; AAV SYVN1+CPP, 246.1 ± 37.74%; F_(2,17) = 11.65, p = 0.0009; Figure 5C) and CHOP (PBS+CPP, 100 ± 14.87%; AAV control + CPP, 111.7 ± 37.29%; AAV SYVN1 + CPP, 218.2 ± 35.47%; F_(2,17) = 4.438, p = 0.0306; Figure 5D) in Dstr of METH-CPP rat. These results suggested that knockdown of Dstr SYVN1 might make misfolded or inappropriate GABA_Aα1 proteins subunit failed to degradate through ERAD and accumulated in ER, which triggered ERS.

We further isolated ER and examined the expression level of GABA_Aα1 in the intra-ER and extra-ER. We used AAV-SYVN1 to infect striatum neurons (Figures 6E,F) and found that knockdown of Dstr SYVN1 increased the expression level of total GABA_Aα1(PBS+CPP, 100 ± 18.68%; AAV Con+CPP, 81.33 ± 5.623%; AAV SYVN1+CPP, 140.9 ± 17.67%; F_(2,17) = 4.018, p = 0.0400; Figure 6A) and GABA_Aα1 in the intra-ER (PBS+CPP, 100 ± 7.488%; AAV Con+CPP, 111.8 ± 15.08%; AAV SYVN1+CPP, 184.3 ± 16.44%; F_(2,17) = 11.29, p = 0.0010; Figure 6B), but not in the extra-ER (PBS+CPP, 100 ± 14.39%; AAV Con+CPP, 102.2 ± 9.850%; AAV SYVN1+CPP, 97.17 ± 9.094%; F_(2,17) = 0.04891, p = 0.9524; Figure 6C). Moreover, knockdown of Dstr SYVN1 did not affect METH CPP behaviors (PBS, 275.6 ± 39.17%; AAV-Con, 250.5 ± 32.29%; AAV-SYVN1, 252.8 ± 30.05%; F_(2,32) = 0.1621, p = 0.8511; Figure 6D).