<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3-mathml3.dtd">
<article article-type="research-article" dtd-version="1.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Mol. Biosci.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Molecular Biosciences</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Mol. Biosci.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">2296-889X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1795772</article-id>
<article-id pub-id-type="doi">10.3389/fmolb.2026.1795772</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Erythropoietin alleviate obstructive renal fibrosis by regulating immunity and inflammation through miR-21-5p/SPRY1/ERK1/2/NF-&#x3ba;B pathway inhibition</article-title>
<alt-title alt-title-type="left-running-head">Liu et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fmolb.2026.1795772">10.3389/fmolb.2026.1795772</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Erpeng</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal Analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources/">Resources</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Software" vocab-term-identifier="https://credit.niso.org/contributor-roles/software/">Software</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Sun</surname>
<given-names>Xiao</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources/">Resources</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Qilong</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2244159"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources/">Resources</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jin</surname>
<given-names>Dongyi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources/">Resources</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Guihong</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources/">Resources</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhao</surname>
<given-names>Huayan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2604917"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources/">Resources</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Sun</surname>
<given-names>Hao</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources/">Resources</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Du</surname>
<given-names>Yuming</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3341311"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal Analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources/">Resources</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Software" vocab-term-identifier="https://credit.niso.org/contributor-roles/software/">Software</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
<institution>Intensive Care Unit, First Affiliated Hospital of Zhengzhou University</institution>, <city>Zhengzhou</city>, <state>Henan</state>, <country country="CN">China</country>
</aff>
<aff id="aff2">
<label>2</label>
<institution>Henan Academy of Innovations in Medical Science</institution>, <city>Zhengzhou</city>, <state>Henan</state>, <country country="CN">China</country>
</aff>
<aff id="aff3">
<label>3</label>
<institution>Neurosurgery, First Affiliated Hospital of Zhengzhou University</institution>, <city>Zhengzhou</city>, <state>Henan</state>, <country country="CN">China</country>
</aff>
<aff id="aff4">
<label>4</label>
<institution>Anyang Center for Disease Control and Prevention</institution>, <city>Anyang</city>, <country country="CN">China</country>
</aff>
<author-notes>
<corresp id="c001">
<label>&#x2a;</label>Correspondence: Yuming Du, <email xlink:href="mailto:dyming027@sohu.com">dyming027@sohu.com</email>
</corresp>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2026-03-02">
<day>02</day>
<month>03</month>
<year>2026</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2026</year>
</pub-date>
<volume>13</volume>
<elocation-id>1795772</elocation-id>
<history>
<date date-type="received">
<day>25</day>
<month>01</month>
<year>2026</year>
</date>
<date date-type="rev-recd">
<day>10</day>
<month>02</month>
<year>2026</year>
</date>
<date date-type="accepted">
<day>13</day>
<month>02</month>
<year>2026</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2026 Liu, Sun, Liu, Jin, Li, Zhao, Sun and Du.</copyright-statement>
<copyright-year>2026</copyright-year>
<copyright-holder>Liu, Sun, Liu, Jin, Li, Zhao, Sun and Du</copyright-holder>
<license>
<ali:license_ref start_date="2026-03-02">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<p>The important role of erythropoietin (EPO) in the treatment of renal fibrosis induced by urinary tract obstruction has been documented in numerous studies; however, its underlying molecular mechanisms are not yet fully understood, particularly its role in regulating immunity and inflammation. Previous studies have revealed that miR-21 can influence the progression of organ fibrosis by regulating inflammation via activation of the SPRY1/ERK/NF-&#x3ba;B pathway. Additionally, several studies have shown that EPO can exert therapeutic effect by regulating microRNA expression. However, the effect of EPO on miR-21, the NF-&#x3ba;B system (which is associated with innate immunity and inflammation), and specific signaling pathways in the context of obstructive renal fibrosis has rarely been reported. In the present study, we employed a mouse model of unilateral ureteral obstruction (UUO) in which the left ureters were ligated and treated the mice with low-dose rhEPO (100 U/kg) for 7 days, and validated the possible signaling pathway through vitro experiments using HK-2 cells. We found that low-dose rhEPO treatment alleviated the fibrosis and inflammation of obstructive kidneys in mice and the upregulation of miR-21-5p and activation of SPRY1/ERK/NF-&#x3ba;B pathway could be reversed by rhEPO treatment <italic>in vivo</italic> and vitro studies. To the best of our knowledge, this is the first demonstration that EPO exerts anti-fibrotic effect in obstructive renal fibrosis by regulating immunity and inflammation through miR-21-5p/SPRY1/ERK/NF-kB axis.</p>
</abstract>
<kwd-group>
<kwd>erythropoietin (EPO)</kwd>
<kwd>immunity</kwd>
<kwd>inflammation</kwd>
<kwd>MiR-21-5p</kwd>
<kwd>renal fibrosis</kwd>
<kwd>Spry1/ERK/NF-&#x3ba;B</kwd>
<kwd>urinary tract obstruction</kwd>
</kwd-group>
<funding-group>
<funding-statement>The author(s) declared that financial support was received for this work and/or its publication. This study was supported by Basic scientific research project of Henan Academy of Medical Sciences(under Grant JBKY250105), Scientific research project of Zhengzhou Science and Technology Bureau(under Grant 2024ZZJCYJ053), and Henan Medical Science and Technology Research Program Joint Construction Project(under Grant LHGJ20210291).</funding-statement>
</funding-group>
<counts>
<fig-count count="6"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="58"/>
<page-count count="00"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Molecular Diagnostics and Therapeutics</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="s1">
<label>1</label>
<title>Introduction</title>
<p>Renal fibrosis represents the common final outcome of various chronic kidney diseases (CKD) (<xref ref-type="bibr" rid="B26">Liu, 2011</xref>). As a chronic inflammatory disorder, CKD is not only associated with diabetes (<xref ref-type="bibr" rid="B41">Peng et al., 2021</xref>)<sup>,</sup> hypertension (<xref ref-type="bibr" rid="B25">Li et al., 2020</xref>), and urinary tract obstruction (<xref ref-type="bibr" rid="B16">Gasparitsch et al., 2013</xref>), but also particularly closely linked to immunity (<xref ref-type="bibr" rid="B5">Braga et al., 2012</xref>) and inflammation (<xref ref-type="bibr" rid="B20">Hassan et al., 2021</xref>)-two key factors that strongly drive the migration and activation of leukocytes, as well as the accumulation of excess interstitial fluid (<xref ref-type="bibr" rid="B47">W et al., 2020</xref>). These pathological changes ultimately lead to extracellular matrix (ECM) deposition, which is the hallmark pathological feature of renal fibrosis. In urology, urinary tract obstruction is the most frequent reason of renal fibrosis, which damages the normal construction of renal tubules and glomeruli, and ultimately impairs renal function. In clinical practice, the preferred treatment for urinary tract obstruction is to release the obstruction via surgery as soon as possible to protect renal function, especially for acute obstruction. However, this approach is ineffective for chronic urinary obstruction with severe renal fibrosis, and for patients with bilateral lesions, they have to undergo hemodialysis or kidney transplantation to maintain their lives, which imposes a heavy financial burden on the family. Therefore, continuous efforts and time investment are still needed to find breakthrough treatments for obstructive renal fibrosis.</p>
<p>MicroRNAs participate in diverse biological processes by binding to specific sites on target genes to regulate mRNA degradation and protein synthesis, and have long been a research focus in organ fibrosis. miR-21 regulates multiple immunological and developmental processes (<xref ref-type="bibr" rid="B23">Kumarswamy et al., 2011</xref>), and is one of the most extensively studied molecules in renal fibrosis research. Studies have demonstrated that inhibition of miR-21 can attenuate renal fibrosis (<xref ref-type="bibr" rid="B58">Zhong et al., 2011</xref>; <xref ref-type="bibr" rid="B54">Za et al., 2011</xref>), which constitutes the actual working mechanism of certain therapeutic strategies (<xref ref-type="bibr" rid="B49">Wang et al., 2020a</xref>; <xref ref-type="bibr" rid="B28">Liu et al., 2020</xref>). SPRY1 is a direct target of miR-21 that inhibits ERK activation, and NF-&#x3ba;B is deeply involved in innate immune responses and the regulation of adaptive immunity. The ERK/NF-&#x3ba;B signaling pathway participates in tissue damage and repair processes by regulating the expression of inflammation-related and immune-related genes (<xref ref-type="bibr" rid="B43">Song et al., 2025</xref>; <xref ref-type="bibr" rid="B12">Du et al., 2021</xref>; <xref ref-type="bibr" rid="B57">Zheng et al., 2021</xref>; <xref ref-type="bibr" rid="B10">Choi et al., 2013</xref>) and plays a central role in the pathogenesis of various inflammatory diseases. Thus, miR-21 can promote immune responses and inflammation by activating the ERK/NF-&#x3ba;B signaling pathway through targeting SPRY1, thereby exacerbating tissue fibrosis. This mechanism has been validated in pulmonary fibrosis (<xref ref-type="bibr" rid="B45">Sun et al., 2017</xref>) and hepatic fibrosis (<xref ref-type="bibr" rid="B35">Ning et al., 2017</xref>), suggesting that this pathway may serve as a promising therapeutic target. Therefore, exploring the role of the miR-21/SPRY1/ERK/NF-&#x3ba;B axis, immunity and inflammation in obstructive renal fibrosis is of great significance.</p>
<p>EPO is a glycoprotein hormone primarily produced by renal peritubular cells. Notably, renal fibrosis is associated with impaired renal capacity to generate EPO (<xref ref-type="bibr" rid="B19">Han et al., 2023</xref>), though the specific mechanism remains elusive. Studies have demonstrated that EPO can attenuate carbon tetrachloride-induced hepatic fibrosis in mice (<xref ref-type="bibr" rid="B40">Park et al., 2012</xref>), diabetic cardiac fibrosis in rats (<xref ref-type="bibr" rid="B29">Lu et al., 2012</xref>) and renal fibrosis induced by unilateral ureteral obstruction (UUO) in rats (<xref ref-type="bibr" rid="B24">Lee et al., 2020</xref>). Clinical studies have also reported that early EPO administration for anemia in patients with renal failure slows the decline in renal function (<xref ref-type="bibr" rid="B18">Gouva et al., 2004</xref>). Therefore, EPO may serve as an effective anti-fibrotic agent and a promising therapeutic strategy for renal fibrosis, but its therapeutic mechanism requires further investigation. Anti-inflammation (<xref ref-type="bibr" rid="B56">Zhang et al., 2020</xref>) and immunomodulation (<xref ref-type="bibr" rid="B42">Sarrabayrouse et al., 2024</xref>; <xref ref-type="bibr" rid="B8">Chiu et al., 2025</xref>) are crucial non-hematopoietic effects of EPO. Published studies have confirmed that EPO inhibits the development of gut microbiota dysbiosis (<xref ref-type="bibr" rid="B42">Sarrabayrouse et al., 2024</xref>), autoimmune kidney disease (<xref ref-type="bibr" rid="B11">Donadei et al., 2019</xref>) and the tumor microenvironment (<xref ref-type="bibr" rid="B8">Chiu et al., 2025</xref>) by regulating immune response. Previous study (<xref ref-type="bibr" rid="B53">Yuen et al., 2017</xref>) confirmed that EPO-cyclosporine combination therapy can reduce cerebral infarct size in rats with acute ischemic stroke by suppressing the expression of microRNAs, mitogen-activated protein kinase (MAPK) family signaling, and inflammatory responses. EPO inhibits inflammation and collagen synthesis through the NADPH/ERK1/2/NF-&#x3ba;B signaling pathway, thereby delaying the progression of myocardial fibrosis (<xref ref-type="bibr" rid="B19">Han et al., 2023</xref>; <xref ref-type="bibr" rid="B22">Jun et al., 2014</xref>; <xref ref-type="bibr" rid="B48">Wang et al., 2016</xref>). Another study revealed that EPO exerts a therapeutic effect in glioblastoma by inhibiting microRNA-451 expression (<xref ref-type="bibr" rid="B3">Alural et al., 2017</xref>). However, the effect of EPO on the miR-21 expression, inflammation, immunity and its downstream pathways in obstructive renal fibrosis is rarely reported.</p>
<p>In the present study, we performed the UUO models in mice and treated the mice with low-dose rhEPO (100 U/kg) for 7 days. This treatment regimen was based on the experience reported in previous studies (<xref ref-type="bibr" rid="B34">Moriyama et al., 2010</xref>; <xref ref-type="bibr" rid="B38">Olgun et al., 2013</xref>; <xref ref-type="bibr" rid="B39">Park et al., 2007</xref>)and was also intended to minimize the side effects of chronic EPO therapy. Furthermore, we validated the possible signaling pathway through vitro experiments using HK-2 cells. We revealed that low-dose rhEPO treatment alleviated the fibrosis and inflammation of obstructive kidneys in mice by inhibiting the expression of miR-21-5p and the activation of SPRY1/ERK/NF-&#x3ba;B pathway. These findings might help to further understand of the role of EPO in obstructive renal fibrosis.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2-1">
<label>2.1</label>
<title>Reagents and antibodies</title>
<p>Recombinant Human Erythropoietin for Injection (rhEPO, S19991025, CHO Cell) was purchased from Shanghai Chemo Wanbang Biophama Co., Ltd. Recombinant Human Transforming Growth Factor &#x3b2;1 (rhTGF-&#x3b2;1, <ext-link ext-link-type="uri" xlink:href="https://www.medchemexpress.cn/recombinant-proteins/recombinant-human-transforming-growth-factor-1.html">HY-P7118</ext-link>, CHO Cell) was purchased from MedChemExpress. Primary antibodies against &#x3b1;-SMA, collagen I, myeloperoxidase (MPO) and &#x3b2;-actin were purchased from Abcam (Cambridge, United States). Primary antibodies against SPRY1, ERK1/2, p-ERK1/2, NF-&#x3ba;B and p-NF-&#x3ba;B were purchased from Cell Signaling Technology (Massachusetts, United States). Primary antibodies against IL-6 and TNF-&#x3b1; were purchased from Proteintech (Wuhan, China). Horseradish peroxidase (HRP)-labeled goat anti-rabbit secondary antibody was purchased from Sangon Biotech (Shanghai, China). Other reagents are described below.</p>
</sec>
<sec id="s2-2">
<label>2.2</label>
<title>Animals</title>
<p>We purchased 24 8-week-old male C57BL/6 mice from the experimental animal center of the Medical College of Zhengzhou University, and they were housed at a 22 &#xb0;C constant room temperature and 47% humidity with a 12-h light-dark cycle and free access to standard laboratory chow and tap water. All experimental procedures on mice were performed in accordance with the National Institutes of Health guidelines and were approved by the Ethical Committee, Animal Care and Use Committee of the First Affiliated Hospital of Zhengzhou University (2020-KY-273).</p>
</sec>
<sec id="s2-3">
<label>2.3</label>
<title>Mouse model of UUO and experimental groups</title>
<p>We used a mouse UUO model with 7-day ureteral obstruction. All mice used in the present study were randomly divided into four groups: the sham group (n &#x3d; 6), the UUO group (n &#x3d; 6), the UUO &#x2b; EPO group (n &#x3d; 6) and the UUO &#x2b; saline group (n &#x3d; 6). We established UUO model according to the accepted procedures depicted in previous studies. Briefly, the mouse was anesthetized with inhaled isoflurane, and the left proximal ureter was exposed. Then ureter was ligated with 6-0 silk thread and severed. Mice in the sham group received the same surgery as mice in the UUO group, except that the ureters were not ligated and severed. For the mice in the UUO &#x2b; EPO group, 100 U/kg body wt rhEPO was administered intraperitoneally every day after operation, which lasted 7 days. For the mice in the UUO &#x2b; saline group, saline was administered intraperitoneally in a manner identical to the rhEPO treatment. All mice in the four groups were sacrificed at the 7th day after operation. The left kidney specimens were collected, and inferior vena cava blood samples were collected for renal function evaluation including blood urea nitrogen (BUN) and serum creatinine (SCr). Part of the kidney tissue was frozen in liquid nitrogen for total RNA and protein extraction, and the remainder was fixed with 4% paraformaldehyde.</p>
</sec>
<sec id="s2-4">
<label>2.4</label>
<title>Histopathological evaluation</title>
<p>The kidney specimens were fixed with 4% paraformaldehyde and embedded in paraffin. The rotary microtome (Leica, Heidelberg, Germany) was used to cut the specimens into 4-&#x3bc;m sections and subjected to hematoxylin and eosin (HE) staining and Masson&#x2019;s trichrome. Then the sections were examined and taken pictures by Leica DM4B microscope equipped with Leica X software. At high magnification (&#xd7;200), we selected six non-overlapping regions of the renal cortex in each section for scoring or image analysis. According to the scoring criteria reported in previous study (<xref ref-type="bibr" rid="B6">Chen and Li, 2018</xref>), the tubulointerstitial impairment was assessed, which included tubular atrophy, tubular necrosis, lymphocyte infiltration, and interstitial fibrosis. The scores for each criterion were as follows: 0 &#x3d; none; 1 &#x3d; mild or &#x3c;25%, 2 &#x3d; moderate or 25%&#x2013;50%, and 3 &#x3d; severe or &#x3e;50%. The blue stained area stained by Masson was considered to be collagen deposition and was analyzed using Image-Pro plus 6.0 software and the results were expressed as the means &#xb1; SD.</p>
</sec>
<sec id="s2-5">
<label>2.5</label>
<title>Immunohistochemistry (IHC)</title>
<p>Using a rotary microtome, the paraffin-embedded kidney specimens were cut into 4-&#x3bc;m sections, then deparaffinized with xylene, and rehydrated with graded ethanol (100%, 95%, 85%, and 75%) and distilled water. The sections were incubated with 3% hydrogen peroxide for 10 min to block the activity of endogenous peroxidase, and then microwaved in 0.01 mol/L citrate buffer (pH 6.0) for 25 min for antigen retrieval. We washed Sections 5 min using phosphate buffered saline (PBS), 3 times in total, and then incubated the sections with the primary antibodies, including anti-&#x3b1;-SMA (1:500), anti-collagen I (1:500), anti-TNF-&#x3b1; (1:300), anti-IL-6 (1:200), and anti-MPO (1:1000), overnight at 4 &#xb0;C. Next day, the sections were washed with PBS, and then incubated with HRP-labeled goat anti-rabbit secondary antibody at room temperature for 1 h. Finally, dehydration, clearing, 3,3&#x2032;-diaminobenzidine (DAB) staining and neutral resin sealing were performed in sequence. Then the sections were examined and taken pictures by Leica DM4B microscope equipped with Leica X software. At high magnification (&#xd7;200), we selected six non-overlapping regions of the renal cortex in each section for image analysis. Image-Pro plus 6.0 software was used to evaluate the integral optical density (IOD) of the positive area, and the results were expressed as the means &#xb1; SD.</p>
</sec>
<sec id="s2-6">
<label>2.6</label>
<title>Cell culture</title>
<p>We purchased the human renal proximal tubular epithelial cell line HK-2 from Beina Chuanglian Biotechnology Institute (Beijing, China), and cultured the cells in a humidified atmosphere of 5% CO2 at 37 &#xb0;C using Dulbecco&#x2019;s modified Eagle medium/nutrient mixture F-12 (DMEM/F12), which was supplemented with 10% (v/v) fetal bovine serum (FBS), 100 IU/mL penicillin, and 10 mg/mL streptomycin. Cells were seeded in 6-well plate at a density of 1 &#xd7; 10<sup>5</sup> cells per well and cultured in 10% FBS complete medium for 24 h. The cells were then cultured in serum-free medium for 24 h, and then treated with rhTGF-&#x3b2;1 at 10 ng/mL in 1% FBS medium for 24 h to induce fibrosis. The concentration and time of rhEPO treatment for HK-2 cells were determined through establishing gradient, the fibrotic HK-2 cells induced by rhTGF-&#x3b2;1 were treated with rhEPO at concentration of 10 U/mL for 0 h, 12 h, 24 h, 48 h respectively, or treated with rhEPO for 24 h at concentration of 0 U/mL, 5 U/mL, 10 U/mL, 20 U/mL respectively.</p>
</sec>
<sec id="s2-7">
<label>2.7</label>
<title>Quantitative real-time polymerase chain reaction (qRT-PCR)</title>
<p>Trizol (Sangon Biotech, B511311, Shanghai, China) was used to extract total RNA, which was stored at &#x2212;80 &#xb0;C and checked the concentration and quality via NanoDrop 2000 UV-Vis spectrophotometer (Thermo Scientific, United States). Then reverse transcription of total RNA was conducted using M-MuLV First-Strand cDNA Synthesis kit (Sangon Biotech, B532435, Shanghai, China). The 2&#xd7;SG Fast qPCR Master Mix (Low Rox) kit (Sangon Biotech, B639272, Shanghai, China) was used to determine the levels of mRNA through the Applied Biosystems 7,500 Sequence Detection System. Each sample was analyzed in triplicate. The &#x3b2;-actin gene served as a control, and the data were analyzed through the 2<sup>&#x2212;(&#x394;&#x394;Ct)</sup> method. To detect the expression level of miR-21-5p, the microRNA First-Strand cDNA Synthesis kit (Sangon Biotech, B532453, Shanghai, China) was used to synthesize cDNA following the manufacturer&#x2019;s protocol. A MicroRNAs Quantitation PCR Kit (Sangon Biotech, B532461, Shanghai, China) was used to conduct qRT-PCR, and an Applied Biosystems 7,500 Sequence Detection System was applied to detect the levels of miR-21-5p. Each sample was analyzed in triplicate. U6 small nuclear RNA served as a control, and the data were analyzed through the 2<sup>&#x2212;(&#x394;&#x394;Ct)</sup> method. The sequences of all primers are listed in <xref ref-type="table" rid="T1">Table 1</xref>.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Primers used for reverse transcription and real-time PCR.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Primer Name</th>
<th align="left"/>
<th align="left">Sequence</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">mmu-&#x3b1;-SMA</td>
<td align="left">Sense<break/>Anti-sense</td>
<td align="left">CTGTTATAGGTGGTTTCGTGGA<break/>GAGCTACGAACTGCCTGAC</td>
</tr>
<tr>
<td align="left">mmu-Collagen I</td>
<td align="left">Sense<break/>Anti-sense</td>
<td align="left">CTTCACCTACAGCACCCTTGTG<break/>GATGACTGTCTTGCCCCAAGTT</td>
</tr>
<tr>
<td align="left">mmu-U6</td>
<td align="left">Stem-loop<break/>Sense<break/>Anti-sense</td>
<td align="left">GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATG<break/>CTCGCTTCGGCAGCACA<break/>AACGCTTCACGAATTTGCGT</td>
</tr>
<tr>
<td align="left">mmu-miR-21-5p</td>
<td align="left">Stem-loop<break/>Sense<break/>Anti-sense</td>
<td align="left">GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAACA<break/>ACACTCCAGCTGGGTAGCTTATCAGACTGA<break/>TGGTGTCGTGGAGTCG</td>
</tr>
<tr>
<td align="left">hsa-U6</td>
<td align="left">Stem-loop<break/>Sense<break/>Anti-sense</td>
<td align="left">CGAGCACAGAATCGCTTCACGAATTTGCGTGTCAT<break/>CGAGCACAGAATCGCTTCA<break/>CTCGCTTCGGCAGCACATAT</td>
</tr>
<tr>
<td align="left">hsa-miR-21-5p</td>
<td align="left">Stem-loop<break/>Sense<break/>Anti-sense</td>
<td align="left">GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAGCCG<break/>CGGCGCAACACCAGTCGATG<break/>AGTGCAGGGTCCGAGGTATT</td>
</tr>
<tr>
<td align="left">Mmu-&#x3b2;-actin</td>
<td align="left">Sense<break/>Anti-sense</td>
<td align="left">AGAGGGAAATCGTGCGTGAC<break/>CAATAGTGATGACCTGGCCGT</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-8">
<label>2.8</label>
<title>Western blotting (WB) assay</title>
<p>According to the manufacturer&#x2019;s instructions, the total protein was isolated from kidney tissues and HK-2 cells using efficient radioimmunoprecipitation assay (RIPA) tissue/cell lysis buffer (Solarbio, R0010, Beijing, China). Enhanced BCA Protein Assay Kit (Beyotime, P0009, Shanghai, China) was used to detect the concentration of total protein. The protein sample was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, loading amount was 30 &#xb5;g per well. In transfer solution, the protein was transferred from the resolving gel to the PVDF membrane by electrophoresis. The membrane was blocked with 5% nonfat milk on a shaker for 2 h and then incubated with primary antibodies overnight at 4 &#xb0;C. Primary antibodies included anti-collagen I (1:1000), anti-&#x3b1;-SMA (1:1000), anti-Spry1 (1:500), anti-ERK1/2 (1:1000), anti-p-ERK1/2 (1:1000), anti-NF-&#x3ba;B (1:500), anti-p-NF-&#x3ba;B (1:500), anti-IL-6 (1:500), anti-TNF-&#x3b1; (1:500), and anti-&#x3b2;-actin (1:2000). TBST solution was used to wash the membrane three times in 30 min. Then, at room temperature, the membrane was incubated with HRP-labeled goat anti-rabbit secondary antibody on a shaker for 1 h. After washing the membrane three times again in TBST solution, the Omni-ECL&#x2122; Femto Light Chemiluminescence kit (EpiZyme, SQ201, Shanghai, China) was used to visualize the bands in the membrane through the Bio-Rad ChemiDoc&#x2122; MP Imaging System. ImageJ software was used to quantify the densities of the bands. The levels of &#x3b2;-actin served as controls, and the results were expressed as the means &#xb1; SD.</p>
</sec>
<sec id="s2-9">
<label>2.9</label>
<title>Cell transfection</title>
<p>The pGV514-miR-21-5p-mimics plasmid for overexpressing miR-21-5p and the corresponding control plasmid were constructed and synthesized by GeneChem (Shanghai, China). The transfection was conducted using lipofectamine 3,000 reagent (Invitrogen) according to the manufacturer&#x2019;s instructions. The cells were seeded in 6-well plate at a density of 1 &#xd7; 10<sup>5</sup> cells per well and transfected at 60%-70% confluence, and then harvested after 48 h of transfection for subsequent experiments.</p>
</sec>
<sec id="s2-10">
<label>2.10</label>
<title>Immunofluorescence</title>
<p>Glass coverslips were placed in wells of 6-well plate in advance and HK-2 cells were seeded at 1 &#xd7; 10<sup>5</sup> per well. Then the cells adhered to the coverslips, which were taken out and washed with PBS. 4% formaldehyde solution was used to fix the cells for 30 min, and then the cells were permeabilized with 0.2% Triton X-100/PBS for 15 min. Thereafter, we blocked the cells with 2% bovine serum albumin for 30 min and then incubated the cells in primary antibodies overnight at 4 &#xb0;C. Next day, the cells were washed with PBS, followed by incubation with FITC-/TRITC-conjugated secondary antibodies for 1 h at room temperature, and then DAPI staining was performed after washing with PBS. At last, the coverslips were checked and taken pictures under fluorescence microscope.</p>
</sec>
<sec id="s2-11">
<label>2.11</label>
<title>Statistical analysis</title>
<p>GraphPad Prism seven was used to determine statistically significant differences. All data are presented as the means &#xb1; SD and were analyzed using one-way analysis of variance with Tukey&#x2019;s test. <italic>P</italic> &#x3c; 0.05 was considered statistically significant.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<label>3</label>
<title>Results</title>
<sec id="s3-1">
<label>3.1</label>
<title>The rhEPO treatment could significantly alleviate the renal cortex collagen deposition and improve renal function in UUO model of mice</title>
<p>HE staining showed that 7 days after the left ureters of mice were ligated, the proximal renal tubules in the cortex of UUO group were significantly dilated and the tubulointerstitial impairment score was increased obviously according to the score criterions (<xref ref-type="fig" rid="F1">Figures 1A,B</xref>). Due to compensation by the right kidneys, the BUN and SCr levels of the UUO group and the UUO &#x2b; saline group were roughly within the normal range (<xref ref-type="table" rid="T2">Table 2</xref>), but compared with Sham group, the upward trend within the normal range was still obvious (<xref ref-type="fig" rid="F1">Figures 1D,E</xref>). The blue-stained area of Masson&#x2019;s trichrome staining expanded significantly in UUO group (<xref ref-type="fig" rid="F1">Figure 1C</xref>). However, comparing UUO &#x2b; EPO group with UUO group or UUO &#x2b; saline group showed that the tubulointerstitial impairment score, the renal function and the blue-stained area of Masson&#x2019;s trichrome staining were decreased significantly.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>The histopathological change of kidneys and renal function were improved by low dose rhEPO treatment in UUO model of mice. <bold>(A)</bold> Representative images of renal cortex in different groups of mice after HE staining (&#xd7;200) and Masson&#x2019;s trichrome staining (&#xd7;200), scale bars represent 50 &#x3bc;m. The images of Blue-stained area of Masson were transformed from representative images of Masson&#x2019;s trichrome staining using Image-Pro plus 6.0 software, the white area refers to the collagen deposition area. <bold>(B,C)</bold> Statistical analyses of tubulointerstitial damage scores and the collagen deposition areas in different groups of mice (mean &#xb1; SD, n &#x3d; 6). <bold>(D,E)</bold> Statistical analyses of BUN and SCr levels in different groups of mice (mean &#xb1; SD, n &#x3d; 6). <sup>&#x2a;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the sham group. <sup>&#x23;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the UUO group. <sup>&#x26;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the UUO &#x2b; saline group.</p>
</caption>
<graphic xlink:href="fmolb-13-1795772-g001.tif">
<alt-text content-type="machine-generated">Panel A displays kidney tissue images stained with hematoxylin and eosin, Masson's trichrome, and blue-stained collagen from four groups: Sham, UUO, UUO plus saline, and UUO plus EPO, each showing varying tissue damage and fibrosis. Panel B shows increased tubulointerstitial impairment scores in obstruction groups with reduction by EPO. Panel C illustrates higher collagen deposition in UUO groups, reduced by EPO. Panels D and E present box plots showing elevated blood urea nitrogen and serum creatinine in obstruction groups, both significantly reduced by EPO treatment.</alt-text>
</graphic>
</fig>
<table-wrap id="T2" position="float">
<label>TABLE 2</label>
<caption>
<p>BUN and SCr levels in the four groups of mice (mean &#xb1; SD, n &#x3d; 6).</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left"/>
<th align="left">Sham</th>
<th align="left">UUO</th>
<th align="left">UUO &#x2b; saline</th>
<th align="left">UUO &#x2b; EPO</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">BUN (mmol/L)</td>
<td align="left">3.663 &#xb1; 0.3572</td>
<td align="left">6.608 &#xb1; 0.3517&#x2a;</td>
<td align="left">6.128 &#xb1; 0.3134&#x2a;</td>
<td align="left">4.390 &#xb1; 0.4956<sup>&#x23;&#x26;</sup>
</td>
</tr>
<tr>
<td align="left">SCr (&#x3bc;mol/L)</td>
<td align="left">17.00 &#xb1; 1.287</td>
<td align="left">42.91 &#xb1; 2.558&#x2a;</td>
<td align="left">41.61 &#xb1; 3.126&#x2a;</td>
<td align="left">29.81 &#xb1; 3.339&#x2a;<sup>&#x23;&#x26;</sup>
</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>The normal BUN, level in mice is 3.86&#x2013;12.41 mmol/L. The normal SCr, level in mice is 10.91&#x2013;85.09 &#x3bc;mol/L <sup>&#x2a;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the sham group. <sup>&#x23;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the UUO, group. <sup>&#x26;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the UUO &#x2b; saline group.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3-2">
<label>3.2</label>
<title>The upregulation of fibrosis indicators could be reversed by the rhEPO treatment in kidneys of UUO model in mice</title>
<p>The results of qRT-PCR showed that the expression levels of &#x3b1;-SMA and Collagen &#x399; were increased significantly after 7-day obstruction in kidneys of UUO group, but the elevations were inhibited by low dose rhEPO treatment in UUO &#x2b; EPO group (<xref ref-type="fig" rid="F2">Figures 2A,B</xref>). The similar results were also revealed by Western blotting (<xref ref-type="fig" rid="F2">Figures 2C,D</xref>) and immunohistochemical staining (<xref ref-type="fig" rid="F2">Figures 2E&#x2013;G</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>The fibrosis indicators were increased in kidneys of UUO model in mice, and the upregulation could be reversed by rhEPO treatment. <bold>(A,B)</bold> Relative &#x3b1;-SMA and collagen I mRNA expression in kidneys of different groups in mice determined by qRT-PCR (mean &#xb1; SD, n &#x3d; 3). <bold>(C,D)</bold> Representative bands and fold changes in &#x3b1;-SMA and collagen I protein expression in kidneys of different groups in mice determined by Western blotting (mean &#xb1; SD, n &#x3d; 3). <bold>(E&#x2013;G)</bold> Representative IHC images and fold changes for &#x3b1;-SMA and collagen I in kidneys of different groups in mice (&#xd7;200), scale bar represents 50 &#x3bc;m (mean &#xb1; SD, n &#x3d; 6). <sup>&#x2a;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the sham group. <sup>&#x23;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the UUO group. <sup>&#x26;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the UUO &#x2b; saline group.</p>
</caption>
<graphic xlink:href="fmolb-13-1795772-g002.tif">
<alt-text content-type="machine-generated">Figure panel showing quantitative bar graphs, Western blot results, immunohistochemistry images, and analyses of &#x3B1;-SMA and Collagen I expression in four groups: Sham, UUO, UUO plus saline, and UUO plus EPO. Panels A, B, and D display significantly increased mRNA and protein expression of &#x3B1;-SMA and Collagen I in UUO and UUO plus saline, with reduction in UUO plus EPO. Panel C shows corresponding Western blots. Panel E presents kidney tissue immunohistochemistry for &#x3B1;-SMA (top row) and Collagen I (bottom row), demonstrating elevated staining in UUO and UUO plus saline, attenuated in UUO plus EPO. Panels F and G quantify IOD sum for &#x3B1;-SMA and Collagen I, consistent with other results.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-3">
<label>3.3</label>
<title>The rhEPO treatment could reverse the upregulation of miR-21-5p and the activation of SPRY1/ERK/NF-&#x3ba;B signaling pathway in kidneys of UUO model in mice</title>
<p>The levels of miR-21-5p were elevated obviously in kidneys of UUO group according to the results of qRT-PCR (<xref ref-type="fig" rid="F3">Figure 3A</xref>). While the protein expression levels of SPRY1 decreased, the protein expression levels of p-ERK1/2, p-NF-&#x3ba;B, IL-6 and TNF-&#x3b1; increased, as shown by Western blotting in UUO group (<xref ref-type="fig" rid="F3">Figures 3B&#x2013;E</xref>). Impressively, the 7-day low dose rhEPO treatment in UUO &#x2b; EPO group could reverse the results listed above according to the results of qRT-PCR and Western blotting.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>The upregulation of miR-21-5p and the activation of SPRY1/ERK/NF-&#x3ba;B signaling pathway in kidneys of UUO model in mice could be reversed by rhEPO treatment <bold>(A)</bold> miR-21-5p levels in kidneys of different groups in mice determined by qRT-PCR (mean &#xb1; SD, n &#x3d; 3). <bold>(B&#x2013;E)</bold> Representative bands and fold changes in Spry1, p-ERK1/2, ERK1/2, p-NF-&#x3ba;B, NF-&#x3ba;B, IL-6 and TNF-&#x3b1; protein expression in kidneys of mice in different groups, determined by Western blotting (mean &#xb1; SD, n &#x3d; 3).<sup>&#x2a;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the sham group. <sup>&#x23;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the UUO group. <sup>&#x26;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the UUO &#x2b; saline group.</p>
</caption>
<graphic xlink:href="fmolb-13-1795772-g003.tif">
<alt-text content-type="machine-generated">Composite figure showing molecular and protein expression data in four experimental groups: Sham, UUO, UUO plus saline, and UUO plus EPO. Panel A is a bar graph of relative miR-21-5p expression, with increases in UUO and UUO plus saline, and reduction in UUO plus EPO. Panel B shows Western blots for proteins SPRY1, p-ERK1/2, ERK1/2, p-NF-&#x3BA;B, NF-&#x3BA;B, IL-6, TNF-&#x3B1;, and &#x3B2;-actin across groups. Panels C, D, and E present bar graphs quantifying protein expression of p-ERK1/2, SPRY1, IL-6, TNF-&#x3B1;, and p-NF-&#x3BA;B, showing increased levels in UUO and reversal with EPO treatment. Statistical symbols denote significance.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-4">
<label>3.4</label>
<title>The rhEPO treatment could ameliorate the inflammatory response of the renal cortex in the UUO model of mice</title>
<p>The results of immunohistochemical staining showed that MPO-positive inflammatory cells were increased and the expression of IL-6 and TNF-&#x3b1; was enhanced significantly in the renal cortex after 7-day obstruction in kidneys of UUO group. In the UUO &#x2b; EPO group, the intervention with 7-day low dose rhEPO treatment in mice could decrease the MPO-positive inflammatory cells and inhibit the expression of IL-6 and TNF-&#x3b1; (<xref ref-type="fig" rid="F4">Figure 4</xref>).</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>The inflammatory response of the renal cortex in the UUO model of mice was ameliorated by rhEPO treatment. <bold>(A)</bold> Representative IHC images of MPO, IL-6 and TNF-&#x3b1; in kidneys of different groups in mice (&#xd7;200), scale bar represents 50 &#x3bc;m. <bold>(B)</bold> MPO positive cells count in the renal cortex of different groups in mice (mean &#xb1; SD, n &#x3d; 6). <bold>(C,D)</bold> Fold changes in IL-6 and TNF-&#x3b1; levels in kidneys of different groups in mice (mean &#xb1; SD, n &#x3d; 6). <sup>&#x2a;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the sham group. <sup>&#x23;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the UUO group. <sup>&#x26;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the UUO &#x2b; saline group.</p>
</caption>
<graphic xlink:href="fmolb-13-1795772-g004.tif">
<alt-text content-type="machine-generated">Panel A presents immunohistochemistry images of kidney sections stained for MPO, IL-6, and TNF-&#x3B1; across four groups: Sham, UUO, UUO plus saline, and UUO plus EPO. Panels B, C, and D provide bar graphs quantifying MPO-positive cells, and fold changes of IL-6 and TNF-&#x3B1;, respectively, showing increased expression in the UUO and UUO plus saline groups, with reduction in the UUO plus EPO group.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-5">
<label>3.5</label>
<title>EPO could alleviate the fibrosis of HK-2 cells induced by TGF-&#x3b2;1 through inhibiting the expression of miR-21-5p</title>
<p>The induction of HK-2 cells by rhTGF-&#x3b2;1 at 10 ng/mL for 24 h promoted the expression of &#x3b1;-SMA and Collagen &#x399;, and resulted in conversion of cell morphology to be spindle-shaped (<xref ref-type="fig" rid="F5">Figures 5F,H</xref>). Results of the time gradient with 10 U/mL rhEPO in treatment of HK-2 cells revealed that the expression of &#x3b1;-SMA in HK-2 cells induced by rhTGF-&#x3b2;1 was decreased significantly after intervention for 24 h and 48 h (<xref ref-type="fig" rid="F5">Figures 5A,C</xref>). And results of the concentration gradient with rhEPO intervention for 24 h showed that the rhEPO concentration at 10 U/mL and 20 U/mL inhibited the expression of &#x3b1;-SMA significantly (<xref ref-type="fig" rid="F5">Figures 5B,D</xref>). So the concentration and time of rhEPO treatment for HK-2 cells were set to 10 U/mL for 24 h in the subsequent experiments. According to the results of Western blotting, the treatment with rhEPO could reverse the upregulation of &#x3b1;-SMA and Collagen &#x399; causing by rhTGF-&#x3b2;1 induction or transfection with miR-21-5p mimics in HK-2 cells (<xref ref-type="fig" rid="F5">Figures 5F,G</xref>), and immunofluorescence staining showed the consistent results with Western blotting (<xref ref-type="fig" rid="F5">Figures 5H</xref>, <xref ref-type="fig" rid="F6">6C</xref>). The rhTGF-&#x3b2;1 induction promoted the expression of miR-21-5p, but the upregulation was inhibit after treatment with rhEPO (<xref ref-type="fig" rid="F5">Figure 5E</xref>).</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>EPO could alleviate the fibrosis of HK-2 cells induced by TGF-&#x3b2;1 through inhibiting the expression of miR-21-5p. <bold>(A&#x2013;D)</bold> Representative bands and fold changes in &#x3b1;-SMA protein expression in HK-2 cells induced by concentration and time gradient of TGF-&#x3b2;1, determined by Western blotting (mean &#xb1; SD, n &#x3d; 3). <sup>&#x2a;</sup>
<italic>P</italic> &#x3c; 0.05, compared to 0 h or 0 U/mL. <sup>&#x23;</sup>
<italic>P</italic> &#x3c; 0.05, compared to 12 h or 5 U/mL. <bold>(E)</bold> miR-21-5p levels in HK-2 cells treated with TGF-&#x3b2;1 and rhEPO determined by qRT-PCR (mean &#xb1; SD, n &#x3d; 3). <sup>&#x2a;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the control group. <sup>&#x23;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the TGF-&#x3b2;1 group. <sup>&#x26;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the TGF-&#x3b2;1 &#x2b; saline group. <bold>(F,G)</bold> Representative bands and fold changes in &#x3b1;-SMA and collagen I protein expression in HK-2 cells treated with TGF-&#x3b2;1 or rhEPO or miR-21-5p-mimic, determined by Western blotting (mean &#xb1; SD, n &#x3d; 3). <sup>&#x2a;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the control group. <sup>&#x23;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the TGF-&#x3b2;1 group. <sup>&#x26;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the miR-21-5p-mimic group. <bold>(H)</bold> Immunofluorescence staining of &#x3b1;-SMA (&#xd7;400) in HK-2 cells showing that TGF-&#x3b2;1 increased &#x3b1;-SMA expression, whereas treatment with rhEPO reversed this effect; scale bar represents 20 &#x3bc;m. </p>
</caption>
<graphic xlink:href="fmolb-13-1795772-g005.tif">
<alt-text content-type="machine-generated">Scientific figure containing western blots, bar graphs, and immunofluorescence images. Panels A, B, and F display protein bands for &#x3B1;-SMA, Collagen I, and &#x3B2;-actin under different conditions and time points. Panels C, D, E, and G show corresponding bar graphs quantifying protein or miR-21-5p expression with statistical annotations (&#x2a;, #, &#x26;). Panel H presents three sets of cell images stained for nuclei (blue) and &#x3B1;-SMA (green), with merged views, comparing Control, TGF-&#x3B2;1, and TGF-&#x3B2;1&#x2b;EPO groups.</alt-text>
</graphic>
</fig>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>Pro-fibrosis effect of miR-21-5p in HK-2 cells was inhibited by EPO through regulating SPRY1/ERK/NF-kB signaling pathway. <bold>(A,B)</bold> Representative bands and fold changes in Spry1, p-ERK1/2, ERK1/2, p-NF-kB and NF-kB protein expression in HK-2 cells treated with rhEPO or miR-21-5p-mimic, determined by Western blotting (mean &#xb1; SD, n &#x3d; 3). <sup>&#x2a;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the miR-NC group. <sup>&#x23;</sup>
<italic>P</italic> &#x3c; 0.05, compared to the miR-21-5p-mimic group. <bold>(C)</bold> Immunofluorescence staining of &#x3b1;-SMA (&#xd7;400) in HK-2 cells showing that miR-21-5p-mimic transfection increased &#x3b1;-SMA expression, whereas treatment with rhEPO reversed this effect; scale bar represents 20 &#x3bc;m. <bold>(D)</bold> Mode pattern of the EPO-miR-21-5p-SPRY1/ERK/NF-kB regulatory network in obstructive renal fibrosis.</p>
</caption>
<graphic xlink:href="fmolb-13-1795772-g006.tif">
<alt-text content-type="machine-generated">Panel A shows Western blot results of SPRY1, &#x3B2;-actin, p-ERK1/2, ERK1/2, p-NF-&#x3BA;B, and NF-&#x3BA;B protein expression under different treatments. Panel B presents bar graphs quantifying these protein levels. Panel C displays immunofluorescence images of HK-2 cells with DAPI staining (blue), &#x3B1;-SMA staining (green), and merged images under three conditions. Panel D contains a schematic diagram depicting molecular pathways involving miR-21-5p, SPRY1, EPO, and downstream signaling in HK-2 cells, with arrows indicating activation and inhibition.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-6">
<label>3.6</label>
<title>EPO could attenuate pro-fibrosis effect of miR-21-5p via inhibiting SPRY1/ERK/NF-&#x3ba;B signaling pathway in HK-2 cells</title>
<p>The transfection with miR-21-5p mimics in HK-2 cells could increase the expression of &#x3b1;-SMA and Collagen &#x399; showing by the results of Western blotting and immunofluorescence staining, but the effect could be counteracted by rhEPO (<xref ref-type="fig" rid="F5">Figures 5F,G</xref>, <xref ref-type="fig" rid="F6">6C</xref>). Moreover, the transfection with miR-21-5p mimics in HK-2 cells increased p-ERK1/2 and p-NF-&#x3ba;B protein levels, but decreased SPRY1 protein levels. However, the treatment with rhEPO reversed the SPRY1/ERK/NF-&#x3ba;B pathway activation, in which the protein level of SPRY1 was increased, but p-ERK1/2 and p-NF-&#x3ba;B were decreased (<xref ref-type="fig" rid="F6">Figures 6A,B</xref>).</p>
<p>Taken together, our results indicate that the low-dose rhEPO treatment has obvious anti-inflammatory and anti-fibrotic effects on obstructive kidneys in mice, which may be achieved by inhibiting miR-21-5p/SPRY1/ERK/NF-&#x3ba;B signaling pathway (<xref ref-type="fig" rid="F6">Figure 6D</xref>).</p>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<label>4</label>
<title>Discussion</title>
<p>The anti-fibrotic effect of EPO has been well-documented in numerous other organs, including the liver (<xref ref-type="bibr" rid="B40">Park et al., 2012</xref>; <xref ref-type="bibr" rid="B50">Wang et al., 2020b</xref>), heart (<xref ref-type="bibr" rid="B29">Lu et al., 2012</xref>; <xref ref-type="bibr" rid="B27">Liu et al., 2018</xref>), skeletal muscle (<xref ref-type="bibr" rid="B52">Wu et al., 2020</xref>). Initially, the rationale for investigating EPO lies in its capacity to exert a prominent protective effect against injuries of various organs and tissues (<xref ref-type="bibr" rid="B40">Park et al., 2012</xref>; <xref ref-type="bibr" rid="B29">Lu et al., 2012</xref>; <xref ref-type="bibr" rid="B4">Bagnis et al., 2001</xref>). In ischemia-reperfusion injury (IRI) of kidney, previous studies have confirmed that EPO can reduce macrophage infiltration, and promote renal tubular repair and regeneration (<xref ref-type="bibr" rid="B19">Han et al., 2023</xref>; <xref ref-type="bibr" rid="B46">va et al., 2013</xref>; <xref ref-type="bibr" rid="B21">Imamura et al., 2012</xref>; <xref ref-type="bibr" rid="B7">Chen et al., 2015</xref>), suggesting that its protective effect may be attributed to regulation of immunity. In the present study, 7 days of ureteral obstruction induced left renal fibrosis in mice, low-dose rhEPO treatment significantly reduced the tubulointerstitial injury score and markedly improved renal function, the treatment also attenuated collagen deposition in the renal cortex and suppressed the expression of renal fibrosis markers, which is consistent with the findings of previous studies (<xref ref-type="bibr" rid="B24">Lee et al., 2020</xref>; <xref ref-type="bibr" rid="B17">Geng et al., 2015</xref>; <xref ref-type="bibr" rid="B1">Acikgoz et al., 2014</xref>). Thus, most researchers concur that EPO exerts anti-fibrotic effect and possesses nephroprotective property in renal injury (<xref ref-type="bibr" rid="B24">Lee et al., 2020</xref>; <xref ref-type="bibr" rid="B18">Gouva et al., 2004</xref>; <xref ref-type="bibr" rid="B56">Zhang et al., 2020</xref>; <xref ref-type="bibr" rid="B13">Elbaset et al., 2023</xref>).</p>
<p>Inflammation, a specific manifestation of the immune response in local tissues that serves as the body&#x2019;s defensive mechanism against injury, infection, or other stimuli, persists throughout the development of CKD and plays a promotional role (<xref ref-type="bibr" rid="B33">Morgado-Pascual et al., 2018</xref>), tissue damage activates the immune system, followed by the migration of immune or inflammatory cells&#x2014;a subset of which express MPO, such as neutrophils, monocytes, and macrophages&#x2014;to the injury site. These cells release inflammatory cytokines, thereby triggering an inflammatory response. These fall within the scope of innate immune responses. In this study, results demonstrated that cytokines including IL-6 and TNF-&#x3b1; were elevated significantly, and the MPO-positive cells infiltrated the renal cortex in mice of UUO group. In contrast, in the UUO &#x2b; EPO group, 7-day low-dose rhEPO treatment significantly inhibited the expression of IL-6 and TNF-&#x3b1;, and the number of MPO-positive cells was also distinctly reduced. Therefore, EPO can effectively ameliorate the inflammatory and immune response in the renal cortex during obstructive renal fibrosis, which is also consistent with previous reports (<xref ref-type="bibr" rid="B56">Zhang et al., 2020</xref>; <xref ref-type="bibr" rid="B13">Elbaset et al., 2023</xref>; <xref ref-type="bibr" rid="B37">Oh et al., 2025</xref>). However, the underlying mechanisms of its immune regulation remain highly complex and incompletely understood.</p>
<p>The prominent pathogenic role of innate immunity in CKD has been well-established in various experimental models recently (<xref ref-type="bibr" rid="B15">Foresto-Neto et al., 2020</xref>; <xref ref-type="bibr" rid="B55">Zambom et al., 2019</xref>; <xref ref-type="bibr" rid="B14">Faustino et al., 2018</xref>; <xref ref-type="bibr" rid="B2">Albino et al., 2021</xref>). In principle, activation of innate immunity induced by membrane debris and biomolecules released following renal IRI or toxic cell damage should be self-limited and thus cease once tubular regeneration is completed. While if innate immunity activation persists, the resulting inflammation could lead to continuing renal damage. Accumulating evidence (<xref ref-type="bibr" rid="B15">Foresto-Neto et al., 2020</xref>; <xref ref-type="bibr" rid="B14">Faustino et al., 2018</xref>; <xref ref-type="bibr" rid="B2">Albino et al., 2021</xref>) has demonstrated that chronic activation of NF-&#x3ba;B system&#x2014;which regulates a multitude of genes critical to innate immunity and inflammation (<xref ref-type="bibr" rid="B30">Ma et al., 2011</xref>)&#x2014;is the key to sustaining the insidious process of renal inflammation that ultimately progresses to CKD by driving a complex transition to renal fibrosis. Our results revealed that the expression level of p-NF-&#x3ba;B was increased in kidneys of UUO group, indicating that the NF-&#x3ba;B system was activated and that innate immunity is involved in inflammatory process of obstructive renal fibrosis. Likewise the low dose rhEPO treatment in the UUO &#x2b; EPO group could reduce the p-NF-&#x3ba;B expression, suggesting that EPO may exert anti-inflammatory and anti-fibrotic effect by regulating NF-&#x3ba;B system and innate immunity. However, the specific signaling pathways involved warrant further in-depth investigation. Meanwhile, studies have confirmed that EPO can physiologically regulate the differentiation of IL-17-producing CD4<sup>&#x2b;</sup> T cells (Th17 cells), thereby inhibiting the secretion of IL-17 and the recruitment of neutrophils and serving as a barrier against the development of autoimmune kidney disease (<xref ref-type="bibr" rid="B11">Donadei et al., 2019</xref>). So the role of adaptive immunity cannot be neglected and merits further exploration in subsequent researches.</p>
<p>
<xref ref-type="bibr" rid="B31">Mo et al. (2020)</xref> reported that miR-21 was upregulated in Nano-Ni-induced pulmonary fibrosis, and knocking out miR-21 ameliorated pulmonary inflammation significantly. <xref ref-type="bibr" rid="B36">Nurrahmah et al. (2021)</xref> also revealed that Retinoic acid abrogates LPS-induced inflammatory response via negative regulation of miR-21 and NF-&#x3ba;B signaling pathway. Our results revealed that miR-21-5p was significantly elevated and SPRY1/ERK/NF-&#x3ba;B pathway was activated in kidney tissue of mice in UUO group. SPRY1, a direct target of miR-21, inhibits the ERK/NF-&#x3ba;B pathway, which is an inflammation-related signaling pathways (<xref ref-type="bibr" rid="B51">White et al., 2020</xref>). Moreover, the low dose rhEPO treatment in the UUO &#x2b; EPO group could decrease the miR-21-5p expression and reverse the activation of SPRY1/ERK/NF-&#x3ba;B signaling pathway. Therefore, we propose that EPO maybe inhibit the inflammatory and immune response of obstructive kidneys by negatively regulating miR-21-5p and its downstream SPRY1/ERK/NF-&#x3ba;B pathways, thereby inhibiting renal fibrosis of mice.</p>
<p>In summary, our research showed that 7-day low dose rhEPO treatment could significantly alleviate cortical inflammation and fibrosis in the obstructive kidneys of mice. Additionally, both <italic>in vivo</italic> and <italic>in vitro</italic> studies demonstrated that rhEPO treatment could reverse the upregulation of miR-21-5p and the activation of the SPRY1/ERK/NF-&#x3ba;B pathway. These results indicate that EPO probably exerts anti-inflammatory and anti-fibrotic effects in obstructive renal fibrosis through miR-21-5p/SPRY1/ERK/NF-kB axis. Our conclusion helps to understand the underlying mechanisms of EPO in the renal fibrosis treatment.</p>
<p>However, our study still has limitations. In clinical practice, EPO therapy is associated with certain side effects, such as hypertension and thrombosis (<xref ref-type="bibr" rid="B32">M&#xf6;llmann, 1992</xref>), which have limited its translational application to a certain extent. Existing studies have confirmed that non-hematopoietic EPO analogs can minimize the hematopoietic-related side effects of natural EPO to the greatest extent and fully exert its anti-inflammatory effects (<xref ref-type="bibr" rid="B44">Sugimoto and Goda, 2025</xref>) as well as tissue protective effects against hypoxic stress (<xref ref-type="bibr" rid="B9">Cho et al., 2022</xref>), which points out the direction for subsequent translational development. As the most commonly used animal model in renal fibrosis research, the UUO model is characterized by stability, rapidity, and maturity. However, it still has certain limitations and cannot fully simulate the disease progression of CKD, which is not conducive to the in-depth exploration of the disease mechanism. Therefore, it is still necessary to explore and establish more suitable animal models for renal fibrosis research. Although we have revealed that EPO can reduce the expression of miR-21-5p, which is in line with the findings of a previous study (<xref ref-type="bibr" rid="B7">Chen et al., 2015</xref>), there is a lack of functional gain/loss experiments of miR-21-5p in the primary disease model, and we have not yet confirmed whether EPO regulates miR-21 directly. We believe that the anti-fibrotic effect of EPO is closely associated with innate immunity, while it remains unclear which specific immune cells it acts upon. In our ongoing follow-up studies, we will continue this line of research, further explore the specific manner by which EPO affects miR-21 expression, and investigate the in-depth anti-fibrotic immune mechanism of EPO in obstructive renal fibrosis.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="sec" rid="s12">Supplementary Material</xref>, further inquiries can be directed to the corresponding author.</p>
</sec>
<sec sec-type="ethics-statement" id="s6">
<title>Ethics statement</title>
<p>The animal study was approved by the Ethical Committee, Animal Care and Use Committee of the First Affiliated Hospital of Zhengzhou University. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec sec-type="author-contributions" id="s7">
<title>Author contributions</title>
<p>EL: Conceptualization, Data curation, Formal Analysis, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing &#x2013; original draft, Writing &#x2013; review and editing. XS: Data curation, Funding acquisition, Resources, Visualization, Writing &#x2013; original draft, Writing &#x2013; review and editing. QL: Funding acquisition, Resources, Writing &#x2013; original draft, Writing &#x2013; review and editing. DJ: Resources, Writing &#x2013; original draft, Writing &#x2013; review and editing. GL: Funding acquisition, Resources, Writing &#x2013; original draft, Writing &#x2013; review and editing. HZ: Resources, Writing &#x2013; original draft, Writing &#x2013; review and editing. HS: Resources, Writing &#x2013; original draft, Writing &#x2013; review and editing. YD: Conceptualization, Data curation, Formal Analysis, Funding acquisition, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing &#x2013; original draft, Writing &#x2013; review and editing.</p>
</sec>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s10">
<title>Generative AI statement</title>
<p>The author(s) declared that generative AI was not used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec sec-type="disclaimer" id="s11">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec sec-type="supplementary-material" id="s12">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fmolb.2026.1795772/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fmolb.2026.1795772/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet3.zip" id="SM1" mimetype="application/zip" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="DataSheet4.zip" id="SM2" mimetype="application/zip" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="DataSheet1.zip" id="SM3" mimetype="application/zip" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="DataSheet6.zip" id="SM4" mimetype="application/zip" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="DataSheet2.zip" id="SM5" mimetype="application/zip" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="DataSheet5.zip" id="SM6" mimetype="application/zip" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Acikgoz</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Can</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Bek</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Acikgoz</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Ozkaya</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Gen&#xe7;</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>The effect of simvastatin and erythropoietin on renal fibrosis in rats with unilateral ureteral obstruction</article-title>. <source>Ren. Fail</source> <volume>36</volume> (<issue>2</issue>), <fpage>252</fpage>&#x2013;<lpage>257</lpage>. <pub-id pub-id-type="doi">10.3109/0886022x.2013.836936</pub-id>
<pub-id pub-id-type="pmid">24083846</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Albino</surname>
<given-names>A. H.</given-names>
</name>
<name>
<surname>Zambom</surname>
<given-names>F. F. F.</given-names>
</name>
<name>
<surname>Foresto-Neto</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Oliveira</surname>
<given-names>K. C.</given-names>
</name>
<name>
<surname>&#xc1;vila</surname>
<given-names>V. F.</given-names>
</name>
<name>
<surname>Arias</surname>
<given-names>S. C. A.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Renal inflammation and innate immune activation underlie the transition from gentamicin-induced acute kidney injury to renal fibrosis</article-title>. <source>Front. Physiol.</source> <volume>12</volume>, <fpage>606392</fpage>. <pub-id pub-id-type="doi">10.3389/fphys.2021.606392</pub-id>
<pub-id pub-id-type="pmid">34305624</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alural</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Ayyildiz</surname>
<given-names>Z. O.</given-names>
</name>
<name>
<surname>Tufekci</surname>
<given-names>K. U.</given-names>
</name>
<name>
<surname>Genc</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Genc</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Erythropoietin promotes glioblastoma <italic>via</italic> miR-451 suppression</article-title>. <source>Vitam. Horm.</source> <volume>105</volume>, <fpage>249</fpage>&#x2013;<lpage>271</lpage>. <pub-id pub-id-type="doi">10.1016/bs.vh.2017.03.002</pub-id>
<pub-id pub-id-type="pmid">28629521</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bagnis</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Beaufils</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Jacquiaud</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Adabra</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Jouanneau</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Le Nahour</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>2001</year>). <article-title>Erythropoietin enhances recovery after cisplatin-induced acute renal failure in the rat</article-title>. <source>Nephrol. Dial. Transpl.</source> <volume>16</volume> (<issue>5</issue>), <fpage>932</fpage>&#x2013;<lpage>938</lpage>. <pub-id pub-id-type="doi">10.1093/ndt/16.5.932</pub-id>
<pub-id pub-id-type="pmid">11328897</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Braga</surname>
<given-names>T. T.</given-names>
</name>
<name>
<surname>Correa-Costa</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Guise</surname>
<given-names>Y. F.</given-names>
</name>
<name>
<surname>Castoldi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>de Oliveira</surname>
<given-names>C. D.</given-names>
</name>
<name>
<surname>Hyane</surname>
<given-names>M. I.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>MyD88 signaling pathway is involved in renal fibrosis by favoring a TH2 immune response and activating alternative M2 macrophages</article-title>. <source>Mol. Med.</source> <volume>18</volume> (<issue>1</issue>), <fpage>1231</fpage>&#x2013;<lpage>1239</lpage>. <pub-id pub-id-type="doi">10.2119/molmed.2012.00131</pub-id>
<pub-id pub-id-type="pmid">22777483</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Telbivudine attenuates UUO-induced renal fibrosis <italic>via</italic> TGF-&#x3b2;/Smad and NF-&#x3ba;B signaling</article-title>. <source>Int. Immunopharmacol.</source> <volume>55</volume>, <fpage>1</fpage>&#x2013;<lpage>8</lpage>. <pub-id pub-id-type="doi">10.1016/j.intimp.2017.11.043</pub-id>
<pub-id pub-id-type="pmid">29207359</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>C. C.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>S. Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J. S.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>S. L.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>The administration of erythropoietin attenuates kidney injury induced by ischemia/reperfusion with increased activation of Wnt/&#x3b2;-catenin signaling</article-title>. <source>J. Formos. Med. Assoc.</source> <volume>114</volume> (<issue>5</issue>), <fpage>430</fpage>&#x2013;<lpage>437</lpage>. <pub-id pub-id-type="doi">10.1016/j.jfma.2015.01.007</pub-id>
<pub-id pub-id-type="pmid">25682558</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chiu</surname>
<given-names>D. K.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>B. Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Hayashi</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Tumor-derived erythropoietin acts as an immunosuppressive switch in cancer immunity</article-title>. <source>Science</source> <volume>388</volume> (<issue>6745</issue>), <fpage>eadr3026</fpage>. <pub-id pub-id-type="doi">10.1126/science.adr3026</pub-id>
<pub-id pub-id-type="pmid">40273234</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cho</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Yoo</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>S. Y.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>Y. I.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>S. R.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Second-generation non-hematopoietic erythropoietin-derived peptide for neuroprotection</article-title>. <source>Redox Biol.</source> <volume>49</volume>, <fpage>102223</fpage>. <pub-id pub-id-type="doi">10.1016/j.redox.2021.102223</pub-id>
<pub-id pub-id-type="pmid">34953452</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Choi</surname>
<given-names>K. C.</given-names>
</name>
<name>
<surname>Hwang</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Bang</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>B. T.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>D. H.</given-names>
</name>
<name>
<surname>Chae</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Chloroform extract of alfalfa (Medicago sativa) inhibits lipopolysaccharide-induced inflammation by downregulating ERK/NF-&#x3ba;B signaling and cytokine production</article-title>. <source>J. Med. Food</source> <volume>16</volume> (<issue>5</issue>), <fpage>410</fpage>&#x2013;<lpage>420</lpage>. <pub-id pub-id-type="doi">10.1089/jmf.2012.2679</pub-id>
<pub-id pub-id-type="pmid">23631491</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Donadei</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Angeletti</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Cantarelli</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>D&#x27;Agati</surname>
<given-names>V. D.</given-names>
</name>
<name>
<surname>La Manna</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Fiaccadori</surname>
<given-names>E.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Erythropoietin inhibits SGK1-dependent TH17 induction and TH17-dependent kidney disease</article-title>. <source>JCI Insight</source> <volume>5</volume> (<issue>10</issue>). <pub-id pub-id-type="doi">10.1172/jci.insight.127428</pub-id>
<pub-id pub-id-type="pmid">31013255</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Du</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Zeng</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>CD38 deficiency up-regulated IL-1&#x3b2; and MCP-1 through TLR4/ERK/NF-&#x3ba;B pathway in sepsis pulmonary injury</article-title>. <source>Microbes Infect.</source> <volume>23</volume> (<issue>9-10</issue>), <fpage>104845</fpage>. <pub-id pub-id-type="doi">10.1016/j.micinf.2021.104845</pub-id>
<pub-id pub-id-type="pmid">34098107</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Elbaset</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Mohamed</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Gad</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Afifi</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Esatbeyoglu</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Abdelrahman</surname>
<given-names>S. S.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Erythropoietin mitigated thioacetamide-induced renal injury <italic>via</italic> JAK2/STAT5 and AMPK pathway</article-title>. <source>Sci. Rep.</source> <volume>13</volume> (<issue>1</issue>), <fpage>14929</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-023-42210-1</pub-id>
<pub-id pub-id-type="pmid">37697015</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Faustino</surname>
<given-names>V. D.</given-names>
</name>
<name>
<surname>Arias</surname>
<given-names>S. C. A.</given-names>
</name>
<name>
<surname>Ferreira &#xc1;vila</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Foresto-Neto</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Zambom</surname>
<given-names>F. F. F.</given-names>
</name>
<name>
<surname>Machado</surname>
<given-names>F. G.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Simultaneous activation of innate and adaptive immunity participates in the development of renal injury in a model of heavy proteinuria</article-title>. <source>Biosci. Rep.</source> <volume>38</volume> (<issue>4</issue>). <pub-id pub-id-type="doi">10.1042/bsr20180762</pub-id>
<pub-id pub-id-type="pmid">29914975</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Foresto-Neto</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Albino</surname>
<given-names>A. H.</given-names>
</name>
<name>
<surname>Arias</surname>
<given-names>S. C. A.</given-names>
</name>
<name>
<surname>Faustino</surname>
<given-names>V. D.</given-names>
</name>
<name>
<surname>Zambom</surname>
<given-names>F. F. F.</given-names>
</name>
<name>
<surname>Cenedeze</surname>
<given-names>M. A.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>NF-&#x3ba;B system is chronically activated and promotes glomerular injury in experimental type 1 diabetic kidney disease</article-title>. <source>Front. Physiol.</source> <volume>11</volume>, <fpage>84</fpage>. <pub-id pub-id-type="doi">10.3389/fphys.2020.00084</pub-id>
<pub-id pub-id-type="pmid">32116790</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gasparitsch</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Arndt</surname>
<given-names>A. K.</given-names>
</name>
<name>
<surname>Pawlitschek</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Oberle</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Keller</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>Kasper</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>RAGE-mediated interstitial fibrosis in neonatal obstructive nephropathy is independent of NF-&#x3ba;B activation</article-title>. <source>Kidney Int.</source> <volume>84</volume> (<issue>5</issue>), <fpage>911</fpage>&#x2013;<lpage>919</lpage>. <pub-id pub-id-type="doi">10.1038/ki.2013.171</pub-id>
<pub-id pub-id-type="pmid">23677242</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Geng</surname>
<given-names>X. C.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>Z. P.</given-names>
</name>
<name>
<surname>Lian</surname>
<given-names>G. Y.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Erythropoietin ameliorates renal interstitial fibrosis <italic>via</italic> the inhibition of fibrocyte accumulation</article-title>. <source>Mol. Med. Rep.</source> <volume>11</volume> (<issue>5</issue>), <fpage>3860</fpage>&#x2013;<lpage>3865</lpage>. <pub-id pub-id-type="doi">10.3892/mmr.2015.3157</pub-id>
<pub-id pub-id-type="pmid">25572934</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gouva</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Nikolopoulos</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Ioannidis</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>Siamopoulos</surname>
<given-names>K. C.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Treating anemia early in renal failure patients slows the decline of renal function: a randomized controlled trial</article-title>. <source>Kidney Int.</source> <volume>66</volume> (<issue>2</issue>), <fpage>753</fpage>&#x2013;<lpage>760</lpage>. <pub-id pub-id-type="doi">10.1111/j.1523-1755.2004.00797.x</pub-id>
<pub-id pub-id-type="pmid">15253730</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Han</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>Y. Y.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Update on the role and mechanism of erythropoietin receptor in acute kidney injury and repair or fibrosis</article-title>. <source>Sheng Li Xue Bao</source> <volume>75</volume> (<issue>1</issue>), <fpage>115</fpage>&#x2013;<lpage>129</lpage>.<pub-id pub-id-type="pmid">36859841</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hassan</surname>
<given-names>N. M. E.</given-names>
</name>
<name>
<surname>Said</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Shehatou</surname>
<given-names>G. S. G.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Nifuroxazide suppresses UUO-induced renal fibrosis in rats via inhibiting STAT-3/NF-&#x3ba;B signaling, oxidative stress and inflammation</article-title>. <source>Life Sci.</source> <volume>272</volume>, <fpage>119241</fpage>. <pub-id pub-id-type="doi">10.1016/j.lfs.2021.119241</pub-id>
<pub-id pub-id-type="pmid">33600861</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Imamura</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Isaka</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Sandoval</surname>
<given-names>R. M.</given-names>
</name>
<name>
<surname>Ichimaru</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Abe</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Okumi</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>A nonerythropoietic derivative of erythropoietin inhibits tubulointerstitial fibrosis in remnant kidney</article-title>. <source>Clin. Exp. Nephrol.</source> <volume>16</volume> (<issue>6</issue>), <fpage>852</fpage>&#x2013;<lpage>862</lpage>. <pub-id pub-id-type="doi">10.1007/s10157-012-0647-x</pub-id>
<pub-id pub-id-type="pmid">22678524</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jun</surname>
<given-names>J. H.</given-names>
</name>
<name>
<surname>Jun</surname>
<given-names>N. H.</given-names>
</name>
<name>
<surname>Shim</surname>
<given-names>J. K.</given-names>
</name>
<name>
<surname>Shin</surname>
<given-names>E. J.</given-names>
</name>
<name>
<surname>Kwak</surname>
<given-names>Y. L.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Erythropoietin protects myocardium against ischemia-reperfusion injury under moderate hyperglycemia</article-title>. <source>Eur. J. Pharmacol.</source> <volume>745</volume>, <fpage>1</fpage>&#x2013;<lpage>9</lpage>. <pub-id pub-id-type="doi">10.1016/j.ejphar.2014.09.038</pub-id>
<pub-id pub-id-type="pmid">25446919</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumarswamy</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Volkmann</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Thum</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Regulation and function of miRNA-21 in health and disease</article-title>. <source>RNA Biol.</source> <volume>8</volume> (<issue>5</issue>), <fpage>706</fpage>&#x2013;<lpage>713</lpage>. <pub-id pub-id-type="doi">10.4161/rna.8.5.16154</pub-id>
<pub-id pub-id-type="pmid">21712654</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>S. H.</given-names>
</name>
<name>
<surname>Jhee</surname>
<given-names>J. H.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>T. Y.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>H. Y.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>H. J.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Microparticles derived from human erythropoietin mRNA-transfected mesenchymal stem cells inhibit epithelial-to-mesenchymal transition and ameliorate renal interstitial fibrosis</article-title>. <source>Stem Cell Res. Ther.</source> <volume>11</volume> (<issue>1</issue>), <fpage>422</fpage>. <pub-id pub-id-type="doi">10.1186/s13287-020-01932-z</pub-id>
<pub-id pub-id-type="pmid">32993806</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Ruan</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Xue</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>AdipoRon attenuates hypertension-induced epithelial-mesenchymal transition and renal fibrosis via promoting epithelial autophagy</article-title>. <source>J. Cardiovasc Transl. Res.</source> <pub-id pub-id-type="doi">10.1007/s12265-020-10075-8</pub-id>
<pub-id pub-id-type="pmid">33025271</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Cellular and molecular mechanisms of renal fibrosis</article-title>. <source>Nat. Rev. Nephrol.</source> <volume>7</volume> (<issue>12</issue>), <fpage>684</fpage>&#x2013;<lpage>696</lpage>. <pub-id pub-id-type="doi">10.1038/nrneph.2011.149</pub-id>
<pub-id pub-id-type="pmid">22009250</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Wen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Kang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Regulation of TLR4 expression mediates the attenuating effect of erythropoietin on inflammation and myocardial fibrosis in rat heart</article-title>. <source>Int. J. Mol. Med.</source> <volume>42</volume> (<issue>3</issue>), <fpage>1436</fpage>&#x2013;<lpage>1444</lpage>. <pub-id pub-id-type="doi">10.3892/ijmm.2018.3707</pub-id>
<pub-id pub-id-type="pmid">29845292</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>J. R.</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>G. Y.</given-names>
</name>
<name>
<surname>Ning</surname>
<given-names>Y. C.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J. C.</given-names>
</name>
<name>
<surname>Lv</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>Y. N.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Caloric restriction alleviates aging-related fibrosis of kidney through downregulation of miR-21 in extracellular vesicles</article-title>. <source>Aging (Albany NY)</source> <volume>12</volume> (<issue>18</issue>), <fpage>18052</fpage>&#x2013;<lpage>18072</lpage>. <pub-id pub-id-type="doi">10.18632/aging.103591</pub-id>
<pub-id pub-id-type="pmid">32963130</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>Y. Y.</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>Q. M.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>G. S.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>S. F.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Erythropoietin attenuates cardiac dysfunction by increasing myocardial angiogenesis and inhibiting interstitial fibrosis in diabetic rats</article-title>. <source>Cardiovasc Diabetol.</source> <volume>11</volume>, <fpage>105</fpage>. <pub-id pub-id-type="doi">10.1186/1475-2840-11-105</pub-id>
<pub-id pub-id-type="pmid">22954171</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ma</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Becker Buscaglia</surname>
<given-names>L. E.</given-names>
</name>
<name>
<surname>Barker</surname>
<given-names>J. R.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>MicroRNAs in NF-kappaB signaling</article-title>. <source>J. Mol. Cell Biol.</source> <volume>3</volume> (<issue>3</issue>), <fpage>159</fpage>&#x2013;<lpage>166</lpage>. <pub-id pub-id-type="doi">10.1093/jmcb/mjr007</pub-id>
<pub-id pub-id-type="pmid">21502305</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mo</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wan</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Q.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>miR-21 mediates nickel nanoparticle-induced pulmonary injury and fibrosis</article-title>. <source>Nanotoxicology</source> <volume>14</volume> (<issue>9</issue>), <fpage>1175</fpage>&#x2013;<lpage>1197</lpage>. <pub-id pub-id-type="doi">10.1080/17435390.2020.1808727</pub-id>
<pub-id pub-id-type="pmid">32924694</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>M&#xf6;llmann</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>1992</year>). <article-title>Erythropoietin--physiology and therapeutic potentialities</article-title>. <source>Anasthesiol Intensivmed. Notfallmed Schmerzther</source> <volume>27</volume> (<issue>8</issue>), <fpage>461</fpage>&#x2013;<lpage>468</lpage>. <pub-id pub-id-type="doi">10.1055/s-2007-1000339</pub-id>
<pub-id pub-id-type="pmid">1489869</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morgado-Pascual</surname>
<given-names>J. L.</given-names>
</name>
<name>
<surname>Marchant</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Rodrigues-Diez</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Dolade</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Suarez-Alvarez</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Kerr</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Epigenetic modification mechanisms involved in inflammation and fibrosis in renal pathology</article-title>. <source>Mediat. Inflamm.</source> <volume>2018</volume>, <fpage>2931049</fpage>. <pub-id pub-id-type="doi">10.1155/2018/2931049</pub-id>
<pub-id pub-id-type="pmid">30647531</pub-id>
</mixed-citation>
</ref>
<ref id="B34">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moriyama</surname>
<given-names>M. T.</given-names>
</name>
<name>
<surname>Tanaka</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Morita</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Ishii</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Chikazawa</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Suga</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Renal protective effects of erythropoietin on ischemic reperfusion injury</article-title>. <source>Cell Transpl.</source> <volume>19</volume> (<issue>6</issue>), <fpage>713</fpage>&#x2013;<lpage>721</lpage>. <pub-id pub-id-type="doi">10.3727/096368910x508816</pub-id>
<pub-id pub-id-type="pmid">20525439</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ning</surname>
<given-names>Z. W.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>X. Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>G. Z.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Pan</surname>
<given-names>M. X.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>R. Q.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>MicroRNA-21 mediates Angiotensin II-Induced liver fibrosis by activating NLRP3 Inflammasome/IL-1&#x3b2; axis via targeting Smad7 and Spry1</article-title>. <source>Antioxid. Redox Signal</source> <volume>27</volume> (<issue>1</issue>), <fpage>1</fpage>&#x2013;<lpage>20</lpage>. <pub-id pub-id-type="doi">10.1089/ars.2016.6669</pub-id>
<pub-id pub-id-type="pmid">27502441</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nurrahmah</surname>
<given-names>Q. I.</given-names>
</name>
<name>
<surname>Madhyastha</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Madhyastha</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Purbasari</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Maruyama</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Nakajima</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Retinoic acid abrogates LPS-induced inflammatory response via negative regulation of NF-kappa B/miR-21 signaling</article-title>. <source>Immunopharmacol. Immunotoxicol.</source> <volume>43</volume>, <fpage>1</fpage>&#x2013;<lpage>10</lpage>. <pub-id pub-id-type="doi">10.1080/08923973.2021.1902348</pub-id>
<pub-id pub-id-type="pmid">33757404</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Oh</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Jhee</surname>
<given-names>J. H.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>S. H.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>T. Y.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>H. J.</given-names>
</name>
<name>
<surname>Bae</surname>
<given-names>W.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Erythropoiesis-stimulating agent protects against kidney fibrosis by inhibiting G2/M cell cycle arrest</article-title>. <source>Cells</source> <volume>14</volume> (<issue>21</issue>), <fpage>1662</fpage>. <pub-id pub-id-type="doi">10.3390/cells14211662</pub-id>
<pub-id pub-id-type="pmid">41227308</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Olgun</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>K&#x131;rk&#x131;m</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Kolatan</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>K&#x131;ray</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ba&#x11f;r&#x131;yan&#x131;k</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>&#x15e;erbet&#xe7;io&#x11f;lu</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Otoprotective effect of recombinant erythropoietin in a model of newborn hypoxic-ischemic encephalopathy</article-title>. <source>Int. J. Pediatr. Otorhinolaryngol.</source> <volume>77</volume> (<issue>5</issue>), <fpage>739</fpage>&#x2013;<lpage>746</lpage>. <pub-id pub-id-type="doi">10.1016/j.ijporl.2013.01.029</pub-id>
<pub-id pub-id-type="pmid">23433994</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Park</surname>
<given-names>S. H.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>I. K.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>S. Y.</given-names>
</name>
<name>
<surname>Nam</surname>
<given-names>J. O.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>C. D.</given-names>
</name>
<etal/>
</person-group> (<year>2007</year>). <article-title>Erythropoietin decreases renal fibrosis in mice with ureteral obstruction: role of inhibiting TGF-beta-induced epithelial-to-mesenchymal transition</article-title>. <source>J. Am. Soc. Nephrol.</source> <volume>18</volume> (<issue>5</issue>), <fpage>1497</fpage>&#x2013;<lpage>1507</lpage>. <pub-id pub-id-type="doi">10.1681/asn.2005080866</pub-id>
<pub-id pub-id-type="pmid">17389738</pub-id>
</mixed-citation>
</ref>
<ref id="B40">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Park</surname>
<given-names>S. Y.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>J. Y.</given-names>
</name>
<name>
<surname>Tak</surname>
<given-names>W. Y.</given-names>
</name>
<name>
<surname>Kweon</surname>
<given-names>Y. O.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>M. S.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Erythropoietin decreases carbon tetrachloride-induced hepatic fibrosis by inhibiting transforming growth factor-beta</article-title>. <source>Chin. Med. J. Engl.</source> <volume>125</volume> (<issue>17</issue>), <fpage>3098</fpage>&#x2013;<lpage>3103</lpage>.<pub-id pub-id-type="pmid">22932188</pub-id>
</mixed-citation>
</ref>
<ref id="B41">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Peng</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Gong</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Yin</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>W.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>circRNA_010383 acts as a sponge for miR-135a, and its downregulated expression contributes to renal fibrosis in diabetic nephropathy</article-title>. <source>Diabetes</source> <volume>70</volume> (<issue>2</issue>), <fpage>603</fpage>&#x2013;<lpage>615</lpage>. <pub-id pub-id-type="doi">10.2337/db20-0203</pub-id>
<pub-id pub-id-type="pmid">33203695</pub-id>
</mixed-citation>
</ref>
<ref id="B42">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sarrabayrouse</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Joulain</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Bessoles</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Chiron</surname>
<given-names>A. S.</given-names>
</name>
<name>
<surname>Abina</surname>
<given-names>A. M.</given-names>
</name>
<name>
<surname>Hacein-Bey-Abina</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Erythropoietin supplementation induces dysbiosis of the gut microbiota and impacts mucosal immunity in a non-diseased mouse model</article-title>. <source>Front. Immunol.</source> <volume>15</volume>, <fpage>1465410</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2024.1465410</pub-id>
<pub-id pub-id-type="pmid">39916952</pub-id>
</mixed-citation>
</ref>
<ref id="B43">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Ginsenoside Rb1 alleviates blood-brain barrier damage and demyelination in experimental autoimmune encephalomyelitis mice by regulating JNK/ERK/NF-&#x3ba;B signaling pathway</article-title>. <source>J. Ethnopharmacol.</source> <volume>343</volume>, <fpage>119448</fpage>. <pub-id pub-id-type="doi">10.1016/j.jep.2025.119448</pub-id>
<pub-id pub-id-type="pmid">39914687</pub-id>
</mixed-citation>
</ref>
<ref id="B44">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sugimoto</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Goda</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Non-hematopoietic roles of erythropoietin in inflammation and metabolic disorders</article-title>. <source>Front. Pharmacol.</source> <volume>16</volume>, <fpage>1613849</fpage>. <pub-id pub-id-type="doi">10.3389/fphar.2025.1613849</pub-id>
<pub-id pub-id-type="pmid">40697664</pub-id>
</mixed-citation>
</ref>
<ref id="B45">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname>
<given-names>N. N.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Pan</surname>
<given-names>M. X.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>B. J.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Q. J.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Mir-21 mediates the inhibitory effect of ang (1-7) on AngII-induced NLRP3 inflammasome activation by targeting Spry1 in lung fibroblasts</article-title>. <source>Sci. Rep.</source> <volume>7</volume> (<issue>1</issue>), <fpage>14369</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-017-13305-3</pub-id>
<pub-id pub-id-type="pmid">29084974</pub-id>
</mixed-citation>
</ref>
<ref id="B46">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>van Rijt</surname>
<given-names>W. G.</given-names>
</name>
<name>
<surname>Nieuwenhuijs-Moeke</surname>
<given-names>G. J.</given-names>
</name>
<name>
<surname>van Goor</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Jespersen</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Ottens</surname>
<given-names>P. J.</given-names>
</name>
<name>
<surname>Ploeg</surname>
<given-names>R. J.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>ARA290, a non-erythropoietic EPO derivative, attenuates renal ischemia/reperfusion injury</article-title>. <source>J. Transl. Med.</source> <volume>11</volume>, <fpage>9</fpage>. <pub-id pub-id-type="doi">10.1186/1479-5876-11-9</pub-id>
<pub-id pub-id-type="pmid">23302512</pub-id>
</mixed-citation>
</ref>
<ref id="B47">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Pei</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Zeng</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Lymphatic vessels enhancing adaptive immunity deteriorates renal inflammation and renal fibrosis</article-title>. <source>Kidney Dis. (Basel)</source> <volume>6</volume> (<issue>3</issue>), <fpage>150</fpage>&#x2013;<lpage>156</lpage>. <pub-id pub-id-type="doi">10.1159/000506201</pub-id>
<pub-id pub-id-type="pmid">32523957</pub-id>
</mixed-citation>
</ref>
<ref id="B48">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>L. P.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>X. H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X. J.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Erythropoietin decreases the occurrence of myocardial fibrosis by inhibiting the NADPH-ERK-NF-x03BA;B pathway</article-title>. <source>Cardiology</source> <volume>133</volume> (<issue>2</issue>), <fpage>97</fpage>&#x2013;<lpage>108</lpage>. <pub-id pub-id-type="doi">10.1159/000440995</pub-id>
<pub-id pub-id-type="pmid">26513353</pub-id>
</mixed-citation>
</ref>
<ref id="B49">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>Q. L.</given-names>
</name>
<name>
<surname>Tao</surname>
<given-names>Y. Y.</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>H. D.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2020a</year>). <article-title>Fuzheng Huayu recipe, a traditional Chinese compound herbal medicine, attenuates renal interstitial fibrosis <italic>via</italic> targeting the miR-21/PTEN/AKT axis</article-title>. <source>J. Integr. Med.</source> <volume>18</volume> (<issue>6</issue>), <fpage>505</fpage>&#x2013;<lpage>513</lpage>. <pub-id pub-id-type="doi">10.1016/j.joim.2020.08.006</pub-id>
<pub-id pub-id-type="pmid">32912827</pub-id>
</mixed-citation>
</ref>
<ref id="B50">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2020b</year>). <article-title>Erythropoietin-modified mesenchymal stem cells enhance anti-fibrosis efficacy in mouse liver fibrosis model</article-title>. <source>Tissue Eng. Regen. Med.</source> <volume>17</volume> (<issue>5</issue>), <fpage>683</fpage>&#x2013;<lpage>693</lpage>. <pub-id pub-id-type="doi">10.1007/s13770-020-00276-2</pub-id>
<pub-id pub-id-type="pmid">32621283</pub-id>
</mixed-citation>
</ref>
<ref id="B51">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>White</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>NF-&#x3ba;B and tPA signaling in kidney and other diseases</article-title>. <source>Cells</source> <volume>9</volume> (<issue>6</issue>). <pub-id pub-id-type="doi">10.3390/cells9061348</pub-id>
<pub-id pub-id-type="pmid">32485860</pub-id>
</mixed-citation>
</ref>
<ref id="B52">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>S. H.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>I. C.</given-names>
</name>
<name>
<surname>Tai</surname>
<given-names>M. H.</given-names>
</name>
<name>
<surname>Chai</surname>
<given-names>C. Y.</given-names>
</name>
<name>
<surname>Kwan</surname>
<given-names>A. L.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>S. H.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Erythropoietin alleviates burn-induced muscle wasting</article-title>. <source>Int. J. Med. Sci.</source> <volume>17</volume> (<issue>1</issue>), <fpage>33</fpage>&#x2013;<lpage>44</lpage>. <pub-id pub-id-type="doi">10.7150/ijms.38590</pub-id>
<pub-id pub-id-type="pmid">31929736</pub-id>
</mixed-citation>
</ref>
<ref id="B53">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yuen</surname>
<given-names>C. M.</given-names>
</name>
<name>
<surname>Yeh</surname>
<given-names>K. H.</given-names>
</name>
<name>
<surname>Wallace</surname>
<given-names>C. G.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>K. H.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>H. S.</given-names>
</name>
<name>
<surname>Sung</surname>
<given-names>P. H.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>EPO-cyclosporine combination therapy reduced brain infarct area in rat after acute ischemic stroke: role of innate immune-inflammatory response, micro-RNAs and MAPK family signaling pathway</article-title>. <source>Am. J. Transl. Res.</source> <volume>9</volume> (<issue>4</issue>), <fpage>1651</fpage>&#x2013;<lpage>1666</lpage>.<pub-id pub-id-type="pmid">28469772</pub-id>
</mixed-citation>
</ref>
<ref id="B54">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zarjou</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Abraham</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Agarwal</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Identification of a microRNA signature in renal fibrosis: role of miR-21</article-title>. <source>Am. J. Physiol. Ren. Physiol.</source> <volume>301</volume> (<issue>4</issue>), <fpage>F793</fpage>&#x2013;<lpage>F801</lpage>. <pub-id pub-id-type="doi">10.1152/ajprenal.00273.2011</pub-id>
<pub-id pub-id-type="pmid">21775484</pub-id>
</mixed-citation>
</ref>
<ref id="B55">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zambom</surname>
<given-names>F. F. F.</given-names>
</name>
<name>
<surname>Oliveira</surname>
<given-names>K. C.</given-names>
</name>
<name>
<surname>Foresto-Neto</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Faustino</surname>
<given-names>V. D.</given-names>
</name>
<name>
<surname>&#xc1;vila</surname>
<given-names>V. F.</given-names>
</name>
<name>
<surname>Albino</surname>
<given-names>A. H.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Pathogenic role of innate immunity in a model of chronic NO inhibition associated with salt overload</article-title>. <source>Am. J. Physiol. Ren. Physiol.</source> <volume>317</volume> (<issue>4</issue>), <fpage>F1058</fpage>&#x2013;<lpage>f1067</lpage>. <pub-id pub-id-type="doi">10.1152/ajprenal.00251.2019</pub-id>
<pub-id pub-id-type="pmid">31411073</pub-id>
</mixed-citation>
</ref>
<ref id="B56">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Advances in understanding the effects of erythropoietin on renal fibrosis</article-title>. <source>Front. Med. (Lausanne)</source> <volume>7</volume>, <fpage>47</fpage>. <pub-id pub-id-type="doi">10.3389/fmed.2020.00047</pub-id>
<pub-id pub-id-type="pmid">32154256</pub-id>
</mixed-citation>
</ref>
<ref id="B57">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zheng</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Che</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Combination of matrine and tacrolimus alleviates acute rejection in murine heart transplantation by inhibiting DCs maturation through ROS/ERK/NF-&#x3ba;B pathway</article-title>. <source>Int. Immunopharmacol.</source> <volume>101</volume> (<issue>Pt B</issue>), <fpage>108218</fpage>. <pub-id pub-id-type="doi">10.1016/j.intimp.2021.108218</pub-id>
<pub-id pub-id-type="pmid">34673300</pub-id>
</mixed-citation>
</ref>
<ref id="B58">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhong</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Chung</surname>
<given-names>A. C.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>H. Y.</given-names>
</name>
<name>
<surname>Meng</surname>
<given-names>X. M.</given-names>
</name>
<name>
<surname>Lan</surname>
<given-names>H. Y.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Smad3-mediated upregulation of miR-21 promotes renal fibrosis</article-title>. <source>J. Am. Soc. Nephrol.</source> <volume>22</volume> (<issue>9</issue>), <fpage>1668</fpage>&#x2013;<lpage>1681</lpage>. <pub-id pub-id-type="doi">10.1681/asn.2010111168</pub-id>
<pub-id pub-id-type="pmid">21852586</pub-id>
</mixed-citation>
</ref>
</ref-list>
<fn-group>
<fn fn-type="custom" custom-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1266833/overview">Yuqin Tang</ext-link>, Henan Provincial People&#x2019;s Hospital, China</p>
</fn>
<fn fn-type="custom" custom-type="reviewed-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2150172/overview">Yunkuo Li</ext-link>, First Affiliated Hospital of Jilin University, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/3250186/overview">Qinjin Dai</ext-link>, First Affiliated Hospital of Chongqing Medical University, China</p>
</fn>
</fn-group>
</back>
</article>