<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3-mathml3.dtd">
<article article-type="research-article" dtd-version="1.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Mol. Biosci.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Molecular Biosciences</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Mol. Biosci.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">2296-889X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1760938</article-id>
<article-id pub-id-type="doi">10.3389/fmolb.2026.1760938</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Integrated bioinformatics and mendelian randomization reveal a six-gene diagnostic signature and key role of CYP26B1 in sarcopenia</article-title>
<alt-title alt-title-type="left-running-head">Wu et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fmolb.2026.1760938">10.3389/fmolb.2026.1760938</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Wu</surname>
<given-names>Yaoqi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3208332"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Software" vocab-term-identifier="https://credit.niso.org/contributor-roles/software/">Software</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Cai</surname>
<given-names>Xiaoqing</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3316813"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal Analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Fan</surname>
<given-names>Shiwen</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhao</surname>
<given-names>Lina</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal Analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jiao</surname>
<given-names>Yingying</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3017514"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Tongkai</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/903861"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Manting</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2944762"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Song</surname>
<given-names>Yafang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/917275"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
<institution>Science and Technology Innovation Center, Guangzhou University of Chinese Medicine</institution>, <city>Guangzhou</city>, <state>Guangdong</state>, <country country="CN">China</country>
</aff>
<aff id="aff2">
<label>2</label>
<institution>Department of Gastrosplenic Diseases, The First Affiliated Hospital of Guangzhou University of Chinese Medicine</institution>, <city>Guangzhou</city>, <state>Guangdong</state>, <country country="CN">China</country>
</aff>
<author-notes>
<corresp id="c001">
<label>&#x2a;</label>Correspondence: Yafang Song, <email xlink:href="mailto:stephanie237@163.com">stephanie237@163.com</email>
</corresp>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2026-02-26">
<day>26</day>
<month>02</month>
<year>2026</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2026</year>
</pub-date>
<volume>13</volume>
<elocation-id>1760938</elocation-id>
<history>
<date date-type="received">
<day>04</day>
<month>12</month>
<year>2025</year>
</date>
<date date-type="rev-recd">
<day>21</day>
<month>01</month>
<year>2026</year>
</date>
<date date-type="accepted">
<day>09</day>
<month>02</month>
<year>2026</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2026 Wu, Cai, Fan, Zhao, Jiao, Chen, Liu and Song.</copyright-statement>
<copyright-year>2026</copyright-year>
<copyright-holder>Wu, Cai, Fan, Zhao, Jiao, Chen, Liu and Song</copyright-holder>
<license>
<ali:license_ref start_date="2026-02-26">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>The pathogenesis of sarcopenia involves complex molecular mechanisms, and treatment remains challenging, with a lack of reliable diagnostic biomarkers. The objective of this study is to identify biomarkers that may be linked to sarcopenia, examine how these biomarkers correlate with immune cell infiltration, and investigate the genes that exhibit a causal relationship with sarcopenia.</p>
</sec>
<sec>
<title>Methods</title>
<p>Four transcriptomic datasets were integrated to identify candidate biomarkers. Genes from the MEBrown module of weighted gene co-expression network analysis (WGCNA) analysis were cross-referenced with differentially expressed genes (DEGs). A diagnostic model was built using 113 machine learning algorithms, followed by protein-protein interaction (PPI) network analysis and SHapley Additive exPlanations (SHAP) evaluation. Immune cell quantification and correlation with sarcopenia-related genes were performed using CIBERSORT, while gene expression data was integrated with genome-wide association statistics (GWAS) and gene expression quantitative trait loci (eQTL) data. <italic>In vitro</italic> validation was carried out using C2C12 cells and quantitative polymerase chain reaction (qPCR) experiments.</p>
</sec>
<sec>
<title>Results</title>
<p>We found 318 DEGs. By comparing the WGCNA gene with these DEGs, we found 109 possible biomarkers, which are related to immune regulation, muscle cytoskeleton regulation and retinol metabolism. A six-gene diagnostic signature (FOXO1, ZBTB16, HOXB2, LYVE1, MGP, and CYP26B1) was developed using machine learning and PPI network analysis, achieving high predictive accuracy (AUC &#x3e;0.80), with HOXB2 identified as the top predictor via SHAP analysis. CIBERSORT analysis showed the relationship between these genes and immune cell subsets, while Mendelian randomization (MR) analysis confirmed the causal relationship between the expression of CYP26B1 gene and the risk of sarcopenia. The result of qPCR analysis is the same as the mRNA expression found in Gene Expression Omnibus (GEO) data set.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>This study identified a highly reliable six-gene diagnostic signature for sarcopenia. Mendelian randomization established CYP26B1 as the sole causal factor, linking retinoic acid metabolism to disease etiology. This dual evidence provides a robust six-gene diagnostic model and a prioritized therapeutic target, elucidating immune-metabolic mechanisms of sarcopenia. These findings offer new avenues for early diagnosis and metabolism-based precision therapy.</p>
</sec>
</abstract>
<kwd-group>
<kwd>bioinformatics</kwd>
<kwd>diagnostic biomarker</kwd>
<kwd>machine learning</kwd>
<kwd>mendelian randomization</kwd>
<kwd>sarcopenia</kwd>
</kwd-group>
<funding-group>
<funding-statement>The author(s) declared that financial support was received for this work and/or its publication. The present study was supported by the National Natural Science Foundation of China (82374391), the Project in Key Fields of Universities in Guangdong Province (2021ZDZX2032), the Natural Science Foundation of Guangdong Province (2023A1515011127) and Guangdong Traditional Medicine Association Youth Development Fund Project (GDTMAZX-202509003).</funding-statement>
</funding-group>
<counts>
<fig-count count="10"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="98"/>
<page-count count="00"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Molecular Diagnostics and Therapeutics</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="s1">
<label>1</label>
<title>Introduction</title>
<p>Sarcopenia is an age-related systemic muscle disease characterized by pathological declines in muscle mass, muscle strength, and gait speed (<xref ref-type="bibr" rid="B18">Cruz-Jentoft and Sayer, 2019</xref>; <xref ref-type="bibr" rid="B66">Sayer et al., 2024</xref>). It is highly prevalent among older adults and significantly increases the risk of falls, disability, and mortality, thereby severely impairing quality of life (<xref ref-type="bibr" rid="B78">Wakabayashi and Sakuma, 2014</xref>). Epidemiological research indicates that around 10%&#x2013;16% of the global elderly population is affected by sarcopenia (<xref ref-type="bibr" rid="B91">Yuan and Larsson, 2023</xref>; <xref ref-type="bibr" rid="B38">Kalra et al., 2025</xref>).</p>
<p>The pathogenesis of sarcopenia is complex and involves multiple molecular and cellular mechanisms, including alterations in muscle fiber composition, hormonal dysregulation, impaired satellite cell function, neuromuscular junction dysfunction, protein homeostasis imbalance, chronic inflammation, and mitochondrial dysfunction (<xref ref-type="bibr" rid="B82">Wiedmer et al., 2021</xref>). However, these mechanisms are still not fully understood (<xref ref-type="bibr" rid="B5">Cannataro et al., 2021</xref>). Pathologically, sarcopenia is characterized by a reduction in both the number and size of muscle fibers, particularly type II fibers, accompanied by fat infiltration into skeletal muscle tissue (<xref ref-type="bibr" rid="B18">Cruz-Jentoft and Sayer, 2019</xref>).</p>
<p>Currently, nutritional supplementation and resistance exercise are the main therapeutic strategies for sarcopenia, and no pharmacological treatment has yet been approved (<xref ref-type="bibr" rid="B64">Sakuma et al., 2023</xref>; <xref ref-type="bibr" rid="B16">Chung et al., 2025</xref>). Nevertheless, these methods often face issues of slow therapeutic response and poor patient compliance, highlighting the urgent need for precise new strategies targeting the pathological mechanisms (<xref ref-type="bibr" rid="B15">Cho et al., 2022</xref>). In clinical practice, muscle mass is commonly evaluated using bioelectrical impedance analysis (BIA) and dual-energy X-ray absorptiometry (DXA). Nevertheless, the high cost of equipment, technical requirements, and susceptibility to physiological factors such as hydration status limit their widespread application (<xref ref-type="bibr" rid="B58">Papadopoulou, 2020</xref>; <xref ref-type="bibr" rid="B15">Cho et al., 2022</xref>). Early diagnosis is therefore critical, as timely intervention may delay or prevent disease progression (<xref ref-type="bibr" rid="B11">Cheng J. P. et al., 2025</xref>). These limitations underscore the importance of identifying reliable molecular biomarkers for sarcopenia.</p>
<p>We found transcriptome data related to muscle tissue from Gene Expression Omnibus (GEO) database, which included samples provided by people diagnosed as sarcopenia and healthy people.There are four expression profiles: GSE1428, GSE8479, GSE136344 and GSE111016. We mainly analyzed GSE1428 and GSE8479, and the test data sets were GSE136344 and GSE111016. Differentially expressed genes between sarcopenia and control samples were first identified. Weighted gene co-expression network analysis (WGCNA) was then applied to construct co-expression modules and screen key functional gene clusters. Overlapping genes between the significant modules and differentially expressed genes were regarded as candidate biomarkers and further subjected to Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses.To identify hub diagnostic genes, we integrated machine learning algorithms with protein&#x2013;protein interaction (PPI) network analysis and constructed a robust diagnostic model, which was interpreted using SHapley Additive exPlanations (SHAP). The association between hub genes and immune cell infiltration was investigated using CIBERSORT. Furthermore, Mendelian randomization (MR) analysis based on genome-wide association studies (GWAS) and expression quantitative trait loci (eQTL) data was performed to explore potential causal relationships between key genes and sarcopenia. Finally, <italic>in vitro</italic> experiments were conducted to validate the bioinformatics findings.</p>
</sec>
<sec sec-type="methods" id="s2">
<label>2</label>
<title>Methods</title>
<sec id="s2-1">
<label>2.1</label>
<title>Research design</title>
<p>In this study, we used GEO database (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/geo/">https://www.ncbi.nlm.nih.gov/geo/</ext-link>) to find the genes related to sarcopenia by differentially expressed genes (DEGs) and WGCNA analysis. Then we further screened out the core genes by machine learning and PPI network analysis. SHAP algorithm helps us to explain the diagnostic model of sarcopenia. At the same time, we also combine the GWAS data about sarcopenia with the eQTL data of specific genes to find out the possible causal relationship between key genes and sarcopenia. We also established a model of sarcopenia with C2C12 cells, so that we can verify the key genes through quantitative polymerase chain reaction (qPCR) experiments <italic>in vitro</italic>.The overall study design and analytical workflow are summarized in <xref ref-type="fig" rid="F1">Figure 1</xref>, which was constructed as a graphical abstract to visually illustrate the integrated research framework, following the principles of effective graphical abstract design (<xref ref-type="bibr" rid="B39">Kamble et al., 2025</xref>).</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Graphical abstract illustrating the overall workflow for identifying and causally validating diagnostic biomarkers of sarcopenia based on transcriptomic integration, machine learning, and Mendelian randomization.</p>
</caption>
<graphic xlink:href="fmolb-13-1760938-g001.tif">
<alt-text content-type="machine-generated">Infographic illustrating a research pipeline for gene analysis in sarcopenia using data acquisition, differential expression analysis, WGCNA, intersection and enrichment analysis, machine learning screening, core gene network, SHAP and CIBERSORT analytics, Mendelian randomization validation, and experimental verification with bar graphs of gene expression changes between control and model groups.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s2-2">
<label>2.2</label>
<title>Data collection and analysis</title>
<p>We got the data set about sarcopenia from GEO database. There are four data sets that can be used publicly: GSE1428 (<xref ref-type="bibr" rid="B28">Giresi et al., 2005</xref>), GSE8479 (<xref ref-type="bibr" rid="B53">Melov et al., 2007</xref>), GSE136344 (<xref ref-type="bibr" rid="B32">Gueugneau et al., 2021</xref>) and GSE111016 (<xref ref-type="bibr" rid="B54">Migliavacca et al., 2019</xref>). In this study, we selected GSE1428 and GSE8479 as training data sets, which included 37 sarcopenia samples (12 from GSE1428 and 25 from GSE8479) and 36 control muscle samples (10 from GSE1428 and 26 from GSE8479). In order to deal with the batch effect and ensure the consistency of data, we first use the &#x201c;SVA&#x201d; toolkit of R language to correct the batch effect. After that, we combined the arrays of each group and used principal component analysis (PCA) to reduce the dimension and the possible batch effect. Then, we use R&#x2019;s &#x201c;Limma&#x201d; toolkit to analyze the differential expression of the integrated data set to find those DEGs that meet the conditions of &#x7c;logFC&#x7c; &#x3e; 0.5 and <italic>P.adjust</italic> &#x3c;0.05. Finally, we use the &#x201c;Pheatmap&#x201d; toolkit to draw these DEGs in the form of heat maps. Because all the data sets we use are public, this study does not need to be approved by the ethics Committee.</p>
</sec>
<sec id="s2-3">
<label>2.3</label>
<title>Weighted gene Co-expression network analysis of DEGs</title>
<p>WGCNA constructed a scale-free network by linking the gene expression level with clinical features (<xref ref-type="bibr" rid="B46">Langfelder and Horvath, 2008</xref>). In this study, we used the &#x201c;WGCNA&#x201d; of R package to find the gene module which is particularly closely related to sarcopenia. First of all, we choose the most suitable soft threshold to build a network structure that conforms to the scale-free distribution. Then, we build a weighted adjacency matrix, and then turn it into a topological overlap matrix (TOM). After that, we calculated the difference between genes according to TOM, and grouped the genes by dynamic tree cutting algorithm, so that we could find out all kinds of co-expression modules. Finally, we chose the gene module which is most related to the phenotype of sarcopenia for further analysis.</p>
</sec>
<sec id="s2-4">
<label>2.4</label>
<title>GO and KEGG enrichment analysis of key genes</title>
<p>GO enrichment analysis is a commonly used bioinformatics method, which divides the functional description of genes into three different types: molecular function, biological process and cellular component (<xref ref-type="bibr" rid="B2">Aleksander et al., 2023</xref>). Similarly, KEGG pathway enrichment analysis is often used to study the biological mechanism and function of genes (<xref ref-type="bibr" rid="B41">Kanehisa and Goto, 2000</xref>). These descriptions cover many fields, such as human diseases, biological processes, and signal pathways, which can help us find out the possible connections between genes related to sarcopenia and let us better understand how they lead to the development of this disease. Based on this, we conducted a comprehensive GO functional analysis and KEGG pathway enrichment analysis on the common genes, using the two toolkits of &#x201c;clusterProfiler&#x201d; and &#x201c;DOSE&#x201d; in R language. We set an important standard for these analyses, that is, the p value should be less than 0.05 to be meaningful. Finally, we use the &#x201c;GOplot&#x201d; toolkit to draw a circular diagram to show these results.</p>
</sec>
<sec id="s2-5">
<label>2.5</label>
<title>Constructing the optimal model using integrated machine learning algorithms</title>
<p>In the R language environment, we use 12 different algorithms for variable selection and model building, including ElasticNet, Stepglm, Lasso, Generalized Linear Model Boosting (glmBoost), Ridge, Elastic Net (Enet), Support Vector Machine (SVM), Partial Least Squares Regression for Generalized Linear Models (plsRglm), Linear Discriminant Analysis (LDA), Random Forest (RF), NaiveBayes and eXtreme Gradient Boosting (XGBoost) (<xref ref-type="bibr" rid="B49">Liang et al., 2025</xref>). This method combines linear regression model with advanced nonlinear learning method, which can give us a lot of analytical inspiration. The whole calculation framework adopts double algorithm strategy: (1) Firstly, the prediction factors are selected by feature sorting through recursive feature elimination, and then the prediction model is established by stacking generalization technology. (2) This method runs under the framework of hierarchical 10-fold cross-validation, and 113 different configurations are generated by system optimization superparameter (<xref ref-type="bibr" rid="B48">Li T. et al., 2025</xref>). Then, we calculated the consistency index (C-Index) of all combinations with the external verification set, and visualized the results through the heat map for evaluation (<xref ref-type="bibr" rid="B96">Zhang W. et al., 2025</xref>). Based on GSE1428 and GSE8479 data sets, we use the combination of 113 algorithms mentioned above to build a diagnosis model. In addition, the model is externally verified on two different data sets, GSE136344 and GSE111016.Finally, the model achieving the highest average area under the curve (AUC) across both the training and test sets was selected as the optimal model for this study.</p>
</sec>
<sec id="s2-6">
<label>2.6</label>
<title>Construction of protein-protein interaction network</title>
<p>A PPI network was established utilizing information obtained from the STRING database to depict the interconnections among various proteins (<xref ref-type="bibr" rid="B72">Szklarczyk et al., 2019</xref>). This network specifically highlights the overlap between DEGs and the genes identified through the WGCNA analysis. Using the Cytoscape softwareplugin &#x201c;Cytohubba&#x201d; (<xref ref-type="bibr" rid="B14">Chin et al., 2014</xref>) the top 15 genes were selected based on their scores in various network centrality measures, including MCC, EPC, Degree, MNC, EcCentricity, DMNC, Radiality, Bottle Neck, Closeness, Betweenness, Clustering Coefficient, and Stress.The core genes of Cytohubba were then identified from these genes.</p>
</sec>
<sec id="s2-7">
<label>2.7</label>
<title>Diagnostic ability and expression levels of core genes</title>
<p>In order to assess the diagnostic potential and expression levels of critical genes associated with sarcopenia, we employed the R package &#x201c;pROC&#x201d; to generate receiver operating characteristic (ROC) curves. This method helps us to calculate the AUC, and we use this AUC to evaluate the classification ability of each gene in distinguishing the people with sarcopenia from the control group. In the training and verification data set, as long as the AUC value of genes exceeds 0.7, we think that they have a good diagnostic effect, indicating that they may become biomarkers of sarcopenia. In addition, the R package &#x201c;PerformanceAnalytics&#x201d; was applied to analyze and visualize the correlations among the key genes in the validation dataset.</p>
</sec>
<sec id="s2-8">
<label>2.8</label>
<title>Model interpretation</title>
<p>To improve the transparency and interpretability of the model, the SHAP algorithm was applied to explain the sarcopenia diagnostic model. This method will score each feature and calculate the SHAP value of each feature, so that we can understand how each feature affects the prediction results of the model (<xref ref-type="bibr" rid="B94">Zhang M. et al., 2025</xref>).</p>
</sec>
<sec id="s2-9">
<label>2.9</label>
<title>CIBERSORT analysis of immune cell subtypes related to sarcopenia</title>
<p>The &#x201c;CIBERSORT&#x201d; package was employed to evaluate the degree of immune cell infiltration within the gene expression dataset associated with sarcopenia.In order to show the number and distribution of immune cells in different samples, we draw a histogram with the tool of &#x201c;ggplot2&#x201d;. Then, we use the R toolkit ggpubr to compare the proportion of 22 different immune cells in sarcopenia samples and normal control samples, and use Wilcoxon test for statistical analysis. The analysis results are displayed by the stack histogram made by ggplot2. In addition, we also use the &#x201c;corrplot&#x201d; toolkit to draw the correlation between 22 kinds of immune cells. When the p value is less than 0.05, we think that the correlation is significant.</p>
</sec>
<sec id="s2-10">
<label>2.10</label>
<title>MR analysis for key gene prioritization</title>
<p>MR is conducted to verify whether the direction of effects observed in the differential gene expression model aligns with the results from the MR approach.The exposure data and gene eQTL data we used were all obtained from GWAS summary data. As for the results related to sarcopenia-such as lean body weight of limbs, grip strength of hands, and walking speed-they are all from UK Biobank, and only use the information of European participants (<xref ref-type="sec" rid="s13">Supplementary Table S1</xref>). In MR analysis, we regard the gene expression level related to sarcopenia as the exposure factor, while the gene variation, especially single nucleotide polymorphisms (SNPs) in eQTL data set, is used as a tool variable to study their possible causal relationship with the risk of sarcopenia. In order to ensure the reliability of the tool, we only consider those genes with at least three effective SNPs. We will evaluate the strength of these tool variables by calculating the F statistics of each SNP set. If the F statistic is greater than 10, it means that it is a strong tool variable, which can help reduce the possible bias in MR analysis.</p>
<p>When we do MR analysis, we mainly use the method of Inverse Variance Weighted (IVW). At the same time, we also use other methods to help, such as MR-Egger, weighted median, simple mode and weighted mode. In order to ensure the reliability of the results, we will carry out pleiotropic test, heterogeneity evaluation and sensitivity analysis. The method of sensitivity analysis is to remove one data at a time and then see if the results will change. The screening criteria we set are: the P value of IVW should be less than 0.05, the odds ratios (OR) obtained by different MR methods should be consistent, and the P value of pleiotropic test should be greater than 0.05. In order to improve the accuracy and reliability of MR analysis, we will use MR-PRESSO to find out the biased SNPs and then remove them. We evaluate the heterogeneity by IVW and MR-Egger test. If the p value is greater than 0.05, it means that there is no obvious heterogeneity in the data. In addition, we use MR-Egger intercept test to check pleiotropy. If the p value is greater than 0.05, it means that there is no pleiotropic effect. For those genes that meet all these criteria, we will use various graphs for further analysis and display, such as forest plots, scatter plots, funnel plots and leave-one-out analysis, so that we can see the causal relationship more clearly.</p>
</sec>
<sec id="s2-11">
<label>2.11</label>
<title>Quantitative PCR verification</title>
<p>Mouse C2C12 myoblasts were originally obtained from the Cell Bank of Chinese Academy of Sciences (CBCC) and procured for this study from Jinyuan Biotechnology (Shanghai, China).Cells were divided into Control and Model groups. To establish an <italic>in vitro</italic> sarcopenia model, cells in the Model group were treated with 100 &#x3bc;M hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) for 24 h, while the Control group was cultured under identical conditions without H<sub>2</sub>O<sub>2</sub> (<xref ref-type="bibr" rid="B26">Feng et al., 2022</xref>; <xref ref-type="bibr" rid="B86">Wu X. et al., 2025</xref>). After treatment, total RNA was extracted from the C2C12 cells using the standard TRIzol method. The purity and concentration of extracted RNA were measured by NanoDrop spectrophotometer. According to the method of reverse transcription kit, we reverse transcription a microgram of RNA and made a cDNA.qPCR was performed on an ABI 7500 Real-Time PCR System using SYBR Green Master Mix. The expression levels of the target genes were normalized to &#x3b2;-Actin as the internal reference gene. The primer sequences used in this study are listed in <xref ref-type="table" rid="T1">Table 1</xref>.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Primer sequences used for real-time qPCR.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Gene</th>
<th align="left">Species</th>
<th align="left">Orientation</th>
<th align="left">Primer sequences (5&#x2032;&#x2013;3&#x2032;)</th>
<th align="left">Product size (bp)</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">
<italic>Cyp26b1</italic>
</td>
<td align="left">
<italic>Mus muslcuhs</italic>
</td>
<td align="left">Forward<break/>Reverse</td>
<td align="left">GGTTTCCAGATCCCCAAGGG<break/>GCCAAACGGGAGGTAATGGA</td>
<td align="left">159</td>
</tr>
<tr>
<td align="left">
<italic>Hoxb2</italic>
</td>
<td align="left">
<italic>Mus muslcuhs</italic>
</td>
<td align="left">Forward<break/>Reverse</td>
<td align="left">CGAGGTCGGATCACCATCAG<break/>TTCTCCAGCTCCAGCAGTTG</td>
<td align="left">108</td>
</tr>
<tr>
<td align="left">
<italic>Lyve1</italic>
</td>
<td align="left">
<italic>Mus muslcuhs</italic>
</td>
<td align="left">Forward<break/>Reverse</td>
<td align="left">GACACTCAAACACCCGCAAC<break/>TGGTGGCAGAAACAGGTGTT</td>
<td align="left">91</td>
</tr>
<tr>
<td align="left">
<italic>Foxo1</italic>
</td>
<td align="left">
<italic>Mus muscuhs</italic>
</td>
<td align="left">Forward<break/>Reverse</td>
<td align="left">TCGCCACAATCTGTCCCTTC<break/>TTCTCCGGGGTGATTTTCCG</td>
<td align="left">119</td>
</tr>
<tr>
<td align="left">
<italic>Zbtb16</italic>
</td>
<td align="left">
<italic>Mus muslcuhs</italic>
</td>
<td align="left">Forward<break/>Reverse</td>
<td align="left">CAGAGGGAGCTGTTCAGCAA<break/>CACTGTGCAGTTTCCTGTGC</td>
<td align="left">142</td>
</tr>
<tr>
<td align="left">
<italic>Mgp</italic>
</td>
<td align="left">
<italic>Mus muslcuhs</italic>
</td>
<td align="left">Forward<break/>Reverse</td>
<td align="left">GAGAGTCCAGGAACGCAACA<break/>GCGTTGTAGCCGTAGACCAT</td>
<td align="left">102</td>
</tr>
<tr>
<td align="left">
<italic>&#x3b2;-actin</italic>
</td>
<td align="left">
<italic>Mus muslcuhs</italic>
</td>
<td align="left">Forward<break/>Reverse</td>
<td align="left">GATGGTGGGAATGGGTCAGAAGG<break/>TTGTAGAAGGTGTGGTGCCAGATC</td>
<td align="left">147</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-12">
<label>2.12</label>
<title>Statistical analysis</title>
<p>We use R software (version 4.5.1) and GraphPad Prism for statistics. Continuous variables are presented as mean &#xb1; standard deviation, while categorical variables are reported as frequencies and percentages. Using the method of T-test, we compared the mRNA expression levels between different groups.To evaluate the diagnostic accuracy of the candidate mRNA, a ROC curve was plotted, and the AUC was determined through the application of a logistic regression model. Additionally, sensitivity and specificity at the optimal cutoff value were determined. The ROC curve was constructed by plotting sensitivity against (100-specificity), with the results expressed as the AUC and its 95% confidence interval. All statistical evaluations were performed utilizing the R programming language.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<label>3</label>
<title>Results</title>
<sec id="s3-1">
<label>3.1</label>
<title>DEGs were identified</title>
<p>The GSE1428 and GSE8479 microarray datasets were subjected to normalization and batch correction, and subsequently merged to form a larger cohort for both training and internal validation purposes. After the normalization and batch correction processes, PCA was performed, demonstrating successful integration of the samples from both datasets, which confirmed effective harmonization across platforms (<xref ref-type="fig" rid="F2">Figures 2A,B</xref>). Using the limma package with criteria of FDR &#x3c;0.05 and &#x7c;Log2 FC&#x7c; &#x3e; 0.5, we identified a total of 318 DEGs (<xref ref-type="sec" rid="s13">Supplementary Table S2</xref>) when comparing the sarcopenia patient cohort to the healthy control group (<xref ref-type="fig" rid="F2">Figures 2C,D</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>DEG between healthy controls and sarcopenia. <bold>(A)</bold> The application of PCA on the two datasets was performed without any prior normalization; <bold>(B)</bold> Subsequently, PCA was conducted on the first and second principal components (PC1 and PC2) after normalizing the data derived from the two datasets; <bold>(C)</bold> A volcano plot illustrating the DEGs between the control and sarcopenia groups; <bold>(D)</bold> A heatmap displaying the top 40 DEGs identified between the control and sarcopenia groups. DEGs, differentially expressed genes; PCA, principal component analysis; PC1, principal component 1; PC2, principal component 2.</p>
</caption>
<graphic xlink:href="fmolb-13-1760938-g002.tif">
<alt-text content-type="machine-generated">Panel A shows a principal component analysis (PCA) plot before batch correction with two sample groups, GSE1428 and GSE8479, clustering separately. Panel B displays the PCA plot after batch correction where both groups show improved overlap. Panel C is a volcano plot with genes colored by significance: red for upregulated, green for downregulated, and gray for not significant based on -log10 adjusted P value and log fold change. Panel D is a heatmap of gene expression showing hierarchical clustering of samples on both axes, with annotations for project type and treatment group.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-2">
<label>3.2</label>
<title>Assessment of key modules in the weighted gene co-expression network</title>
<p>In order to systematically identify key genes associated with the sarcopenia phenotype,we undertook an assessment of the weighted gene co-expression network. As illustrated in <xref ref-type="fig" rid="F3">Figure 3</xref>, the MEbrown module exhibited the most pronounced negative correlation with sarcopenia within the studied cohort (correlation &#x3d; &#x2212;0.32, <italic>P</italic> &#x3d; 0.006, refer to <xref ref-type="fig" rid="F3">Figures 3A,B</xref>). Additionally, we observed a statistically significant variation in the distribution of gene significance (GS) across various modules (<italic>P</italic> &#x3d; 0.05). Subsequently, we conducted an intra-module analysis, which uncovered a significant positive correlation between module membership (MM) and GS specifically in the MEbrown module (correlation &#x3d; 0.52, <italic>P</italic> &#x3d; 3.7e&#x2212;27) (<xref ref-type="fig" rid="F3">Figure 3C</xref>). Finally, we intersected the 372 genes in the MEbrown module with the previously identified DEGs, resulting in the selection of 109 candidate genes for further machine learning analysis (<xref ref-type="fig" rid="F3">Figure 3D</xref>).</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>WGCNA screens immune-related genes. <bold>(A)</bold> Thresholds for WGCNA analysis. <bold>(B)</bold> Module-feature relationships. Each cell contains the corresponding correlation and p-value. <bold>(C)</bold> Scatter plot illustrating the correlation between module membership (MM) and gene significance (GS) within the brown module. <bold>(D)</bold> Venn diagram representing the overlap between DEGs and genes within the brown module.</p>
</caption>
<graphic xlink:href="fmolb-13-1760938-g003.tif">
<alt-text content-type="machine-generated">Panel A shows a hierarchical gene dendrogram with colored bands representing different gene modules; panel B presents a heatmap matrix of module-trait relationships with correlation values for control and treated groups; panel C displays a scatter plot correlating module membership with gene significance for the brown module; panel D depicts a Venn diagram comparing gene overlaps between WGCNA-identified modules and differentially expressed genes, with numerical values for each segment.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-3">
<label>3.3</label>
<title>Functional enrichment analysis</title>
<p>GO and KEGG enrichment analyses were performed on the genes identified as common across the datasets. The GO enrichment results showed that these genes were mainly involved in gland morphogenesis, retinoic acid metabolic process, complement activation, and humoral immune response in the Biological Process (BP) category, suggesting their potential roles in tissue development, immune regulation, and retinoid metabolism (<xref ref-type="fig" rid="F4">Figure 4A</xref>). In the Cellular Component (CC) category, the significantly enriched terms included collagen-containing extracellular matrix, contractile muscle fiber, actin filament bundle, and myosin filament, indicating that DEGs are closely associated with cytoskeletal organization and extracellular matrix remodeling. In the Molecular Function (MF) category, extracellular matrix structural constituent, actin binding, oxidoreductase activity, and NAD/NAD<sup>&#x2b;</sup> binding were prominently enriched, implying the involvement of these genes in structural maintenance, cytoskeletal dynamics, and redox-related metabolic processes. Furthermore, KEGG pathway analysis demonstrated that DEGs were significantly enriched in pathways such as cytoskeleton in muscle cells, transcriptional misregulation in cancer, complement and coagulation cascades, phagosome, and retinol metabolism (<xref ref-type="fig" rid="F4">Figure 4B</xref>). These pathways suggest that the dysregulated genes may participate in cytoskeletal reorganization, immune and inflammatory responses, metabolic reprogramming, collectively highlighting the potential roles of DEGs in extracellular matrix remodeling, immune modulation, and metabolic alterations underlying the studied condition.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>Functional enrichment analysis of intersecting genes in GO and KEGG. <bold>(A)</bold> Pie chart of GO enrichment functions; <bold>(B)</bold> Bubble chart of KEGG signaling pathways. GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; DEGs, differentially expressed genes.</p>
</caption>
<graphic xlink:href="fmolb-13-1760938-g004.tif">
<alt-text content-type="machine-generated">Panel A displays a dot plot for Gene Ontology enrichment analysis grouped by Biological Process, Cellular Component, and Molecular Function, using dot color to show adjusted p-values and circle size for gene count. Panel B shows a dot plot for KEGG pathway enrichment, with similar color and size encoding for p-values and gene counts, listing pathways such as cytoskeleton in muscle cells and retinol metabolism. Both panels use horizontal axis for gene ratio and vertical labels for enriched categories.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-4">
<label>3.4</label>
<title>Constructing a sarcopenia diagnostic model through machine learning</title>
<p>For the 109 potential key genes identified earlier, leading to the generation of 113 distinct combinations utilizing 12 varied machine learning algorithms aimed at determining the most dependable diagnostic model. To ensure the robustness of our findings, we extended this comprehensive analysis beyond the initial training model to include two independent external validation datasets (<xref ref-type="fig" rid="F5">Figure 5A</xref>). We assessed the utility of each feature selection technique by strictly monitoring the classification accuracy of the resulting models on the validation set. For the internal training dataset, we applied a 10-fold cross-validation strategy across every algorithmic combination to compute the associated AUC values. As detailed in the rankings presented in <xref ref-type="fig" rid="F5">Figure 5A</xref>, the pairing of RF with Ridge regression emerged as the clear standout. This combination demonstrated superior predictive capability across both the internal and external cohorts, achieving AUC values of 1.000 (95% CI: 1.000&#x2013;1.000), 0.852 (95% CI: 0.720&#x2013;0.953), and 1.000 (95% CI: 1.000&#x2013;1.000), respectively (<xref ref-type="fig" rid="F5">Figure 5B</xref>). The confusion matrix shown in <xref ref-type="fig" rid="F5">Figure 5C</xref> further indicates that the model achieved an impressive overall accuracy of 98.6% on the training set, calculated as (35 &#x2b; 37)/(35 &#x2b; 0&#x2b;1 &#x2b; 37). The model exhibited strong classification performance across all datasets, demonstrating high predictive accuracy (<xref ref-type="fig" rid="F5">Figure 5C</xref>). The RF &#x2b; Ridge algorithm identified 25 hub genes (HOXB2, SLPI, TPPP3, PLAG1, COL4A5, PPIF, KLF13, LYVE1, FOXO1, ST8SIA5, TMEM158, KAZALD1, ZBTB16, FST, ASXL1, SIRT4, ACTC1, TAF5, SLC7A6, CYP26B1, CCDC69, GADD45G, C1S, ATP1B4, MGP).</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>Development and assessment of the feature gene model utilizing machine learning techniques. <bold>(A)</bold> The heatmap illustrates the predictive performance, represented by the AUC, of 113 machine learning combinations evaluated on the training dataset (Train) as well as two validation datasets (GSE111016, GSE136344). <bold>(B)</bold> The ROC curves for the chosen model are depicted for both the training dataset and the validation datasets, demonstrating its ability to classify effectively. <bold>(C)</bold> Confusion matrix visualizations for the training and validation datasets are presented.</p>
</caption>
<graphic xlink:href="fmolb-13-1760938-g005.tif">
<alt-text content-type="machine-generated">Panel A shows a colored heatmap ranking predictive models by AUC values across train, GSE111016, and GSE136344 cohorts; panel B presents associated ROC curves; panel C displays corresponding confusion matrices.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-5">
<label>3.5</label>
<title>PPI network of hub genes</title>
<p>
<xref ref-type="fig" rid="F6">Figure 6A</xref> illustrates the distinct expression profiles of 25 key genes in individuals with sarcopenia compared to control participants, as represented in a volcano plot.We used the Cytoscape plugin cytoHubba to perform centrality analysis on the PPI network composed of 25 hub genes (<xref ref-type="fig" rid="F6">Figure 6B</xref>). The intersection of all twelve ranking algorithms integrated by Cytohubba revealed that FOXO1, ZBTB16, HOXB2, LYVE1, MGP, and CYP26B1 were identified as key genes for further analysis (<xref ref-type="fig" rid="F6">Figure 6C</xref>).</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>Identification of key genes. <bold>(A)</bold> The volcano plot depicts the expression levels of 25 key genes in sarcopenia patients in comparison to the control group. <bold>(B)</bold> The PPI network comprises these 25 central genes. <bold>(C)</bold> Upset plot of 12 topological algorithms determined by protein interaction network analysis.</p>
</caption>
<graphic xlink:href="fmolb-13-1760938-g006.tif">
<alt-text content-type="machine-generated">Panel A shows a volcano plot with log fold change on the x-axis and negative log adjusted p-value on the y-axis, highlighting upregulated (red) and downregulated (green) genes. Panel B displays a network diagram of gene interactions with upregulated genes in orange and downregulated genes in green, connected by lines indicating relationships. Panel C presents a bar chart for gene set intersections among different analytical methods, with the set size shown on the left and vertical bars representing gene intersection counts across methods.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-6">
<label>3.6</label>
<title>Diagnostic performance and SHAP-based interpretability of core biomarkers</title>
<p>Single-gene ROC analysis indicated that the AUCs for FOXO1, HOXB2, ZBTB16, LYVE1, MGP, and CYP26B1 were 0.860, 0.982, 0.843, 0.873, 0.808, and 0.835, respectively, with HOXB2 showing an AUC &#x3e;0.98, demonstrating excellent discriminative power (<xref ref-type="fig" rid="F7">Figure 7A</xref>). The analysis of gene expression demonstrated a notable upregulation of the FOXO1, ZBTB16, LYVE1, MGP, and CYP26B1 genes within the sarcopenia cohort. Conversely, the HOXB2 gene exhibited a significant downregulation in this same group, thereby underscoring their possible involvement in the pathology of the disease (<xref ref-type="fig" rid="F7">Figure 7B</xref>). The SHAP bee swarm plot and bar plot illustrated the impact of six key genes on model predictions. HOXB2 exhibited the highest average absolute SHAP value (0.213) and showed negative regulation, indicating its dominant role in discrimination, but increased expression was inversely related to predicted risk. LYVE1, ZBTB16, and FOXO1 showed positive SHAP values (0.057&#x2013;0.066), indicating that higher expression levels of these genes were linked to an elevation in the predicted outcomes. MGP and CYP26B1 had weaker effects (SHAP &#x3c;0.045) (<xref ref-type="fig" rid="F7">Figures 7C,D</xref>). SHAP dependence plots revealed distinct non-linear and dose-dependent relationships between gene expression levels and their contributions to model output. Specifically, the negative contribution of HOXB2 plateaued at higher expression levels, suggesting a saturation effect (<xref ref-type="fig" rid="F7">Figure 7Ei</xref>), while FOXO1 exhibited a transition from a negative to a positive impact as its expression increased, indicating a threshold-dependent shift in its influence on model prediction (<xref ref-type="fig" rid="F7">Figure 7iv</xref>). Similar non-linear patterns were also observed for LYVE1, ZBTB16, MGP, and CYP26B1 (<xref ref-type="fig" rid="F7">Figure 7Eii, iii, v, vi</xref>), further supporting the robustness of SHAP-based interpretability in revealing complex gene&#x2013;model interactions.</p>
<fig id="F7" position="float">
<label>FIGURE 7</label>
<caption>
<p>Gene expression characteristics and SHAP-based interaction analysis of the model. <bold>(A)</bold> ROC curves for individual model genes, demonstrating their discriminative performance in distinguishing sarcopenia from normal samples. <bold>(B)</bold> Box plots comparing gene expression levels between sarcopenia and control groups (blue: Control; red: Sarcopenia). Statistical significance is indicated by asterisks (&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.001). <bold>(C)</bold> SHAP feature importance plot ranking genes according to their mean absolute SHAP values. <bold>(D)</bold> SHAP beeswarm plot illustrating the distribution of SHAP values for each gene across all samples; colors represent gene expression levels (orange: high, purple: low), indicating how expression magnitude influences model predictions. <bold>(E)</bold> SHAP dependence plots <bold>(i&#x2013;vi)</bold> showing the non-linear relationships between individual gene expression levels and their SHAP values, with color gradients indicating potential interaction effects with secondary genes.</p>
</caption>
<graphic xlink:href="fmolb-13-1760938-g007.tif">
<alt-text content-type="machine-generated">Figure composed of six panels depicting statistical analyses of gene expression: (A) ROC curves displaying the diagnostic performance of six genes; (B) boxplots comparing gene expression in control and treated groups; (C) bar graph showing mean SHAP values for feature importance; (D) scatterplot summarizing SHAP feature contributions; (E)(i&#x2013;vi) scatterplots of SHAP values versus gene expression for each gene, with colored points indicating interaction values.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-7">
<label>3.7</label>
<title>Immune infiltration analysis and its association with diagnostic features</title>
<p>We employed the CIBERSORT algorithm to deconstruct the immunological landscape, quantifying the relative proportions of 22 infiltrating immune cell types across both sarcopenia and control samples (<xref ref-type="fig" rid="F8">Figure 8A</xref>). Subsequent comparative analysis using the Wilcoxon test highlighted distinct immunological signatures, specifically revealing significant disparities in the abundance of M2 Macrophages and resting Dendritic cells between the two cohorts (<xref ref-type="fig" rid="F8">Figure 8B</xref>). To further elucidate the interplay between molecular drivers and the immune microenvironment, we constructed correlation network heatmaps linking core genes to specific immune subsets (<xref ref-type="fig" rid="F8">Figure 8C</xref>) and analyzed intra-immune interactions (<xref ref-type="fig" rid="F8">Figure 8D</xref>). Notably, genes such as HOXB2, LYVE1, MGP, and CYP26B1 exhibited significant negative associations with resting NK cells, while ZBTB16 revealed a negative association with M1 macrophages (<xref ref-type="fig" rid="F8">Figure 8E</xref>). These patterns strongly imply that macrophage and NK cell dynamics are central to the immune-regulatory pathways modulated by these hub genes.</p>
<fig id="F8" position="float">
<label>FIGURE 8</label>
<caption>
<p>Research on immune characteristics related to sarcopenia and immune infiltrating cells associated with central genes. <bold>(A)</bold> Depicts a heatmap representing various immune cell types. <bold>(B)</bold> Presents a comparative analysis of the types of immune cell infiltration observed between the sarcopenia cohort and the control group. <bold>(C)</bold> Heatmap visualization illustrating the interaction landscape between the six model genes and 22 immune cell subsets. <bold>(D)</bold> Correlation matrix revealing the co-expression patterns among significant immune cells within the training cohort. <bold>(E)</bold> Lollipop plots illustrating the correlation between hub gene expression and immune cell infiltration levels in the training cohort. Each subpanel represents one core gene: <bold>(E) (i)</bold> CYP26B1, <bold>(E) (ii)</bold> HOXB2, <bold>(E) (iii)</bold> LYVE1, <bold>(E) (iv)</bold> MGP, <bold>(E) (v)</bold> ZBTB16.The horizontal axis indicates the correlation coefficient, and the dot size reflects the absolute value of the correlation. Dot colors represent the statistical significance (<italic>P-value</italic>), with warmer colors indicating stronger significance.</p>
</caption>
<graphic xlink:href="fmolb-13-1760938-g008.tif">
<alt-text content-type="machine-generated">Composite scientific graphic summarizes immune cell composition and gene-correlation analysis. Panel A shows stacked bar graphs of immune cell distributions in control and treated groups. Panel B presents box plots comparing immune cell fractions by group. Panel C features a network plot visualizing significant correlations between immune cell types and genes, color-coded by correlation value. Panel D displays a color-coded heatmap of cell-cell correlation coefficients. Panels E(i&#x2013;v) are lollipop plots showing correlation coefficients and p-values between selected genes (CYP26B1, HOXB, LYVE1, MGP, ZBTB16) and immune cell types, with color gradients for statistical significance.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-8">
<label>3.8</label>
<title>MR validated the causal role of CYP26B1 in sarcopenia</title>
<p>To probe the causal underpinnings of sarcopenia, we established a two-sample MR framework, mining the IEU Open GWAS database for valid SNPs associated with our six candidate genes (FOXO1, HOXB2, ZBTB16, LYVE1, MGP, and CYP26B1).By applying stringent instrumental variable criteria (<italic>P</italic> &#x3c; 5e-8), we successfully isolated robust genetic instruments.The MR analysis demonstrated a noteworthy positive causal relationship between the expression levels of CYP26B1 (Odds Ratio &#x3d; 1.006, 95% Confidence Interval: 1.002&#x2013;1.011, <italic>P</italic> &#x3d; 0.004) and the likelihood of developing sarcopenia (<xref ref-type="fig" rid="F9">Figure 9A</xref>). While MR-Egger regression and pattern-based analyses yielded consistent directional outcomes, they did not achieve statistical significance. The heterogeneity assessments (Inverse Variance Weighted Q &#x3d; 5.46, <italic>P</italic> &#x3d; 0.14; MR-Egger Q &#x3d; 1.18, <italic>P</italic> &#x3d; 0.552) and pleiotropy evaluations (Egger intercept &#x3d; 0.007, <italic>P</italic> &#x3d; 0.174) revealed no significant heterogeneity or pleiotropic effects. Furthermore, the leave-one-out sensitivity analysis (Residual Sum of Squares observed &#x3d; 7.01, <italic>P</italic> &#x3d; 0.451) substantiated that no individual SNP exerted a considerable impact on the overall results, thereby reinforcing the reliability of these findings (<xref ref-type="fig" rid="F9">Figures 9B&#x2013;D</xref>).</p>
<fig id="F9" position="float">
<label>FIGURE 9</label>
<caption>
<p>The causal relationship between CYP26B1 and sarcopenia risk. <bold>(A)</bold> Scatter plot illustrating the genetic associations of individual SNPs with CYP26B1 expression (exposure) versus sarcopenia risk (outcome). Regression slopes represent causal estimates from five distinct MR methods, including IVW and MR-Egger. <bold>(B)</bold> The forest plot showcases the levels of SNPs related to CYP26B1 and their impact on sarcopenia risk, along with the overall causal estimates (b, 95% confidence interval) obtained through MR-Egger and IVW techniques. <bold>(C)</bold> Funnel plot utilized to visualize potential heterogeneity and screen for directional pleiotropy among the genetic instruments. <bold>(D)</bold> The leave-one-out sensitivity analysis plot assesses the influence of each individual SNP on the causal estimates.</p>
</caption>
<graphic xlink:href="fmolb-13-1760938-g009.tif">
<alt-text content-type="machine-generated">Panel A displays a scatter plot with four Mendelian randomization (MR) method regression lines analyzing SNP effects on sarcopenia versus CYP26B1, including inverse variance weighted, MR Egger, weighted median, weighted mode, and simple mode. Panel B presents a forest plot of MR effect sizes for CYP26B1 on sarcopenia by SNP and aggregated methods. Panel C shows a funnel plot evaluating precision (one divided by standard error) against IVW beta values for two MR methods. Panel D features a leave-one-out sensitivity analysis with a forest plot of MR effect sizes for CYP26B1 on sarcopenia, indicating individual and combined SNP effects.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-9">
<label>3.9</label>
<title>
<italic>In vitro</italic> model</title>
<p>To validate the reliability of the bioinformatic screening and the causal relationships identified through Mendelian randomization, we established an <italic>in vitro</italic> model of sarcopenia using C2C12 mouse myoblasts. As illustrated in <xref ref-type="fig" rid="F10">Figures 10A&#x2013;F</xref>, the mRNA expression levels of the six hub genes were quantified via qPCR. Compared with the Control group, the expression levels of Cyp26b1 (<xref ref-type="fig" rid="F10">Figure 10A</xref>, <italic>P</italic> &#x3c; 0.05), Foxo1 (<xref ref-type="fig" rid="F10">Figure 10B</xref>, <italic>P</italic> &#x3c; 0.01), Lyve1 (<xref ref-type="fig" rid="F10">Figure 10D</xref>, <italic>P</italic> &#x3c; 0.0001), Mgp (<xref ref-type="fig" rid="F10">Figure 10E</xref>, <italic>P</italic> &#x3c; 0.01), and Zbtb16 (<xref ref-type="fig" rid="F10">Figure 10F</xref>, <italic>P</italic> &#x3c; 0.001) were significantly elevated in the Model group. Conversely, the expression of Hoxb2 (<xref ref-type="fig" rid="F10">Figure 10C</xref>, <italic>P</italic> &#x3c; 0.05) exhibited a significant decrease following induction. These experimental results are highly consistent with the mRNA expression profiles identified in the GEO datasets (GSE1428 and GSE8479) and the machine learning predictions, confirming that these genes are key regulatory nodes in the progression of sarcopenia and providing a solid molecular basis for further mechanistic exploration.</p>
<fig id="F10" position="float">
<label>FIGURE 10</label>
<caption>
<p>Altered expression of key genes in H<sub>2</sub>O<sub>2</sub>-induced C2C12 cell sarcopenia model. <bold>(A)</bold> Cyp26b1; <bold>(B)</bold> Foxo1; <bold>(C)</bold> Hoxb2; <bold>(D)</bold> Lyve1; <bold>(E)</bold> Mgp; <bold>(F)</bold> Zbtb16. &#x2a;<italic>P</italic> &#x3c; 0.05, &#x2a;&#x2a;<italic>P</italic> &#x3c; 0.01, &#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.001, &#x2a;&#x2a;&#x2a;&#x2a;<italic>P</italic> &#x3c; 0.0001.</p>
</caption>
<graphic xlink:href="fmolb-13-1760938-g010.tif">
<alt-text content-type="machine-generated">Six bar graphs labeled A to F compare gene expression between control and model groups for Cyp26b1, Foxo1, Hoxb2, Lyve1, Mgp, and Zbtb16. Significance levels are indicated by asterisks.</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<label>4</label>
<title>Discussion</title>
<p>Sarcopenia is characterized by the gradual loss of skeletal muscle mass and strength, which poses significant challenges to public health, particularly among the elderly population (<xref ref-type="bibr" rid="B6">Chan and Yang, 2022</xref>; <xref ref-type="bibr" rid="B84">Wu et al., 2023</xref>; <xref ref-type="bibr" rid="B91">Yuan and Larsson, 2023</xref>). Epidemiological studies indicate that the prevalence of sarcopenia is 5%&#x2013;13% in individuals aged 60&#x2013;70 years, and it can be as high as 50% in those over 80 years, leading to increased morbidity, disability, and mortality (<xref ref-type="bibr" rid="B3">Ates Bulut et al., 2017</xref>; <xref ref-type="bibr" rid="B44">Kitamura et al., 2020</xref>; <xref ref-type="bibr" rid="B55">Milewska et al., 2022</xref>; <xref ref-type="bibr" rid="B84">Wu et al., 2023</xref>). However, the early symptoms of the disease are not obvious and can easily be overlooked. Furthermore, the clinical manifestations can vary among patients, complicating the effective study of sarcopenia progression (<xref ref-type="bibr" rid="B87">Xie et al., 2021</xref>). Although several biomarkers associated with sarcopenia have been identified, early diagnosis remains a significant challenge due to the complex underlying pathophysiological mechanisms and atypical early clinical presentations (<xref ref-type="bibr" rid="B37">Kalinkovich and Livshits, 2015</xref>; <xref ref-type="bibr" rid="B87">Xie et al., 2021</xref>; <xref ref-type="bibr" rid="B76">Veronesi et al., 2024</xref>). Therefore, developing accurate molecular biomarkers for identification and predictive diagnostic models is of utmost clinical significance for the early recognition and management of sarcopenia, as this may facilitate timely interventions and improve patient outcomes.</p>
<p>Our integrated analysis indicates that genes associated with sarcopenia mainly converge on extracellular matrix remodeling, muscle fiber organization, immune regulation, and retinoid metabolism. These biological processes are highly consistent with the core pathological features of sarcopenia, including impaired muscle structural integrity, dysregulated regeneration, chronic low-grade inflammation, and metabolic imbalance, suggesting that sarcopenia is a multifactorial disorder rather than the result of a single molecular abnormality (<xref ref-type="bibr" rid="B80">Wang et al., 2023</xref>; <xref ref-type="bibr" rid="B12">Cheng Y. et al., 2025</xref>; <xref ref-type="bibr" rid="B19">Damanti et al., 2025</xref>; <xref ref-type="bibr" rid="B47">Li N. et al., 2025</xref>).</p>
<p>Specifically, alterations in cell&#x2013;matrix adhesion and contractile fiber assembly reflect disruption of cytoskeletal and extracellular matrix architecture that is essential for maintaining muscle strength and regeneration (<xref ref-type="bibr" rid="B18">Cruz-Jentoft and Sayer, 2019</xref>; <xref ref-type="bibr" rid="B71">Sun et al., 2025</xref>; <xref ref-type="bibr" rid="B29">Granic et al., 2026</xref>). In parallel, the enrichment of immune-related pathways highlights the contribution of immune dysregulation and persistent inflammatory signaling to muscle degeneration (<xref ref-type="bibr" rid="B83">Wilson et al., 2017</xref>; <xref ref-type="bibr" rid="B88">Xie et al., 2025</xref>). Moreover, the involvement of retinoid metabolism suggests that abnormalities in vitamin A and retinoic acid signaling may impair myogenic differentiation and tissue repair, providing an important metabolic link to sarcopenia pathogenesis (<xref ref-type="bibr" rid="B24">El Haddad et al., 2017</xref>; <xref ref-type="bibr" rid="B43">Kitakaze et al., 2023</xref>; <xref ref-type="bibr" rid="B25">Fang et al., 2024</xref>; <xref ref-type="bibr" rid="B70">Song et al., 2024</xref>; <xref ref-type="bibr" rid="B13">Cheung et al., 2025</xref>).</p>
<p>Among the six key genes confirmed in this study, genes such as Forkhead box O1(FOXO1) (<xref ref-type="bibr" rid="B52">Maimaiti et al., 2025</xref>), Homeobox protein Hox-B2 (HOXB2) (<xref ref-type="bibr" rid="B9">Chen Y. et al., 2024</xref>), Lymphatic vessel endothelial hyaluronan receptor 1 (LYVE-1) (<xref ref-type="bibr" rid="B68">Shen et al., 2024</xref>), and Matrix Gla protein (MGP) (<xref ref-type="bibr" rid="B89">Yang et al., 2025</xref>) have been supported by literature for their association with sarcopenia. Forkhead box O (FOXO) proteins are transcription factors that play a critical role in regulating skeletal muscle mass and control myogenic differentiation and fiber type specificity (<xref ref-type="bibr" rid="B40">Kamei et al., 2004</xref>; <xref ref-type="bibr" rid="B36">Huang et al., 2019</xref>). Studies have shown that in C2C12 cells and mouse models, &#x3b2;-sitosterol inhibits catabolic pathways by downregulating FoxO1, thereby preventing protein catabolism in skeletal muscle and reducing age-related muscle loss (<xref ref-type="bibr" rid="B34">Hah et al., 2022</xref>). Homeobox (Hox) genes are highly conserved transcription factors that play a crucial role in the proper development of muscles and the regulation of muscle-specific genes in mature muscle tissue (<xref ref-type="bibr" rid="B35">Houghton and Rosenthal, 1999</xref>; <xref ref-type="bibr" rid="B60">Poliacikova et al., 2021</xref>). As a member of this family, HOXB2 has been previously indicated to be downregulated in sarcopenia, consistent with the findings of this study (<xref ref-type="bibr" rid="B9">Chen Y. et al., 2024</xref>). Research has pointed out that after muscle injury, the expression of LYVE-1 is upregulated, leading to lymphangiogenesis, which promotes tissue repair and inflammation resolution (<xref ref-type="bibr" rid="B74">Taketa et al., 2024</xref>). A transcriptomic study on sarcopenia identified LYVE1 as a marker gene for tissue-resident macrophages in the skeletal muscle microenvironment, showing consistent expression across different age groups and pathological conditions (<xref ref-type="bibr" rid="B68">Shen et al., 2024</xref>). MGP regulates the calcification of bone and cartilage and is a substrate for &#x3b3;-glutamyl carboxylase (<xref ref-type="bibr" rid="B61">Price et al., 1976</xref>). MGP is present in muscle, fat, and bone tissues, and all undergo vitamin K-dependent carboxylation modifications, coupling the degenerative processes of muscle, fat, and bone at the molecular level; its dysfunction may be a triggering and sustaining factor for multi-organ coordinated degeneration in sarcopenia (<xref ref-type="bibr" rid="B67">Schweighofer et al., 2022</xref>).</p>
<p>Additionally, this research identifies for the first time a correlation between Cytochrome P450 family 26 subfamily B member 1(CYP26B1) and Zinc finger and BTB domain containing 16 (ZBTB16) with this disease. ZBTB16 belongs to the evolutionarily conserved Zinc finger and BTB(ZBTB) transcription factor family (<xref ref-type="bibr" rid="B10">Cheng et al., 2021</xref>). Research has found that ZBTB16 expression in fibroblasts is critical for inflammation and fibrosis in the aging heart, a process modulated by macrophage mineralocorticoid receptors (<xref ref-type="bibr" rid="B27">Fraccarollo et al., 2024</xref>). Additionally, ZBTB16 has been reported to enhance the oligomerization of the inflammasome adaptor protein ASC by promoting its SUMOylation, thereby driving inflammasome assembly (<xref ref-type="bibr" rid="B22">Dong et al., 2023</xref>). All this evidence indicates that ZBTB16 may not only be a new candidate gene for sarcopenia, but also play a role in the development of the disease by regulating the chronic inflammatory process.</p>
<p>Compared with traditional sarcopenia biomarkers that mainly focus on single pathways such as inflammatory cytokines (e.g., tumor necrosis factor-&#x3b1; (TNF-&#x3b1;), interleukin-6 (IL-6), and interleukin-8 (IL-8)) (<xref ref-type="bibr" rid="B59">Picca et al., 2022</xref>; <xref ref-type="bibr" rid="B4">Calluy et al., 2026</xref>; <xref ref-type="bibr" rid="B69">Sokolova et al., 2026</xref>) or muscle-specific proteins (e.g., muscle RING-finger protein-1 (MuRF1), FOXO1, eukaryotic translation elongation factor 1 epsilon 1 (EEF1E1), and perilipin-2 (PLIN2)) (<xref ref-type="bibr" rid="B75">Van Long et al., 2023</xref>; <xref ref-type="bibr" rid="B23">Dun et al., 2024</xref>), our six-gene signature (FOXO1, HOXB2, LYVE1, ZBTB16, MGP, and CYP26B1) provides a more comprehensive and multi-dimensional representation of the disease by integrating immune regulation, structural integrity, and metabolic homeostasis, which better reflects the multifactorial nature of sarcopenia (<xref ref-type="bibr" rid="B30">Grima-Terr&#xe9;n et al., 2024</xref>; <xref ref-type="bibr" rid="B65">Sato et al., 2024</xref>). Methodologically, this study goes beyond conventional differential expression analyses by integrating WGCNA, machine learning algorithms, PPI network construction, and SHAP interpretation, an analytical strategy that is increasingly adopted in recent high-impact bioinformatics-driven biomedical studies (<xref ref-type="bibr" rid="B62">Sackett et al., 2022</xref>; <xref ref-type="bibr" rid="B8">Chen B. et al., 2024</xref>; <xref ref-type="bibr" rid="B56">Niu et al., 2024</xref>; <xref ref-type="bibr" rid="B81">Wang et al., 2024</xref>; <xref ref-type="bibr" rid="B50">Liu et al., 2025</xref>). More importantly, we introduced Mendelian randomization to move from correlation to causality (<xref ref-type="bibr" rid="B20">Davey Smith and Hemani, 2014</xref>; <xref ref-type="bibr" rid="B85">Wu Q. et al., 2025</xref>), identifying CYP26B1 as a potential causal risk factor for sarcopenia. Together, these advances establish a causally informed, multi-pathway biomarker framework that offers clear advantages over existing single-dimension biomarkers.</p>
<p>The significantly elevated expression level of the CYP26B1 gene in sarcopenia patients warrants further exploration of its molecular mechanisms in muscle metabolism regulation. CYP26B1 is a member of the cytochrome P450 enzyme family that metabolizes retinoic acid (RA) into easily degradable derivatives (<xref ref-type="bibr" rid="B97">Zhang Z. et al., 2025</xref>). RA is a bioactive derivative of vitamin A, which is particularly important in regulating many biological processes, such as cell differentiation, growth and apoptosis (<xref ref-type="bibr" rid="B57">Noy, 2010</xref>; <xref ref-type="bibr" rid="B33">Guo et al., 2022</xref>). For example, it is found that RA can promote myoblasts to differentiate into mature muscle fibers by antagonizing TGF-&#x3b2; signal mediated by C/EBP&#x3b2;, thus enhancing muscle production ability (<xref ref-type="bibr" rid="B45">Lamarche et al., 2015</xref>; <xref ref-type="bibr" rid="B73">Takaya et al., 2022</xref>). CYP26B1 is crucial in the metabolic pathway of vitamin A, as it facilitates the conversion of surplus retinoic acid into its inactive polar derivatives (<xref ref-type="bibr" rid="B42">Khosasih et al., 2023</xref>). Vitamin A is essential for cell development and tissue homeostasis, and studies have shown that it can stimulate muscle cell differentiation and promote skeletal muscle repair, playing an important role in maintaining muscle function (<xref ref-type="bibr" rid="B93">Zhang et al., 2023</xref>; <xref ref-type="bibr" rid="B25">Fang et al., 2024</xref>). However, elevated CYP26B1 expression may lead to excessive metabolism of RA, resulting in insufficient local active signaling, thereby weakening the beneficial effects of vitamin A on muscle maintenance and repair. Although previous studies have suggested that abnormal vitamin A metabolism may be associated with an elevated risk of sarcopenia, the precise molecular mechanisms of CYP26B1 in this process remain unclear. Additionally, its potential clinical value as a biomarker or therapeutic target necessitates further investigation and validation (<xref ref-type="bibr" rid="B25">Fang et al., 2024</xref>).</p>
<p>The MR analysis of our study found that there was an obvious positive causal relationship between the expression level of CYP26B1 and the risk of sarcopenia. This finding is very similar to other reports. For example, in tumors and Cardiac Developmental Abnormalities, the expression of CYP26B1 also increased, and it will affect cell proliferation and differentiation by degrading retinoic acid, which has been confirmed in (<xref ref-type="bibr" rid="B1">Ahuja et al., 2022</xref>; <xref ref-type="bibr" rid="B31">Gu et al., 2025</xref>). It has been reported that activating Wnt/&#x3b2;-catenin pathway can decrease the expression of CYP26B1, so that the signal of retinoic acid will be enhanced, thus promoting osteogenesis and tissue regeneration (<xref ref-type="bibr" rid="B90">Yao et al., 2023</xref>). In sarcopenia patients and elderly mouse models, knocking down STAT3 with siRNA can activate the Wnt/&#x3b2;-catenin pathway, enhancing the expression of myogenic markers and restoring muscle mass and function (<xref ref-type="bibr" rid="B21">Deng et al., 2024</xref>; <xref ref-type="bibr" rid="B95">Zhang S. et al., 2025</xref>). However, the abnormal upregulation of CYP26B1 may interfere with this pathway, leading to weak differentiation signal and muscle production problems.</p>
<p>In order to study the relationship between key genes and the immune microenvironment of sarcopenia more carefully, we used the method of CIBERSORT to analyze how immune cells entered the muscle. Many studies have told us that inflammation and abnormal immune system have a great influence on the occurrence of sarcopenia (<xref ref-type="bibr" rid="B63">Saini et al., 2016</xref>; <xref ref-type="bibr" rid="B92">Zhang et al., 2022</xref>; <xref ref-type="bibr" rid="B98">Zhou et al., 2025</xref>). The aging of our immune system will make our muscles age in several ways, and finally lead to sarcopenia (<xref ref-type="bibr" rid="B79">Wang et al., 2019</xref>). Additionally, scientists conducted genetic analysis and tissue examination on patients with sarcopenia, and found that in the microenvironment of human skeletal muscle, the types of immune cells, how they stay together and how they interact with each other have changed with people getting older. These changes make the elderly or people with sarcopenia prone to a long-term inflammation in their muscles (<xref ref-type="bibr" rid="B68">Shen et al., 2024</xref>). Our study indicates that the genes HOXB2, LYVE1, MGP, and CYP26B1 show significant negative correlations with NK cells resting. NK cells, as an important component of the innate immune system, play a key role in maintaining immune homeostasis, clearing abnormal cells, and regulating the tissue microenvironment (<xref ref-type="bibr" rid="B51">Lutz and Quinn, 2012</xref>; <xref ref-type="bibr" rid="B17">Crinier et al., 2020</xref>; <xref ref-type="bibr" rid="B77">Vivier et al., 2024</xref>). ZBTB16 demonstrates an inverse correlation with M1 macrophages. Macrophages are essential in tissue regeneration and the maintenance of muscle homeostasis, as they release growth factors and cytokines that regulate the behavior of muscle stem cells and the activation of myofibroblasts (<xref ref-type="bibr" rid="B7">Chen et al., 2022</xref>). However, at present, there is still a lack of systematic research on the molecular mechanisms by which these key genes (HOXB2, LYVE1, MGP, CYP26B1, and ZBTB16) regulate the functional states of NK cells and macrophages in the context of sarcopenia. The results of this study mainly reflect the statistical correlations between gene expression levels and immune cell infiltration, and thus cannot directly infer causal regulatory relationships. Further functional experiments and mechanistic studies are required to elucidate the related molecular pathways and regulatory networks, which will contribute to a more comprehensive understanding of the role of immune regulation in the development and progression of sarcopenia.Moreover, whether these genes interact with each other in a coordinated or synergistic manner to modulate immune cell behavior and muscle microenvironment remodeling remains unknown and warrants further investigation.</p>
<p>This study has made progress in identifying and functionally predicting key genes related to sarcopenia; however, several limitations should be acknowledged. First, the diagnostic models were mainly based on transcriptomic data from public GEO datasets and lacked validation in independent clinical cohorts, which may limit their generalizability. Second, although MR analysis suggested a causal role of CYP26B1 in sarcopenia, this conclusion still requires validation through functional experiments. In addition, while the six-gene panel showed strong combined diagnostic performance, their potential biological synergistic interactions were not directly explored. Moreover, due to the absence of detailed clinical information in the GEO datasets, potential confounding factors such as Body mass index, lifestyle, comorbidities, and medication use could not be fully adjusted for, which may have influenced the observed associations.</p>
<p>Future studies should integrate spatial transcriptomics and single-cell sequencing, together with functional experiments such as gene knockdown or overexpression, to clarify causal mechanisms and gene&#x2013;immune cell interactions. In addition, multi-center clinical cohorts with comprehensive clinical and lifestyle covariates are needed to validate the multi-gene diagnostic model and to explore possible synergistic regulatory effects among these genes.</p>
</sec>
<sec sec-type="conclusion" id="s5">
<label>5</label>
<title>Conclusion</title>
<p>This study successfully combined WGCNA and multiple machine learning techniques to identify six key sarcopenia biomarkers: HOXB2, FOXO1, LYVE1, ZBTB16, MGP, and CYP26B1, with PCR confirmation in cell models. Most significantly, our MR analysis identified CYP26B1 as a causal factor, linking retinoic acid metabolism directly to sarcopenia pathogenesis. Theoretically, this completes the chain from genetic association to immune-metabolic causation. Clinically, while the six-gene panel aids diagnosis, CYP26B1 represents a novel therapeutic target for modulating retinoic acid pathways and the immune microenvironment.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s6">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="sec" rid="s13">Supplementary Material</xref>.</p>
</sec>
<sec sec-type="ethics-statement" id="s7">
<title>Ethics statement</title>
<p>Ethical approval was not required for the studies on animals in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used.</p>
</sec>
<sec sec-type="author-contributions" id="s8">
<title>Author contributions</title>
<p>YW: Software, Visualization, Writing &#x2013; original draft, Writing &#x2013; review and editing. XC: Formal Analysis, Writing &#x2013; original draft. SF: Methodology, Writing &#x2013; original draft. LZ: Formal Analysis, Writing &#x2013; original draft. YJ: Data curation, Writing &#x2013; original draft. TC: Data curation, Writing &#x2013; original draft. ML: Project administration, Supervision, Writing &#x2013; original draft. YS: Project administration, Supervision, Writing &#x2013; original draft.</p>
</sec>
<ack>
<title>Acknowledgements</title>
<p>We would like to express our sincere gratitude for the data made available by databases such as GEO and GWAS.</p>
</ack>
<sec sec-type="COI-statement" id="s10">
<title>Conflict of interest</title>
<p>The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s11">
<title>Generative AI statement</title>
<p>The author(s) declared that generative AI was not used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec sec-type="disclaimer" id="s12">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec sec-type="supplementary-material" id="s13">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fmolb.2026.1760938/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fmolb.2026.1760938/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Table2.xlsx" id="SM1" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table3.xlsx" id="SM2" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table1.xlsx" id="SM3" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ahuja</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Hiltabidle</surname>
<given-names>M. S.</given-names>
</name>
<name>
<surname>Rajasekhar</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Voss</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>S. Z.</given-names>
</name>
<name>
<surname>Barlow</surname>
<given-names>H. R.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Endothelial Cyp26b1 restrains murine heart valve growth during development</article-title>. <source>Dev. Biol.</source> <volume>486</volume>, <fpage>81</fpage>&#x2013;<lpage>95</lpage>. <pub-id pub-id-type="doi">10.1016/j.ydbio.2022.03.003</pub-id>
<pub-id pub-id-type="pmid">35364055</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Aleksander</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Balhoff</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Carbon</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Cherry</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Drabkin</surname>
<given-names>H. J.</given-names>
</name>
<name>
<surname>Ebert</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>The gene ontology knowledgebase in 2023</article-title>. <source>Genetics</source> <volume>224</volume>, <fpage>iyad031</fpage>. <pub-id pub-id-type="doi">10.1093/genetics/iyad031</pub-id>
<pub-id pub-id-type="pmid">36866529</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ates Bulut</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Soysal</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Aydin</surname>
<given-names>A. E.</given-names>
</name>
<name>
<surname>Dokuzlar</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Kocyigit</surname>
<given-names>S. E.</given-names>
</name>
<name>
<surname>Isik</surname>
<given-names>A. T.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Vitamin B12 deficiency might be related to sarcopenia in older adults</article-title>. <source>Exp. Gerontol.</source> <volume>95</volume>, <fpage>136</fpage>&#x2013;<lpage>140</lpage>. <pub-id pub-id-type="doi">10.1016/j.exger.2017.05.017</pub-id>
<pub-id pub-id-type="pmid">28549839</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Calluy</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Malrechauff&#xe9;</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Boretti</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Van Heden</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Sanchez-Rodriguez</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Chan</surname>
<given-names>Y. M.</given-names>
</name>
<etal/>
</person-group> (<year>2026</year>). <article-title>Frequently reported blood biomarkers in sarcopenia clinical trials: a systematic review and meta-analysis</article-title>. <source>Aging Cell</source> <volume>25</volume>, <fpage>e70361</fpage>. <pub-id pub-id-type="doi">10.1111/acel.70361</pub-id>
<pub-id pub-id-type="pmid">41521726</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cannataro</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Carbone</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Petro</surname>
<given-names>J. L.</given-names>
</name>
<name>
<surname>Cione</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Vargas</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Angulo</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Sarcopenia: etiology, nutritional approaches, and miRNAs</article-title>. <source>Int. J. Mol. Sci.</source> <volume>22</volume>, <fpage>9724</fpage>. <pub-id pub-id-type="doi">10.3390/ijms22189724</pub-id>
<pub-id pub-id-type="pmid">34575884</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chan</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Q.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Skeletal muscle metabolic alternation develops sarcopenia</article-title>. <source>Aging Dis.</source> <volume>13</volume>, <fpage>801</fpage>&#x2013;<lpage>814</lpage>. <pub-id pub-id-type="doi">10.14336/ad.2021.1107</pub-id>
<pub-id pub-id-type="pmid">35656108</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>Y. F.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>C. W.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>H. H.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>W. T.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>O. K.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Immunometabolism of macrophages regulates skeletal muscle regeneration</article-title>. <source>Front. Cell Dev. Biol.</source> <volume>10</volume>, <fpage>948819</fpage>. <pub-id pub-id-type="doi">10.3389/fcell.2022.948819</pub-id>
<pub-id pub-id-type="pmid">36147742</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>An integrated machine learning framework for developing and validating a diagnostic model of major depressive disorder based on interstitial cystitis-related genes</article-title>. <source>J. Affect Disord.</source> <volume>359</volume>, <fpage>22</fpage>&#x2013;<lpage>32</lpage>. <pub-id pub-id-type="doi">10.1016/j.jad.2024.05.061</pub-id>
<pub-id pub-id-type="pmid">38754597</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Epigenetic characterization of sarcopenia-associated genes based on machine learning and network screening</article-title>. <source>Eur. J. Med. Res.</source> <volume>29</volume>, <fpage>54</fpage>. <pub-id pub-id-type="doi">10.1186/s40001-023-01603-8</pub-id>
<pub-id pub-id-type="pmid">38229116</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname>
<given-names>Z. Y.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>T. T.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>X. M.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>ZBTB transcription factors: key regulators of the development, differentiation and effector function of T cells</article-title>. <source>Front. Immunol.</source> <volume>12</volume>, <fpage>713294</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2021.713294</pub-id>
<pub-id pub-id-type="pmid">34349770</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>J. X.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Research progress on the relationship between aging and microbiota in sarcopenia</article-title>. <source>Front. Med. (Lausanne)</source> <volume>12</volume>, <fpage>1549733</fpage>. <pub-id pub-id-type="doi">10.3389/fmed.2025.1549733</pub-id>
<pub-id pub-id-type="pmid">40852355</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Fan</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>The role of chronic low-grade inflammation in the development of sarcopenia: advances in molecular mechanisms</article-title>. <source>Int. Immunopharmacol.</source> <volume>147</volume>, <fpage>114056</fpage>. <pub-id pub-id-type="doi">10.1016/j.intimp.2025.114056</pub-id>
<pub-id pub-id-type="pmid">39799736</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheung</surname>
<given-names>C. V.</given-names>
</name>
<name>
<surname>Searcy</surname>
<given-names>R. A.</given-names>
</name>
<name>
<surname>Atube</surname>
<given-names>K. J.</given-names>
</name>
<name>
<surname>Colonna</surname>
<given-names>N. A.</given-names>
</name>
<name>
<surname>Krusen</surname>
<given-names>K. E.</given-names>
</name>
<name>
<surname>Coppage</surname>
<given-names>K. J.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Local injection of particles for retinoic acid drug delivery improves muscle structure and modulates inflammation in mice recovering from cast immobilization</article-title>. <source>Am. J. Physiol. Cell Physiol.</source> <volume>329</volume>, <fpage>C1343</fpage>&#x2013;<lpage>C1359</lpage>. <pub-id pub-id-type="doi">10.1152/ajpcell.00097.2025</pub-id>
<pub-id pub-id-type="pmid">40953042</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chin</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>S. H.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>H. H.</given-names>
</name>
<name>
<surname>Ho</surname>
<given-names>C. W.</given-names>
</name>
<name>
<surname>Ko</surname>
<given-names>M. T.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>C. Y.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>cytoHubba: identifying hub objects and sub-networks from complex interactome</article-title>. <source>BMC Syst. Biol.</source> <volume>8</volume> (<issue>Suppl. 4</issue>), <fpage>S11</fpage>. <pub-id pub-id-type="doi">10.1186/1752-0509-8-s4-s11</pub-id>
<pub-id pub-id-type="pmid">25521941</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cho</surname>
<given-names>M. R.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>S. K.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>A review of Sarcopenia pathophysiology, diagnosis, treatment and future direction</article-title>. <source>J. Korean Med. Sci.</source> <volume>37</volume>, <fpage>e146</fpage>. <pub-id pub-id-type="doi">10.3346/jkms.2022.37.e146</pub-id>
<pub-id pub-id-type="pmid">35535373</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chung</surname>
<given-names>J. Y.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>S. G.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>S. H.</given-names>
</name>
<name>
<surname>Park</surname>
<given-names>C. H.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Sarcopenia: how to determine and manage</article-title>. <source>Knee Surg. Relat. Res.</source> <volume>37</volume>, <fpage>12</fpage>. <pub-id pub-id-type="doi">10.1186/s43019-025-00265-6</pub-id>
<pub-id pub-id-type="pmid">40098209</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Crinier</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Narni-Mancinelli</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Ugolini</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Vivier</surname>
<given-names>E.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>SnapShot: natural killer cells</article-title>. <source>Cell</source> <volume>180</volume>, <fpage>1280</fpage>&#x2013;<lpage>1280.e1281</lpage>. <pub-id pub-id-type="doi">10.1016/j.cell.2020.02.029</pub-id>
<pub-id pub-id-type="pmid">32200803</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cruz-Jentoft</surname>
<given-names>A. J.</given-names>
</name>
<name>
<surname>Sayer</surname>
<given-names>A. A.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Sarcopeni</article-title>. <source>Lancet</source> <volume>393</volume>, <fpage>2636</fpage>&#x2013;<lpage>2646</lpage>. <pub-id pub-id-type="doi">10.1016/s0140-6736(19)31138-9</pub-id>
<pub-id pub-id-type="pmid">31171417</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Damanti</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Senini</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>De Lorenzo</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Merolla</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Santoro</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Festorazzi</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Molecular constraints of sarcopenia in the ageing muscle</article-title>. <source>Front. Aging</source> <volume>6</volume>, <fpage>1588014</fpage>. <pub-id pub-id-type="doi">10.3389/fragi.2025.1588014</pub-id>
<pub-id pub-id-type="pmid">40678078</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Davey Smith</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Hemani</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Mendelian randomization: genetic anchors for causal inference in epidemiological studies</article-title>. <source>Hum. Mol. Genet.</source> <volume>23</volume>, <fpage>R89</fpage>&#x2013;<lpage>R98</lpage>. <pub-id pub-id-type="doi">10.1093/hmg/ddu328</pub-id>
<pub-id pub-id-type="pmid">25064373</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Deng</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Inhibition of CILP2 improves glucose metabolism and mitochondrial dysfunction in Sarcopenia <italic>via</italic> the wnt signalling pathway</article-title>. <source>J. Cachexia, Sarcopenia Muscle</source> <volume>15</volume>, <fpage>2544</fpage>&#x2013;<lpage>2558</lpage>. <pub-id pub-id-type="doi">10.1002/jcsm.13597</pub-id>
<pub-id pub-id-type="pmid">39385717</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dong</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Du</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Fei</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Inflammasome activity is controlled by ZBTB16-dependent SUMOylation of ASC</article-title>. <source>Nat. Commun.</source> <volume>14</volume>, <fpage>8465</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-023-43945-1</pub-id>
<pub-id pub-id-type="pmid">38123560</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dun</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Du</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>High-Intensity Interval training mitigates Sarcopenia and suppresses the Myoblast Senescence Regulator EEF1E1</article-title>. <source>J. Cachexia Sarcopenia Muscle</source> <volume>15</volume>, <fpage>2574</fpage>&#x2013;<lpage>2585</lpage>. <pub-id pub-id-type="doi">10.1002/jcsm.13600</pub-id>
<pub-id pub-id-type="pmid">39276001</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>El Haddad</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Notarnicola</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Evano</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>El Khatib</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Blaqui&#xe8;re</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Bonnieu</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Retinoic acid maintains human skeletal muscle progenitor cells in an immature state</article-title>. <source>Cell Mol. Life Sci.</source> <volume>74</volume>, <fpage>1923</fpage>&#x2013;<lpage>1936</lpage>. <pub-id pub-id-type="doi">10.1007/s00018-016-2445-1</pub-id>
<pub-id pub-id-type="pmid">28025671</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Bai</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Ying</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>Z.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Systematic exploration of the Association between vitamin A intakes and sarcopenia prevalence in American adults</article-title>. <source>Food Sci. and Nutr.</source> <volume>12</volume>, <fpage>10786</fpage>&#x2013;<lpage>10799</lpage>. <pub-id pub-id-type="doi">10.1002/fsn3.4613</pub-id>
<pub-id pub-id-type="pmid">39723081</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feng</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Xi</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>Z.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Aerobic exercise and resistance exercise alleviate skeletal muscle atrophy through IGF-1/IGF-1R-PI3K/Akt pathway in mice with myocardial infarction</article-title>. <source>Am. J. Physiol. Cell Physiol.</source> <volume>322</volume>, <fpage>C164</fpage>&#x2013;<lpage>C176</lpage>. <pub-id pub-id-type="doi">10.1152/ajpcell.00344.2021</pub-id>
<pub-id pub-id-type="pmid">34852207</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fraccarollo</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Geffers</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Galuppo</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Bauersachs</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Mineralocorticoid receptor promotes cardiac macrophage inflammaging</article-title>. <source>Basic Res. Cardiol.</source> <volume>119</volume>, <fpage>243</fpage>&#x2013;<lpage>260</lpage>. <pub-id pub-id-type="doi">10.1007/s00395-024-01032-6</pub-id>
<pub-id pub-id-type="pmid">38329499</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Giresi</surname>
<given-names>P. G.</given-names>
</name>
<name>
<surname>Stevenson</surname>
<given-names>E. J.</given-names>
</name>
<name>
<surname>Theilhaber</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Koncarevic</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Parkington</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Fielding</surname>
<given-names>R. A.</given-names>
</name>
<etal/>
</person-group> (<year>2005</year>). <article-title>Identification of a molecular signature of sarcopenia</article-title>. <source>Physiol. Genomics</source> <volume>21</volume>, <fpage>253</fpage>&#x2013;<lpage>263</lpage>. <pub-id pub-id-type="doi">10.1152/physiolgenomics.00249.2004</pub-id>
<pub-id pub-id-type="pmid">15687482</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Granic</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Simoes</surname>
<given-names>D. C. M.</given-names>
</name>
<name>
<surname>Bowen</surname>
<given-names>T. S.</given-names>
</name>
<name>
<surname>Almaghtuf</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Richardson</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Sayer</surname>
<given-names>A. A.</given-names>
</name>
</person-group> (<year>2026</year>). <article-title>Ageing of human myofibres in the Vastus Lateralis muscle: a narrative review</article-title>. <source>Ageing Res. Rev.</source> <volume>115</volume>, <fpage>103022</fpage>. <pub-id pub-id-type="doi">10.1016/j.arr.2026.103022</pub-id>
<pub-id pub-id-type="pmid">41506604</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Grima-Terr&#xe9;n</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Campanario</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Ram&#xed;rez-Pardo</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Cisneros</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Hong</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Perdiguero</surname>
<given-names>E.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Muscle aging and sarcopenia: the pathology, etiology, and most promising therapeutic targets</article-title>. <source>Mol. Asp. Med.</source> <volume>100</volume>, <fpage>101319</fpage>. <pub-id pub-id-type="doi">10.1016/j.mam.2024.101319</pub-id>
<pub-id pub-id-type="pmid">39312874</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>Z.-D.</given-names>
</name>
<name>
<surname>Pang</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Hao</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>C.-H.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Retinoic acid metabolism related gene CYP26B1 promotes tumor stemness and tumor microenvironment remodeling in bladder cancer</article-title>. <source>J. Cancer</source> <volume>16</volume>, <fpage>2476</fpage>&#x2013;<lpage>2491</lpage>. <pub-id pub-id-type="doi">10.7150/jca.101406</pub-id>
<pub-id pub-id-type="pmid">40535799</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gueugneau</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Coudy-Gandilhon</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Chambon</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Verney</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Taillandier</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Combaret</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Muscle proteomic and transcriptomic profiling of healthy aging and metabolic syndrome in men</article-title>. <source>Int. J. Mol. Sci.</source> <volume>22</volume>, <fpage>4205</fpage>. <pub-id pub-id-type="doi">10.3390/ijms22084205</pub-id>
<pub-id pub-id-type="pmid">33921590</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Hua</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Impacts of vitamin A deficiency on biological rhythms: insights from the literature</article-title>. <source>Front. Nutr.</source> <volume>9</volume>, <fpage>886244</fpage>. <pub-id pub-id-type="doi">10.3389/fnut.2022.886244</pub-id>
<pub-id pub-id-type="pmid">36466383</pub-id>
</mixed-citation>
</ref>
<ref id="B34">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hah</surname>
<given-names>Y. S.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>W. K.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>E. J.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>J. H.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>S. J.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>&#x3b2;-Sitosterol Attenuates dexamethasone-induced muscle atrophy <italic>via</italic> regulating FoxO1-Dependent signaling in C2C12 cell and mice model</article-title>. <source>Nutrients</source> <volume>14</volume>, <fpage>2894</fpage>. <pub-id pub-id-type="doi">10.3390/nu14142894</pub-id>
<pub-id pub-id-type="pmid">35889851</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Houghton</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Rosenthal</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Regulation of a muscle-specific transgene by persistent expression of Hox genes in postnatal murine limb muscle</article-title>. <source>Dev. Dyn.</source> <volume>216</volume>, <fpage>385</fpage>&#x2013;<lpage>397</lpage>. <pub-id pub-id-type="doi">10.1002/(sici)1097-0177(199912)216:4/5&#x3c;385::Aid-dvdy7&#x3e;3.0.Co;2-g</pub-id>
<pub-id pub-id-type="pmid">10633858</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname>
<given-names>Z. Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>L. J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J. J.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>W. J.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Z. Q.</given-names>
</name>
<name>
<surname>Ni</surname>
<given-names>S. H.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Hispaglabridin B, a constituent of liquorice identified by a bioinformatics and machine learning approach, relieves protein-energy wasting by inhibiting forkhead box O1</article-title>. <source>Br. J. Pharmacol.</source> <volume>176</volume>, <fpage>267</fpage>&#x2013;<lpage>281</lpage>. <pub-id pub-id-type="doi">10.1111/bph.14508</pub-id>
<pub-id pub-id-type="pmid">30270561</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kalinkovich</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Livshits</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Sarcopenia &#x2013; the search for emerging biomarkers</article-title>. <source>Ageing Res. Rev.</source> <volume>22</volume>, <fpage>58</fpage>&#x2013;<lpage>71</lpage>. <pub-id pub-id-type="doi">10.1016/j.arr.2015.05.001</pub-id>
<pub-id pub-id-type="pmid">25962896</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kalra</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Das</surname>
<given-names>A. K.</given-names>
</name>
<name>
<surname>Kotwal</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Nagendra</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Agrawal</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Hk</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Expert opinion on management advancements in Sarcopenia: from muscle wasting to recovery</article-title>. <source>J. Assoc. Physicians India</source> <volume>73</volume>, <fpage>50</fpage>&#x2013;<lpage>60</lpage>. <pub-id pub-id-type="doi">10.59556/japi.73.1031</pub-id>
<pub-id pub-id-type="pmid">40553592</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kamble</surname>
<given-names>N. S.</given-names>
</name>
<name>
<surname>Thomas</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Madaan</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Ehsani</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Sange</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Tucker</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Engineered bacteria as an orally administered anti-viral treatment and immunization system</article-title>. <source>Gut Microbes</source> <volume>17</volume>, <fpage>2500056</fpage>. <pub-id pub-id-type="doi">10.1080/19490976.2025.2500056</pub-id>
<pub-id pub-id-type="pmid">40340796</pub-id>
</mixed-citation>
</ref>
<ref id="B40">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kamei</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Miura</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Suzuki</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kai</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Mizukami</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Taniguchi</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2004</year>). <article-title>Skeletal muscle FOXO1 (FKHR) transgenic mice have less skeletal muscle mass, down-regulated Type I (slow twitch/red muscle) fiber genes, and impaired glycemic control</article-title>. <source>J. Biol. Chem.</source> <volume>279</volume>, <fpage>41114</fpage>&#x2013;<lpage>41123</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.M400674200</pub-id>
<pub-id pub-id-type="pmid">15272020</pub-id>
</mixed-citation>
</ref>
<ref id="B41">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kanehisa</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Goto</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>KEGG: kyoto encyclopedia of genes and genomes</article-title>. <source>Nucleic Acids Res.</source> <volume>28</volume>, <fpage>27</fpage>&#x2013;<lpage>30</lpage>. <pub-id pub-id-type="doi">10.1093/nar/28.1.27</pub-id>
<pub-id pub-id-type="pmid">10592173</pub-id>
</mixed-citation>
</ref>
<ref id="B42">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khosasih</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>K. M.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>C. M.</given-names>
</name>
<name>
<surname>Liou</surname>
<given-names>L. B.</given-names>
</name>
<name>
<surname>Hsieh</surname>
<given-names>M. S.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>C. H.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>A functional polymorphism downstream of vitamin A regulator gene CYP26B1 is associated with hand osteoarthritis</article-title>. <source>Int. J. Mol. Sci.</source> <volume>24</volume>, <fpage>3021</fpage>. <pub-id pub-id-type="doi">10.3390/ijms24033021</pub-id>
<pub-id pub-id-type="pmid">36769350</pub-id>
</mixed-citation>
</ref>
<ref id="B43">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kitakaze</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Tatsumi</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Yamaguchi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kubota</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Nakatsuji</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Harada</surname>
<given-names>N.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>All-Trans retinoic acid-responsive LGR6 is transiently expressed during myogenic differentiation and is required for myoblast differentiation and fusion</article-title>. <source>Int. J. Mol. Sci.</source> <volume>24</volume>, <fpage>9035</fpage>. <pub-id pub-id-type="doi">10.3390/ijms24109035</pub-id>
<pub-id pub-id-type="pmid">37240382</pub-id>
</mixed-citation>
</ref>
<ref id="B44">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kitamura</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Seino</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Abe</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Nofuji</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yokoyama</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Amano</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Sarcopenia: prevalence, associated factors, and the risk of mortality and disability in Japanese older adults</article-title>. <source>J. Cachexia, Sarcopenia Muscle</source> <volume>12</volume>, <fpage>30</fpage>&#x2013;<lpage>38</lpage>. <pub-id pub-id-type="doi">10.1002/jcsm.12651</pub-id>
<pub-id pub-id-type="pmid">33241660</pub-id>
</mixed-citation>
</ref>
<ref id="B45">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lamarche</surname>
<given-names>&#xc9;.</given-names>
</name>
<name>
<surname>Lala-Tabbert</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Gunanayagam</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>St-Louis</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Wiper-Bergeron</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Retinoic acid promotes myogenesis in myoblasts by antagonizing transforming growth factor-beta signaling <italic>via</italic> C/EBP&#x3b2;</article-title>. <source>Skelet. Muscle</source> <volume>5</volume>, <fpage>8</fpage>. <pub-id pub-id-type="doi">10.1186/s13395-015-0032-z</pub-id>
<pub-id pub-id-type="pmid">25878769</pub-id>
</mixed-citation>
</ref>
<ref id="B46">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Langfelder</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Horvath</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>WGCNA: an R package for weighted correlation network analysis</article-title>. <source>BMC Bioinforma.</source> <volume>9</volume>, <fpage>559</fpage>. <pub-id pub-id-type="doi">10.1186/1471-2105-9-559</pub-id>
<pub-id pub-id-type="pmid">19114008</pub-id>
</mixed-citation>
</ref>
<ref id="B47">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Qu</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Microenvironment-driven satellite cell regeneration and repair in aging-related sarcopenia: mechanisms and therapeutic frontiers</article-title>. <source>Stem Cell Res. Ther.</source> <volume>16</volume>, <fpage>545</fpage>. <pub-id pub-id-type="doi">10.1186/s13287-025-04481-5</pub-id>
<pub-id pub-id-type="pmid">41057931</pub-id>
</mixed-citation>
</ref>
<ref id="B48">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Jing</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Yao</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Identification of key genes as diagnostic biomarkers for IBD using bioinformatics and machine learning</article-title>. <source>J. Transl. Med.</source> <volume>23</volume>, <fpage>738</fpage>. <pub-id pub-id-type="doi">10.1186/s12967-025-06531-1</pub-id>
<pub-id pub-id-type="pmid">40611294</pub-id>
</mixed-citation>
</ref>
<ref id="B49">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liang</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Nong</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Tao</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Fang</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Integration of multi-omics and machine learning strategies identifies immune related candidate biomarkers in inflammation-associated hypertrophic cardiomyopathy</article-title>. <source>Front. Immunol.</source> <volume>16</volume>, <fpage>1645382</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2025.1645382</pub-id>
<pub-id pub-id-type="pmid">41080564</pub-id>
</mixed-citation>
</ref>
<ref id="B50">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Unraveling diethyl phthalate-induced prostate carcinogenesis: core targets revealed by integrated network toxicology, machine learning, and structural validation</article-title>. <source>Hum. Genomics</source> <volume>19</volume>, <fpage>149</fpage>. <pub-id pub-id-type="doi">10.1186/s40246-025-00863-1</pub-id>
<pub-id pub-id-type="pmid">41444679</pub-id>
</mixed-citation>
</ref>
<ref id="B51">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lutz</surname>
<given-names>C. T.</given-names>
</name>
<name>
<surname>Quinn</surname>
<given-names>L. S.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Sarcopenia, obesity, and natural killer cell immune senescence in aging: altered cytokine levels as a common mechanism</article-title>. <source>Aging (Albany NY)</source> <volume>4</volume>, <fpage>535</fpage>&#x2013;<lpage>546</lpage>. <pub-id pub-id-type="doi">10.18632/aging.100482</pub-id>
<pub-id pub-id-type="pmid">22935594</pub-id>
</mixed-citation>
</ref>
<ref id="B52">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maimaiti</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Abulitifu</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ajimu</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Su</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>FOXO regulation of TXNIP induces ferroptosis in satellite cells by inhibiting glutathione metabolism, promoting Sarcopenia</article-title>. <source>Cell Mol. Life Sci.</source> <volume>82</volume>, <fpage>81</fpage>. <pub-id pub-id-type="doi">10.1007/s00018-025-05592-1</pub-id>
<pub-id pub-id-type="pmid">39982519</pub-id>
</mixed-citation>
</ref>
<ref id="B53">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Melov</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Tarnopolsky</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Beckman</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Felkey</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Hubbard</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Resistance exercise reverses aging in human skeletal muscle</article-title>. <source>PLoS One</source> <volume>2</volume>, <fpage>e465</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0000465</pub-id>
<pub-id pub-id-type="pmid">17520024</pub-id>
</mixed-citation>
</ref>
<ref id="B54">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Migliavacca</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Tay</surname>
<given-names>S. K. H.</given-names>
</name>
<name>
<surname>Patel</surname>
<given-names>H. P.</given-names>
</name>
<name>
<surname>Sonntag</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Civiletto</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Mcfarlane</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Mitochondrial oxidative capacity and NAD(&#x2b;) biosynthesis are reduced in human sarcopenia across ethnicities</article-title>. <source>Nat. Commun.</source> <volume>10</volume>, <fpage>5808</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-019-13694-1</pub-id>
<pub-id pub-id-type="pmid">31862890</pub-id>
</mixed-citation>
</ref>
<ref id="B55">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Milewska</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Przekop</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Szostak-W&#x119;gierek</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Chrzanowska</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Raciborski</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Traczyk</surname>
<given-names>I.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Prevalence of risk of Sarcopenia in Polish elderly Population&#x2014;A population Study</article-title>. <source>Nutrients</source> <volume>14</volume>, <fpage>3466</fpage>. <pub-id pub-id-type="doi">10.3390/nu14173466</pub-id>
<pub-id pub-id-type="pmid">36079726</pub-id>
</mixed-citation>
</ref>
<ref id="B56">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Niu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Cheuk</surname>
<given-names>Y. C.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Characterizing hub biomarkers for post-transplant renal fibrosis and unveiling their immunological functions through RNA sequencing and advanced machine learning techniques</article-title>. <source>J. Transl. Med.</source> <volume>22</volume>, <fpage>186</fpage>. <pub-id pub-id-type="doi">10.1186/s12967-024-04971-9</pub-id>
<pub-id pub-id-type="pmid">38378674</pub-id>
</mixed-citation>
</ref>
<ref id="B57">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Noy</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Between death and survival: retinoic acid in regulation of apoptosis</article-title>. <source>Annu. Rev. Nutr.</source> <volume>30</volume>, <fpage>201</fpage>&#x2013;<lpage>217</lpage>. <pub-id pub-id-type="doi">10.1146/annurev.nutr.28.061807.155509</pub-id>
<pub-id pub-id-type="pmid">20415582</pub-id>
</mixed-citation>
</ref>
<ref id="B58">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Papadopoulou</surname>
<given-names>S. K.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Sarcopenia: a contemporary health problem among older adult populations</article-title>. <source>Nutrients</source> <volume>12</volume>, <fpage>1293</fpage>. <pub-id pub-id-type="doi">10.3390/nu12051293</pub-id>
<pub-id pub-id-type="pmid">32370051</pub-id>
</mixed-citation>
</ref>
<ref id="B59">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Picca</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Coelho-Junior</surname>
<given-names>H. J.</given-names>
</name>
<name>
<surname>Calvani</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Marzetti</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Vetrano</surname>
<given-names>D. L.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Biomarkers shared by frailty and sarcopenia in older adults: a systematic review and meta-analysis</article-title>. <source>Ageing Res. Rev.</source> <volume>73</volume>, <fpage>101530</fpage>. <pub-id pub-id-type="doi">10.1016/j.arr.2021.101530</pub-id>
<pub-id pub-id-type="pmid">34839041</pub-id>
</mixed-citation>
</ref>
<ref id="B60">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Poliacikova</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Maurel-Zaffran</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Graba</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Saurin</surname>
<given-names>A. J.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Hox proteins in the regulation of muscle development</article-title>. <source>Front. Cell Dev. Biol.</source> <volume>9</volume>, <fpage>731996</fpage>. <pub-id pub-id-type="doi">10.3389/fcell.2021.731996</pub-id>
<pub-id pub-id-type="pmid">34733846</pub-id>
</mixed-citation>
</ref>
<ref id="B61">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Price</surname>
<given-names>P. A.</given-names>
</name>
<name>
<surname>Otsuka</surname>
<given-names>A. A.</given-names>
</name>
<name>
<surname>Poser</surname>
<given-names>J. W.</given-names>
</name>
<name>
<surname>Kristaponis</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Raman</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>1976</year>). <article-title>Characterization of a gamma-carboxyglutamic acid-containing protein from bone</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>73</volume>, <fpage>1447</fpage>&#x2013;<lpage>1451</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.73.5.1447</pub-id>
<pub-id pub-id-type="pmid">1064018</pub-id>
</mixed-citation>
</ref>
<ref id="B62">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sackett</surname>
<given-names>J. D.</given-names>
</name>
<name>
<surname>Kamble</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Leach</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Schuelke</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Wilbanks</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Rowe</surname>
<given-names>A. R.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Genome-Scale mutational analysis of cathode-oxidizing Thioclava electrotropha ElOx9(T)</article-title>. <source>Front. Microbiol.</source> <volume>13</volume>, <fpage>909824</fpage>. <pub-id pub-id-type="doi">10.3389/fmicb.2022.909824</pub-id>
<pub-id pub-id-type="pmid">35756027</pub-id>
</mixed-citation>
</ref>
<ref id="B63">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saini</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Mcphee</surname>
<given-names>J. S.</given-names>
</name>
<name>
<surname>Al-Dabbagh</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Stewart</surname>
<given-names>C. E.</given-names>
</name>
<name>
<surname>Al-Shanti</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Regenerative function of immune system: modulation of muscle stem cells</article-title>. <source>Ageing Res. Rev.</source> <volume>27</volume>, <fpage>67</fpage>&#x2013;<lpage>76</lpage>. <pub-id pub-id-type="doi">10.1016/j.arr.2016.03.006</pub-id>
<pub-id pub-id-type="pmid">27039885</pub-id>
</mixed-citation>
</ref>
<ref id="B64">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sakuma</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Hamada</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Yamaguchi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Aoi</surname>
<given-names>W.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Current nutritional and pharmacological approaches for attenuating sarcopenia</article-title>. <source>Cells</source> <volume>12</volume>, <fpage>2422</fpage>. <pub-id pub-id-type="doi">10.3390/cells12192422</pub-id>
<pub-id pub-id-type="pmid">37830636</pub-id>
</mixed-citation>
</ref>
<ref id="B65">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sato</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Vatic</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Peixoto Da Fonseca</surname>
<given-names>G. W.</given-names>
</name>
<name>
<surname>Anker</surname>
<given-names>S. D.</given-names>
</name>
<name>
<surname>Von Haehling</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Biological basis and treatment of frailty and sarcopenia</article-title>. <source>Cardiovasc. Res.</source> <volume>120</volume>, <fpage>982</fpage>&#x2013;<lpage>998</lpage>. <pub-id pub-id-type="doi">10.1093/cvr/cvae073</pub-id>
<pub-id pub-id-type="pmid">38828887</pub-id>
</mixed-citation>
</ref>
<ref id="B66">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sayer</surname>
<given-names>A. A.</given-names>
</name>
<name>
<surname>Cooper</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Arai</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Cawthon</surname>
<given-names>P. M.</given-names>
</name>
<name>
<surname>Ntsama Essomba</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Fielding</surname>
<given-names>R. A.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Sarcopenia</article-title>. <source>Nat. Rev. Dis. Prim.</source> <volume>10</volume>, <fpage>68</fpage>. <pub-id pub-id-type="doi">10.1038/s41572-024-00550-w</pub-id>
<pub-id pub-id-type="pmid">39300120</pub-id>
</mixed-citation>
</ref>
<ref id="B67">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schweighofer</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Haudum</surname>
<given-names>C. W.</given-names>
</name>
<name>
<surname>Trummer</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Lind</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kolesnik</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Mursic</surname>
<given-names>I.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Dp-ucMGP as a biomarker in Sarcopenia</article-title>. <source>Nutrients</source> <volume>14</volume>, <fpage>5400</fpage>. <pub-id pub-id-type="doi">10.3390/nu14245400</pub-id>
<pub-id pub-id-type="pmid">36558558</pub-id>
</mixed-citation>
</ref>
<ref id="B68">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shen</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zong</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>N.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Characterizing the skeletal muscle immune microenvironment for sarcopenia: insights from transcriptome analysis and histological validation</article-title>. <source>Front. Immunol.</source> <volume>15</volume>, <fpage>1414387</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2024.1414387</pub-id>
<pub-id pub-id-type="pmid">39026669</pub-id>
</mixed-citation>
</ref>
<ref id="B69">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sokolova</surname>
<given-names>A. V.</given-names>
</name>
<name>
<surname>Dragunov</surname>
<given-names>D. O.</given-names>
</name>
<name>
<surname>Arutyunov</surname>
<given-names>G. P.</given-names>
</name>
</person-group> (<year>2026</year>). <article-title>Plasma short-chain fatty acids and cytokine profiles in chronic kidney disease: a potential pathophysiological link</article-title>. <source>Int. J. Mol. Sci.</source> <volume>27</volume>, <fpage>550</fpage>. <pub-id pub-id-type="doi">10.3390/ijms27010550</pub-id>
<pub-id pub-id-type="pmid">41516422</pub-id>
</mixed-citation>
</ref>
<ref id="B70">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Ji</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Vitamin a potentiates sheep myoblasts myogenic differentiation through BHLHE40-modulated ID3 expression</article-title>. <source>BMC Genomics</source> <volume>25</volume>, <fpage>244</fpage>. <pub-id pub-id-type="doi">10.1186/s12864-024-10161-0</pub-id>
<pub-id pub-id-type="pmid">38443816</pub-id>
</mixed-citation>
</ref>
<ref id="B71">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Lou</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Hidden pathway: the role of extracellular matrix in type 2 diabetes mellitus-related sarcopenia</article-title>. <source>Front. Endocrinol. (Lausanne)</source> <volume>16</volume>, <fpage>1560396</fpage>. <pub-id pub-id-type="doi">10.3389/fendo.2025.1560396</pub-id>
<pub-id pub-id-type="pmid">40309438</pub-id>
</mixed-citation>
</ref>
<ref id="B72">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Szklarczyk</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Gable</surname>
<given-names>A. L.</given-names>
</name>
<name>
<surname>Lyon</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Junge</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Wyder</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Huerta-Cepas</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets</article-title>. <source>Nucleic Acids Res.</source> <volume>47</volume>, <fpage>D607</fpage>&#x2013;<lpage>D613</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gky1131</pub-id>
<pub-id pub-id-type="pmid">30476243</pub-id>
</mixed-citation>
</ref>
<ref id="B73">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Takaya</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Aramaki-Hattori</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Sakai</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Okabe</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Asou</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kishi</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Effect of all-trans retinoic acid on Panniculus Carnosus Muscle regeneration in fetal mouse wound healing</article-title>. <source>Plast. Reconstr. Surg. Glob. Open</source> <volume>10</volume>, <fpage>e4533</fpage>. <pub-id pub-id-type="doi">10.1097/gox.0000000000004533</pub-id>
<pub-id pub-id-type="pmid">36187276</pub-id>
</mixed-citation>
</ref>
<ref id="B74">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Taketa</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Tamakoshi</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Hotta</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Maki</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Taguchi</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Takahashi</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Lymphatic capillarization in different fiber types of rat skeletal muscles with growth and Age</article-title>. <source>Microcirculation</source> <volume>31</volume>, <fpage>e12879</fpage>. <pub-id pub-id-type="doi">10.1111/micc.12879</pub-id>
<pub-id pub-id-type="pmid">39073171</pub-id>
</mixed-citation>
</ref>
<ref id="B75">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Van Long</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Chien</surname>
<given-names>P. N.</given-names>
</name>
<name>
<surname>Tung</surname>
<given-names>T. X.</given-names>
</name>
<name>
<surname>Van Anh</surname>
<given-names>L. T.</given-names>
</name>
<name>
<surname>Giang</surname>
<given-names>N. N.</given-names>
</name>
<name>
<surname>Nga</surname>
<given-names>P. T.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Complementary combination of biomarkers for diagnosis of sarcopenia in C57BL/6J mice</article-title>. <source>Life Sci.</source> <volume>312</volume>, <fpage>121213</fpage>. <pub-id pub-id-type="doi">10.1016/j.lfs.2022.121213</pub-id>
<pub-id pub-id-type="pmid">36423671</pub-id>
</mixed-citation>
</ref>
<ref id="B76">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Veronesi</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Salamanna</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Borsari</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Ruffilli</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Faldini</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Giavaresi</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Unlocking diagnosis of sarcopenia: the role of circulating biomarkers &#x2013; a clinical systematic review</article-title>. <source>Mech. Ageing Dev.</source> <volume>222</volume>, <fpage>112005</fpage>. <pub-id pub-id-type="doi">10.1016/j.mad.2024.112005</pub-id>
<pub-id pub-id-type="pmid">39521148</pub-id>
</mixed-citation>
</ref>
<ref id="B77">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vivier</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Rebuffet</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Narni-Mancinelli</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Cornen</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Igarashi</surname>
<given-names>R. Y.</given-names>
</name>
<name>
<surname>Fantin</surname>
<given-names>V. R.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Natural killer cell therapies</article-title>. <source>Nature</source> <volume>626</volume>, <fpage>727</fpage>&#x2013;<lpage>736</lpage>. <pub-id pub-id-type="doi">10.1038/s41586-023-06945-1</pub-id>
<pub-id pub-id-type="pmid">38383621</pub-id>
</mixed-citation>
</ref>
<ref id="B78">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wakabayashi</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Sakuma</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Comprehensive approach to sarcopenia treatment</article-title>. <source>Curr. Clin. Pharmacol.</source> <volume>9</volume>, <fpage>171</fpage>&#x2013;<lpage>180</lpage>. <pub-id pub-id-type="doi">10.2174/1574884708666131111192845</pub-id>
<pub-id pub-id-type="pmid">24219006</pub-id>
</mixed-citation>
</ref>
<ref id="B79">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wehling-Henricks</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Welc</surname>
<given-names>S. S.</given-names>
</name>
<name>
<surname>Fisher</surname>
<given-names>A. L.</given-names>
</name>
<name>
<surname>Zuo</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Tidball</surname>
<given-names>J. G.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Aging of the immune system causes reductions in muscle stem cell populations, promotes their shift to a fibrogenic phenotype, and modulates sarcopenia</article-title>. <source>Faseb J.</source> <volume>33</volume>, <fpage>1415</fpage>&#x2013;<lpage>1427</lpage>. <pub-id pub-id-type="doi">10.1096/fj.201800973R</pub-id>
<pub-id pub-id-type="pmid">30130434</pub-id>
</mixed-citation>
</ref>
<ref id="B80">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Qi</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Chronic kidney disease-induced muscle atrophy: molecular mechanisms and promising therapies</article-title>. <source>Biochem. Pharmacol.</source> <volume>208</volume>, <fpage>115407</fpage>. <pub-id pub-id-type="doi">10.1016/j.bcp.2022.115407</pub-id>
<pub-id pub-id-type="pmid">36596414</pub-id>
</mixed-citation>
</ref>
<ref id="B81">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Ling</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Integrative analysis identifies oxidative stress biomarkers in non-alcoholic fatty liver disease <italic>via</italic> machine learning and weighted gene co-expression network analysis</article-title>. <source>Front. Immunol.</source> <volume>15</volume>, <fpage>1335112</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2024.1335112</pub-id>
<pub-id pub-id-type="pmid">38476236</pub-id>
</mixed-citation>
</ref>
<ref id="B82">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wiedmer</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Jung</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Castro</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>Pomatto</surname>
<given-names>L. C. D.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>P. Y.</given-names>
</name>
<name>
<surname>Davies</surname>
<given-names>K. J. A.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Sarcopenia - molecular mechanisms and open questions</article-title>. <source>Ageing Res. Rev.</source> <volume>65</volume>, <fpage>101200</fpage>. <pub-id pub-id-type="doi">10.1016/j.arr.2020.101200</pub-id>
<pub-id pub-id-type="pmid">33130247</pub-id>
</mixed-citation>
</ref>
<ref id="B83">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wilson</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Jackson</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Sapey</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Lord</surname>
<given-names>J. M.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Frailty and sarcopenia: the potential role of an aged immune system</article-title>. <source>Ageing Res. Rev.</source> <volume>36</volume>, <fpage>1</fpage>&#x2013;<lpage>10</lpage>. <pub-id pub-id-type="doi">10.1016/j.arr.2017.01.006</pub-id>
<pub-id pub-id-type="pmid">28223244</pub-id>
</mixed-citation>
</ref>
<ref id="B84">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Ding</surname>
<given-names>P. A.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Sarcopenia: molecular regulatory network for loss of muscle mass and function</article-title>. <source>Front. Nutr.</source> <volume>10</volume>, <fpage>1037200</fpage>. <pub-id pub-id-type="doi">10.3389/fnut.2023.1037200</pub-id>
<pub-id pub-id-type="pmid">36819699</pub-id>
</mixed-citation>
</ref>
<ref id="B85">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>W.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Integrative multidimensional analysis of age-associated synthetic lethal genes and development of a prognostic model in breast cancer</article-title>. <source>Front. Immunol.</source> <volume>16</volume>, <fpage>1690301</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2025.1690301</pub-id>
<pub-id pub-id-type="pmid">41112293</pub-id>
</mixed-citation>
</ref>
<ref id="B86">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>An</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Exogenous nucleotides supplementation attenuates age-related sarcopenia</article-title>. <source>J. Cachexia Sarcopenia Muscle</source> <volume>16</volume>, <fpage>e70002</fpage>. <pub-id pub-id-type="doi">10.1002/jcsm.70002</pub-id>
<pub-id pub-id-type="pmid">40745399</pub-id>
</mixed-citation>
</ref>
<ref id="B87">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xie</surname>
<given-names>W. Q.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>D. J.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>Y. X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X. H.</given-names>
</name>
<name>
<surname>Lv</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Mouse models of sarcopenia: classification and evaluation</article-title>. <source>J. Cachexia Sarcopenia Muscle</source> <volume>12</volume>, <fpage>538</fpage>&#x2013;<lpage>554</lpage>. <pub-id pub-id-type="doi">10.1002/jcsm.12709</pub-id>
<pub-id pub-id-type="pmid">33951340</pub-id>
</mixed-citation>
</ref>
<ref id="B88">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xie</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zong</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Aging-Associated CD55<sup>&#x2b;</sup> fibroblasts promote chronic inflammation and ECM dysregulation in Sarcopenia</article-title>. <source>J. Inflamm. Res.</source> <volume>18</volume>, <fpage>16729</fpage>&#x2013;<lpage>16746</lpage>. <pub-id pub-id-type="doi">10.2147/jir.S542613</pub-id>
<pub-id pub-id-type="pmid">41341214</pub-id>
</mixed-citation>
</ref>
<ref id="B89">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Gong</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>W.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Multi-omics Mendelian randomization and single-cell analysis identify novel therapeutic targets for osteosarcopenia</article-title>. <source>J. Gerontol. A Biol. Sci. Med. Sci.</source> <volume>80</volume>, <fpage>glaf228</fpage>. <pub-id pub-id-type="doi">10.1093/gerona/glaf228</pub-id>
<pub-id pub-id-type="pmid">41071635</pub-id>
</mixed-citation>
</ref>
<ref id="B90">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yao</surname>
<given-names>X.-T.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>P.-P.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y.-Y.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>Z.-L.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>H.-T.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Wnt/&#x3b2;-Catenin promotes the osteoblastic potential of BMP9 through down-regulating Cyp26b1 in mesenchymal stem cells</article-title>. <source>Tissue Eng. Regen. Med.</source> <volume>20</volume>, <fpage>705</fpage>&#x2013;<lpage>723</lpage>. <pub-id pub-id-type="doi">10.1007/s13770-023-00526-z</pub-id>
<pub-id pub-id-type="pmid">37010733</pub-id>
</mixed-citation>
</ref>
<ref id="B91">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yuan</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Larsson</surname>
<given-names>S. C.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Epidemiology of sarcopenia: prevalence, risk factors, and consequences</article-title>. <source>Metabolism</source> <volume>144</volume>, <fpage>155533</fpage>. <pub-id pub-id-type="doi">10.1016/j.metabol.2023.155533</pub-id>
<pub-id pub-id-type="pmid">36907247</pub-id>
</mixed-citation>
</ref>
<ref id="B92">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Immune system and sarcopenia: presented relationship and future perspective</article-title>. <source>Exp. Gerontol.</source> <volume>164</volume>, <fpage>111823</fpage>. <pub-id pub-id-type="doi">10.1016/j.exger.2022.111823</pub-id>
<pub-id pub-id-type="pmid">35504482</pub-id>
</mixed-citation>
</ref>
<ref id="B93">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Peng</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Tong</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Vitamin A promotes the repair of mice skeletal muscle injury through RAR&#x3b1;</article-title>. <source>Nutrients</source> <volume>15</volume>, <fpage>3674</fpage>. <pub-id pub-id-type="doi">10.3390/nu15173674</pub-id>
<pub-id pub-id-type="pmid">37686706</pub-id>
</mixed-citation>
</ref>
<ref id="B94">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>TIGIT and SNRPA1 as novel diagnostic and predictive biomarkers in obstructive ventilatory dysfunction combined with pulmonary nontuberculous mycobacterial infection patients</article-title>. <source>Front. Cell Infect. Microbiol.</source> <volume>15</volume>, <fpage>1621129</fpage>. <pub-id pub-id-type="doi">10.3389/fcimb.2025.1621129</pub-id>
<pub-id pub-id-type="pmid">41104127</pub-id>
</mixed-citation>
</ref>
<ref id="B95">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Tao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Fu</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Tu</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Modulation of Wnt/&#x3b2;-Catenin signaling by STAT3 inhibition restores myogenic capacity in Sarcopenia</article-title>. <source>Int. J. Rheum. Dis.</source> <volume>28</volume>, <fpage>e70340</fpage>. <pub-id pub-id-type="doi">10.1111/1756-185x.70340</pub-id>
<pub-id pub-id-type="pmid">40590521</pub-id>
</mixed-citation>
</ref>
<ref id="B96">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Peng</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>A diagnostic model for sepsis using an integrated machine learning framework approach and its therapeutic drug discovery</article-title>. <source>BMC Infect. Dis.</source> <volume>25</volume>, <fpage>219</fpage>. <pub-id pub-id-type="doi">10.1186/s12879-025-10616-z</pub-id>
<pub-id pub-id-type="pmid">39953444</pub-id>
</mixed-citation>
</ref>
<ref id="B97">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Su</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Pang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Single-cell RNA sequencing dataset of hearts from wild type and Cyp26b1 knockout mouse embryos</article-title>. <source>Sci. Data</source> <volume>12</volume>, <fpage>1165</fpage>. <pub-id pub-id-type="doi">10.1038/s41597-025-05497-5</pub-id>
<pub-id pub-id-type="pmid">40634327</pub-id>
</mixed-citation>
</ref>
<ref id="B98">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Association between immune cells, inflammatory cytokines, and sarcopenia: insights from a Mendelian randomization analysis</article-title>. <source>Archives Gerontology Geriatrics</source> <volume>128</volume>, <fpage>105560</fpage>. <pub-id pub-id-type="doi">10.1016/j.archger.2024.105560</pub-id>
<pub-id pub-id-type="pmid">39213747</pub-id>
</mixed-citation>
</ref>
</ref-list>
<fn-group>
<fn fn-type="custom" custom-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2437219/overview">Veronica Castro Aceituno</ext-link>, City of Hope National Medical Center, United States</p>
</fn>
<fn fn-type="custom" custom-type="reviewed-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1748988/overview">Nitin Kamble</ext-link>, University of Cincinnati Medical Center, United States</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1822990/overview">Xinpei Deng</ext-link>, Sun Yat-sen University Cancer Center (SYSUCC), China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1217232/overview">Zugui Wu</ext-link>, The Third Affiliated Hospital of Yunnan University of Chinese Medicine, China</p>
</fn>
</fn-group>
</back>
</article>