<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" 'JATS-journalpublishing1-3-mathml3.dtd'>
<article article-type="research-article" dtd-version="1.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Mol. Biosci.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Molecular Biosciences</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Mol. Biosci.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">2296-889X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1733878</article-id>
<article-id pub-id-type="doi">10.3389/fmolb.2025.1733878</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Asparagine-related biomarkers and regulatory mechanisms in type 2 diabetes mellitus</article-title>
<alt-title alt-title-type="left-running-head">Xia et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fmolb.2025.1733878">10.3389/fmolb.2025.1733878</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Xia</surname>
<given-names>Jiayi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3258305"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Software" vocab-term-identifier="https://credit.niso.org/contributor-roles/software/">Software</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal Analysis</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Cai</surname>
<given-names>Tao</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Software" vocab-term-identifier="https://credit.niso.org/contributor-roles/software/">Software</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal Analysis</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Peiyin</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal Analysis</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Gan</surname>
<given-names>Lu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal Analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Cao</surname>
<given-names>Bo</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing &#x2013; review and editing</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Kong</surname>
<given-names>Mingming</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing &#x2013; review and editing</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
<institution>Department of Endocrinology, The First Affiliated Hospital of Guizhou University of Traditional Chinese Medicine</institution>, <city>Guiyang</city>, <state>Guizhou</state>, <country country="CN">China</country>
</aff>
<aff id="aff2">
<label>2</label>
<institution>Department of Colorectal and Anal Surgery, The First Affiliated Hospital of Guizhou University of Traditional Chinese Medicine</institution>, <city>Guiyang</city>, <state>Guizhou</state>, <country country="CN">China</country>
</aff>
<aff id="aff3">
<label>3</label>
<institution>Department of Endocrinology, The Second People&#x2019;s Hospital of Guizhou Provincial</institution>, <city>Guiyang</city>, <state>Guizhou</state>, <country country="CN">China</country>
</aff>
<aff id="aff4">
<label>4</label>
<institution>Outpatient Department, The 970th Hospital of PLA Joint Logistic Support Force</institution>, <city>Yantai</city>, <state>Shandong</state>, <country country="CN">China</country>
</aff>
<author-notes>
<corresp id="c001">
<label>&#x2a;</label>Correspondence: Bo Cao, <email xlink:href="mailto:Caobo39666@163.com">Caobo39666@163.com</email>; Mingming Kong, <email xlink:href="mailto:826168886@qq.com">826168886@qq.com</email>
</corresp>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2025-12-17">
<day>17</day>
<month>12</month>
<year>2025</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2025</year>
</pub-date>
<volume>12</volume>
<elocation-id>1733878</elocation-id>
<history>
<date date-type="received">
<day>28</day>
<month>10</month>
<year>2025</year>
</date>
<date date-type="rev-recd">
<day>24</day>
<month>11</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>01</day>
<month>12</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Xia, Cai, Chen, Gan, Cao and Kong.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Xia, Cai, Chen, Gan, Cao and Kong</copyright-holder>
<license>
<ali:license_ref start_date="2025-12-17">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>Type 2 diabetes mellitus (T2DM) is a complex metabolic disorder. Emerging evidence suggests asparagine metabolism might play a pivotal role in T2DM, yet the underlying molecular mechanisms remain elusive. This study aimed to detect asparagine-related biomarkers and expound their functional roles in T2DM pathogenesis.</p>
</sec>
<sec>
<title>Methods</title>
<p>Transcriptomic datasets from peripheral blood samples of T2DM patients and controls were analyzed. Differential expression analysis, protein-protein interaction (PPI) network, and machine learning algorithms, followed by expression analysis across cohorts were employed to screen biomarkers. Biomarker diagnostic performance was evaluated. Functional enrichment, immune infiltration analysis, and multi-layer regulatory network construction were conducted. Drug-target interactions and molecular docking were explored to identify potential therapeutics.</p>
</sec>
<sec>
<title>Results</title>
<p>A total of 90 candidate genes were detected. Four feature genes were screened via multi-algorithm integration. Protein phosphatase 1 catalytic subunit alpha (PPP1CA) and cathepsin D (CTSD) were validated as biomarkers, showing significant upregulation in T2DM samples and high diagnostic accuracy (AUC of PPP1CA &#x3d; 0.969 and CTSD &#x3d; 0.984 in the training cohort, AUC of PPP1CA &#x3d; 0.806 and CTSD &#x3d; 0.875 in the validation cohort, respectively). Functional enrichment highlighted distinct yet complementary functional roles of PPP1CA and CTSD in T2DM progression. Immune infiltration revealed elevated activated dendritic cells, mast cells, and myeloid-derived suppressor cells in T2DM samples, with PPP1CA and CTSD correlating significantly with these cell types. Regulatory networks identified shared transcription factors and miRNAs targeting both genes. Pharmacological screening prioritized norcantharidin and naringenin as high-affinity compounds targeting these biomarkers.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>This study identified PPP1CA and CTSD as asparagine-related biomarkers driving immune-metabolic crosstalk in T2DM. The pr&#xed;icted regulatory networks and therapeutic compounds provided novel insights into T2DM mechanisms and potential intervention strategies.</p>
</sec>
</abstract>
<kwd-group>
<kwd>type 2 diabetes mellitus</kwd>
<kwd>asparagine</kwd>
<kwd>protein phosphatase 1 catalytic subunit alpha</kwd>
<kwd>cathepsin D</kwd>
<kwd>immune infiltration</kwd>
</kwd-group>
<funding-group>
<funding-statement>The author(s) declared that financial support was not received for this work and/or its publication.</funding-statement>
</funding-group>
<counts>
<fig-count count="6"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="57"/>
<page-count count="14"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Molecular Diagnostics and Therapeutics</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="s1">
<title>Introduction</title>
<p>Type 2 diabetes mellitus (T2DM) represents one of the most problematic health issues worldwide in the 21st century. This complex, multisystemic metabolic disorder is characterized by chronic hyperglycemia resulting from a progressive defect in insulin secretion or tissue resistance to insulin (<xref ref-type="bibr" rid="B33">M&#x142;ynarska et al., 2025</xref>; <xref ref-type="bibr" rid="B2">Adiga et al., 2021</xref>). Globally, an estimated 462 million individuals are affected by T2DM, corresponding to 6.28% of the world&#x2019;s population (<xref ref-type="bibr" rid="B26">Khan et al., 2020</xref>). Between 1990 and 2022, the age-standardized prevalence of T2DM rose in 131 countries for women and in 155 countries for men, with a posterior probability exceeding 0.80. The most significant increases occurred in low- and middle-income nations across Southeast Asia, South Asia, the Middle East, North Africa, and Latin America Caribbean (<xref ref-type="bibr" rid="B34">NCD Risk Factor Collaboration, 2024</xref>). The pathogenesis of T2DM is primarily associated with insulin resistance (IR) and pancreatic &#x3b2;-cell dysfunction (<xref ref-type="bibr" rid="B33">M&#x142;ynarska et al., 2025</xref>). Under insulin-resistant conditions, the sensitivity of peripheral tissues&#x2014;such as skeletal muscle and adipose tissue&#x2014;to insulin is diminished, leading to impaired glucose metabolism. Pancreatic &#x3b2;-cell dysfunction, in turn, results in inadequate insulin secretion that fails to meet the body&#x2019;s metabolic demands, thereby inducing hyperglycemia (<xref ref-type="bibr" rid="B31">Lu et al., 2024</xref>). T2DM not only directly harms multiple organ systems but also worsens the risk and severity of cardiovascular diseases, renal failure, and related neuropathies, which severely diminish patients&#x2019; quality of life and shorten life expectancy (<xref ref-type="bibr" rid="B40">Pan et al., 2025</xref>). Therefore, in-depth investigation into the underlying pathogenic and molecular mechanisms of T2DM, along with the identification of molecular biomarkers and targeted therapeutic agents, is of paramount importance for improving the quality of life and prognosis of T2DM patients.</p>
<p>Asparagine is a crucial non-essential amino acids (AAs) that plays a pivotal role in protein synthesis and nitrogen metabolism. In recent years, the involvement of asparagine in metabolism-related diseases has garnered increasing scientific attention. Emerging evidence suggests a potential association between asparagine and T2DM (<xref ref-type="bibr" rid="B10">Chung et al., 2015</xref>; <xref ref-type="bibr" rid="B36">Newgard et al., 2009</xref>; <xref ref-type="bibr" rid="B49">Wang S. et al., 2022</xref>). In Sprague Dawley rats with T2DM, the metabolic pathway of aminoacyl-t-RNA biosynthesis was significantly upregulated. Meanwhile, AAs, including glycine, L-asparagine, and L-serine were also significantly increased in T2DM rats, which was prospectively associated with impaired insulin secretion and an increase in glucose levels (<xref ref-type="bibr" rid="B35">Ndlovu et al., 2023</xref>; <xref ref-type="bibr" rid="B50">Wang L. et al., 2022</xref>). In addition, the increased serum glutamic acid, lysine, phenylalanine, arginine, alanine, tyrosine, aspartic acid, in patients with T2DM were positively correlated with the metabolic disorder, such as fasting glucose, homeostasis model assessment of insulin resistance (HOMA-IR) (<xref ref-type="bibr" rid="B28">Lee et al., 2018</xref>). More notably, the ratio of asparagine to other AAs demonstrates greater predictive value for T2DM disease status and prognosis than individual AAs levels. When the ratio of asparagine and aspartate exceeds 1.5, the risk of T2DM significantly increases (OR &#x3d; 7.99, 95% CI: 5.50&#x2013;11.6), especially in females gender and by &#x3e;50 years of age (<xref ref-type="bibr" rid="B32">Luo et al., 2020</xref>). All available evidence indicated that abnormal asparagine, a robust biomarker in T2DM, contributed to IR and defects of insulin secretion, and deteriorated T2DM pathogenesis. However, the specific mechanistic role of asparagine in T2DM pathogenesis remains incompletely elucidated. Further investigation into the involvement of asparagine in T2DM development is essential for uncovering novel pathogenic mechanisms and identifying potential therapeutic targets.</p>
<p>This present study systematically identifies key biomarkers associated with asparagine metabolism and elucidates their functional roles, transcriptional and epigenetic regulatory networks in the pathogenesis of T2DM. We integrated multiple approaches, including transcriptomic data analysis, machine learning, and experimental validation. Additionally, potential therapeutic agents targeting these biomarkers were explored. Analysis of the workflow is presented in <xref ref-type="sec" rid="s12">Supplementary Figure S1</xref>. Our study provides novel molecular mechanisms insights into asparagine&#x2019;s involvement in T2DM, enriching the theoretical framework of diabetic etiology. Findings from this study hold promise for optimizing clinical management strategies and advancing novel therapeutics against T2DM.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and methods</title>
<sec id="s2-1">
<title>Ethics approval and consent to participate</title>
<p>This study was approved by the ethics committee of the First Affiliated Hospital of Guizhou University of Traditional Chinese Medicine (Number: KL2024-017). All participants provided written informed consent prior to the study. A total of 10 newly diagnosed patients with T2DM, aged 40&#x2013;65 years (mean age: 47.23 &#xb1; 7.41 years), and 10 healthy individuals, aged 40&#x2013;65 years (mean age: 47.23 &#xb1; 7.41 years), were included in this study. The diagnosis of T2DM was established based on the criteria set by the American Diabetes Association (<xref ref-type="bibr" rid="B15">ElSayed et al., 2023</xref>). Participants were recruited from individuals attending our hospital. Participants with acute or chronic inflammatory diseases, cardiovascular disease, uncontrolled hypertension, type 1 diabetes mellitus (T1DM), gestational diabetes, smoking habits, or alcohol consumption were excluded.</p>
</sec>
<sec id="s2-2">
<title>Real-time quantitative PCR for mRNA expression in peripheral blood mononuclear cells</title>
<p>Peripheral blood mononuclear cells (PBMCs) were isolated from heparinized whole blood samples immediately using Ficoll-Hypaque density-gradient centrifugation under sterile conditions as previously conducted (<xref ref-type="bibr" rid="B4">Arab Sadeghabadi et al., 2022</xref>). After washing the cells twice with phosphate-buffered saline, isolated PBMCs were suspended in RPMI 1640 medium. Then PBMCs were counted, 5 &#xd7; 10<sup>6</sup> cells/well plated in a 6-well plate containing RPMI 1640 supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin for 24 h. Total RNA (500 ng) was extracted from PBMCs with TRIzol reagent (Nordic Bioscience, Beijing, China) and reverse into cDNA (10 uL) by reverse transcription kit (TakaRa, PrimeScript&#x2122; RT Master Mix, Cat No: RR036Q). The primer sequences of the specific genes (PPP1CA and CTSD) are listed in <xref ref-type="table" rid="T1">Table 1</xref>. Real-time quantitative PCR (RT-qPCR) for these mRNAs was performed and analyzed using cDNA and SYBR Green PCR Master Mix (Nordic Bioscience, Beijing, China, dilution: 5X). RT-qPCR was performed on a 7,500 fast real-time PCR system (Applied Biosystems, Foster City, CA, United States). The relative amounts of mRNA were determined based on 2<sup>&#x2212;&#x394;&#x394;CT</sup> calculations with GAPDH as a control reference.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Primer sequences of RT-qPCR analyses for mRNA expression.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Genes</th>
<th align="left">ID</th>
<th align="left">Forward</th>
<th align="left">Reverse</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">PPP1CA</td>
<td align="left">5499</td>
<td align="left">ACTACGACCTTCTGCGACTAT</td>
<td align="left">AGTTCTCGGGGTACTTGATCTT</td>
</tr>
<tr>
<td align="left">CTSD</td>
<td align="left">1509</td>
<td align="left">ATTCAGGGCGAGTACATGATCC</td>
<td align="left">CGACACCTTGAGCGTGTAG</td>
</tr>
<tr>
<td align="left">GAPDH</td>
<td align="left">2597</td>
<td align="left">ACATCAAGAAGGTGGTGAAGCAG</td>
<td align="left">AAAGGTGGAGGAGTGGGTGTC</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-3">
<title>Data collection</title>
<p>Gene expression profiles for training cohort (GSE15932) were extracted from the Gene Expression Omnibus (GEO) database (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/geo/">https://www.ncbi.nlm.nih.gov/geo/</ext-link>) (GPL570 platform), which comprised peripheral blood samples from 8 T2DM patients and 8 controls. The GSE26168 dataset (GPL6883 platform), containing transcriptomic data from 9 T2DM patients and 8 healthy controls, was downloaded from the same database for external validation. A total of 1,519 asparagine-related genes (ARGs) were identified by merging two independent sources: 326 genes from Molecular Signatures Database (MSigDB, <ext-link ext-link-type="uri" xlink:href="https://www.gsea-msigdb.org/gsea/msigdb">https://www.gsea-msigdb.org/gsea/msigdb</ext-link>) and 1,322 genes from GeneCards (<ext-link ext-link-type="uri" xlink:href="https://www.genecards.org/">https://www.genecards.org/</ext-link>) with relevance scores &#x3e;6 (<xref ref-type="bibr" rid="B29">Li et al., 2024</xref>) (<xref ref-type="sec" rid="s12">Supplementary Table S1</xref>).</p>
</sec>
<sec id="s2-4">
<title>Differential expression analysis</title>
<p>Differentially expressed genes (DEGs) between T2DM samples and controls were identified from the training cohort (GSE15932) using the R package &#x201c;limma&#x201d; (v 3.54.0) (<xref ref-type="bibr" rid="B42">Ritchie et al., 2015</xref>) (&#x7c;log<sub>2</sub> fold change (FC)&#x7c; &#x3e;0.5, <italic>P</italic> &#x3c; 0.05). To visualize the distribution of DEGs, a volcano plot was created with &#x201c;ggplot2&#x201d; package (v 3.4.4) (<xref ref-type="bibr" rid="B21">Gustavsson et al., 2022</xref>). The top 10 upregulated/downregulated DEGs (ranked by &#x7c;log<sub>2</sub>FC&#x7c;) were labeled on the volcano plot. Additionally, a heatmap was constructed using the R package &#x201c;Complex Heatmap&#x201d; (v 2.14.0) (<xref ref-type="bibr" rid="B20">Gu et al., 2016</xref>) to display the expression patterns of these top 20 DEGs across all samples. To obtain candidate genes associated with both asparagine and T2DM pathogenesis, the intersection of DEGs and ARGs was implemented with &#x201c;Venn Diagram&#x201d; package (v 1.7.3).</p>
</sec>
<sec id="s2-5">
<title>Gene ontology (GO) and kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analyses</title>
<p>To shed light on the biological functions and signaling pathways associated with the candidate genes, GO and KEGG pathway enrichment analyses were executed with &#x201c;cluster Profiler&#x201d; package (v 4.7.1.003) (<xref ref-type="bibr" rid="B52">Wu et al., 2021</xref>). The GO analysis categorized gene functions into biological process (BP), cellular component (CC), and molecular function (MF). KEGG pathway analysis was conducted to detect metabolic and signal transduction pathways linked to the candidate genes. For both analyses, a significance threshold of adjusted <italic>P</italic> &#x3c; 0.05 was implemented. Enrichment results were ranked by adjusted p-values in ascending order, and the top 5 most significant terms from each category were obtained for visualization.</p>
</sec>
<sec id="s2-6">
<title>Protein-protein interaction (PPI) network</title>
<p>PPI network for the candidate genes was analyzed based on STRING database (<ext-link ext-link-type="uri" xlink:href="https://string-db.org/">https://string-db.org/</ext-link>) (confidence score &#x3e;0.4). The resulting interaction data were visualized with Cytoscape (v 3.9.1). To identify candidate feature genes within the PPI network, four topological algorithms from the Cytoscape plugin &#x201c;Cytohubba&#x201d;&#x2014;Maximum Clique Centrality (MCC), Edge Percolated Component (EPC), Closeness, and Betweenness&#x2014;were applied. Genes with weights above the median threshold (i.e., exceeding the median value for MCC, EPC, Closeness, and Betweenness scores) were retained. The shared genes identified by all four algorithms were determined as candidate feature genes using the R package &#x201c;ggvenn&#x201d; (v 0.1.9) (<xref ref-type="bibr" rid="B17">Gao et al., 2021</xref>).</p>
</sec>
<sec id="s2-7">
<title>Machine learning</title>
<p>To detect feature genes associated with asparagine in T2DM, the Boruta algorithm was implemented using the R package &#x201c;Boruta&#x201d; (v 8.0.0) (<xref ref-type="bibr" rid="B56">Zhou et al., 2023</xref>). The training cohort (GSE15932) was subjected to iterative feature importance analysis with a significance threshold of p &#x3d; 0.001 and a maximum iteration parameter of maxRuns &#x3d; 100. Genes classified as &#x201c;Confirmed&#x201d; by the Boruta algorithm&#x2014;indicating statistically significant importance in distinguishing T2DM from controls&#x2014;were retained for downstream analysis. A random forest classifier was constructed using &#x201c;random Forest&#x201d; package (v 4.7.1.1) (<xref ref-type="bibr" rid="B3">Alderden et al., 2018</xref>) to further refine feature selection. The model utilized 5-fold cross-validation, with the out-of-bag (OOB) error rate serving as the performance metric to determine the optimal number of decision trees (ntree). The ntree value corresponding to the lowest OOB error rate was selected to finalize the model. Genes ranked in the top 50% of mean decrease Gini importance scores were defined as feature genes. Support Vector Machine Recursive Feature Elimination (SVM-RFE) was executed employing &#x201c;caret&#x201d; package (v 6.0-93). The algorithm iteratively removed the least important features from the candidate gene set based on linear kernel SVM weights. A 5-fold cross-validation strategy was applied to evaluate classification accuracy, and the gene subset achieving the lowest error rate was identified. The overlapping genes across all three machine learning methods were defined as feature genes.</p>
</sec>
<sec id="s2-8">
<title>Expression analysis</title>
<p>To validate the expression consistency of feature genes across cohorts, Wilcoxon rank-sum tests were performed separately in the training cohort (GSE15932) and validation cohort (GSE26168). Genes exhibiting statistically significant differential expression in both cohorts (<italic>P</italic> &#x3c; 0.05), with consistent trends between T2DM and controls, were defined as biomarkers. To assess the diagnostic potential of these biomarkers, receiver operating characteristic (ROC) curves were generated. The area under the curve (AUC) was calculated to evaluate discriminatory ability between T2DM samples and controls, with AUC values interpreted as follows: AUC &#x3e;0.7 indicated strong discriminatory potential. The ROC analysis was performed using the R package &#x201c;pROC&#x201d; (v 1.18.0).</p>
</sec>
<sec id="s2-9">
<title>Gene set enrichment analysis (GSEA)</title>
<p>To delve into biological pathways associated with the biomarker in T2DM, GSEA was implemented with R &#x201c;clusterProfiler&#x201d; package (v 4.7.1.003) (&#x7c;normalized enrichment score (NES)&#x7c; &#x3e;1, adjusted <italic>P</italic> &#x3c; 0.05). Spearman correlation coefficients (cor) between the identified biomarkers and all other genes in the training cohort (GSE15932) were calculated with &#x201c;psych&#x201d; package (v 2.1.6). Genes were ordered by the cor values. The reference gene set (h.all.v2024.1.Hs.symbols.gmt) was acquired from the MSigDB.</p>
</sec>
<sec id="s2-10">
<title>Immune infiltration analysis</title>
<p>To quantify the infiltration levels of 28 immune cell types in peripheral blood samples from training cohort (GSE15932) (<xref ref-type="bibr" rid="B54">Zhang Y. et al., 2023</xref>), ssGSEA was executed employing &#x201c;GSVA&#x201d; package (v 1.46.0) (<xref ref-type="bibr" rid="B22">H&#xe4;nzelmann et al., 2013</xref>). A heatmap depicting immune cell infiltration scores across T2DM samples and controls was generated with &#x201c;pheatmap&#x201d; package (v 1.0.12). Wilcoxon tests were used to contrast immune cell enrichment scores between T2DM samples and controls. Immune cell types with adjusted <italic>P</italic> &#x3c; 0.05 were defined as differentially infiltrated immune cells. Boxplots visualizing these differences were constructed with &#x201c;ggplot2&#x201d; package (v 3.4.4). Cor values between differentially infiltrated immune cells were calculated (&#x7c;cor&#x7c; &#x3e;0.3, <italic>P</italic> &#x3c; 0.05). A correlation heatmap was created with &#x201c;ggcorrplot&#x201d; package (v 0.1.4). Spearman correlation analysis was executed using &#x201c;psych&#x201d; package (v 2.1.6) to assess relationships between differentially infiltrated immune cells and biomarkers. Cor values and p-values were calculated (&#x7c;cor&#x7c; &#x3e;0.3, <italic>P</italic> &#x3c; 0.05).</p>
</sec>
<sec id="s2-11">
<title>Subcellular localization prediction of biomarkers</title>
<p>Protein sequences corresponding to the identified biomarkers were acquired from the National Center for Biotechnology Information (NCBI) database (<ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/">https://www.ncbi.nlm.nih.gov/</ext-link>). The subcellular localization of biomarker-associated mRNAs was predicted based on mRNALocater (<ext-link ext-link-type="uri" xlink:href="http://bio-bigdata.cn/mRNALocater/">http://bio-bigdata.cn/mRNALocater/</ext-link>), a machine learning-based database specialized in eukaryotic mRNA localization. The distribution of predicted subcellular localizations was visualized with &#x201c;ggplot2&#x201d; package (v 3.4.4).</p>
</sec>
<sec id="s2-12">
<title>GeneMANIA network construction</title>
<p>Functional associations between the identified biomarkers and other genes were analyzed based on the GeneMANIA database (<ext-link ext-link-type="uri" xlink:href="https://genemania.org/">https://genemania.org/</ext-link>), which integrates heterogeneous genomic and proteomic data, including protein-protein interactions, co-expression networks, genetic interactions, and pathway associations. Biomarkers were uploaded to GeneMANIA, and the 20 genes with the highest functional similarity scores (based on weighted interaction evidence) were selected. Enriched pathways and biological functions associated with the biomarker-top 20 gene network were identified (p &#x3c; 0.05, false discovery rate (FDR) &#x3c;0.05). The top 7 most significant pathways and functions were retained for visualization.</p>
</sec>
<sec id="s2-13">
<title>Regulation network analysis</title>
<p>Transcription factors (TFs) regulating the identified biomarkers were retrieved from ChIPBase database (<ext-link ext-link-type="uri" xlink:href="http://rna.sysu.edu.cn/chipbase/">http://rna.sysu.edu.cn/chipbase/</ext-link>). In addition, microRNA (miRNA) targeting the biomarkers was predicted using MicroCosm database (<ext-link ext-link-type="uri" xlink:href="https://tools4mirs.org/software/mirna_databases/microcosm-targets/">https://tools4mirs.org/software/mirna_databases/microcosm-targets/</ext-link>). Subsequently, long non-coding RNAs (lncRNAs) regulating identified miRNAs were predicted employing ENCORI database (<ext-link ext-link-type="uri" xlink:href="https://rnasysu.com/encori/">https://rnasysu.com/encori/</ext-link>). Interactions with a number of supporting CLIP-seq experiments (clipExpNum) &#x3e;20 were retained to ensure high-confidence lncRNA-miRNA pairs. A lncRNA-miRNA-mRNA regulatory network was created by integrating miRNA-mRNA and lncRNA-miRNA interaction pairs. The networks were visualized with Cytoscape software (v 3.9.1).</p>
</sec>
<sec id="s2-14">
<title>Drug prediction and molecular docking</title>
<p>Potential therapeutic compounds targeting the biomarkers were detected using Comparative Toxicogenomics Database (CTD, <ext-link ext-link-type="uri" xlink:href="https://ctdbase.org/">https://ctdbase.org/</ext-link>). Direct and indirect drug-target interactions were retrieved (combined score &#x3e;50). A network was constructed for visualization employing Cytoscape software (v 3.9.1). 3D structures of the top-ranked drugs (ranked by combined score) were downloaded in SDF format from NCBI PubChem Compound database (<ext-link ext-link-type="uri" xlink:href="https://pubchem.ncbi.nlm.nih.gov/">https://pubchem.ncbi.nlm.nih.gov/</ext-link>). Crystal structures of biomarker encoding proteins were obtained from UniProt database (<ext-link ext-link-type="uri" xlink:href="https://www.uniprot.org/">https://www.uniprot.org/</ext-link>) in PDB format. Molecular docking was performed using CB-Dock2 (<ext-link ext-link-type="uri" xlink:href="https://cadd.labshare.cn/cb-dock2/">https://cadd.labshare.cn/cb-dock2/</ext-link>). The optimal binding conformation of the protein and drug was visualized using PyMOL software (v 3.1) (<xref ref-type="bibr" rid="B44">Seeliger and de Groot, 2010</xref>).</p>
</sec>
<sec id="s2-15">
<title>Statistical analysis</title>
<p>Bioinformatics analyses were executed utilizing the R software (v 4.2.2). Comparative analysis of data from different groups was carried out using the Wilcoxon test (<italic>P</italic> &#x3c; 0.05).</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec id="s3-1">
<title>Asparagine-associated genes involved in T2DM pathogenesis</title>
<p>Transcriptome profiling revealed 1,093 DEGs between T2DM samples and controls (&#x7c;log<sub>2</sub>FC&#x7c; &#x3e;0.5, <italic>P</italic> &#x3c; 0.05), with 692 genes upregulated and 401 downregulated in T2DM samples (<xref ref-type="fig" rid="F1">Figures 1A,B</xref>). Intersection analysis of these DEGs with 1,519 ARGs identified 90 candidate genes potentially involved in T2DM pathogenesis (<xref ref-type="fig" rid="F1">Figure 1C</xref>). Functional annotation through GO enrichment analysis demonstrated significant associations across three categories. Candidate genes were predominantly enriched in some BP, such as glucose metabolic process, hexose metabolic process, and monosaccharide metabolic process (<xref ref-type="fig" rid="F1">Figure 1D</xref>). CC involved vesicle-related structures such as cytoplasmic vesicle lumen, endocytic vesicle lumen, and secretory granule lumen (<xref ref-type="fig" rid="F1">Figure 1E</xref>). For MF, candidate genes were significantly enriched in alpha-mannosidase activity, insulin receptor binding, and mannosidase activity (<xref ref-type="fig" rid="F1">Figure 1F</xref>; <xref ref-type="sec" rid="s12">Supplementary Table S2</xref>). KEGG pathway analysis identified 7 significantly enriched metabolic and disease pathways. Notably, the candidate genes were associated with Type II diabetes mellitus, diabetic cardiomyopathy, and Non&#x2212;alcoholic fatty liver disease (<xref ref-type="fig" rid="F1">Figure 1G</xref>; <xref ref-type="sec" rid="s12">Supplementary Table S3</xref>). These findings strongly indicate that the regulation of asparagine could play a pivotal role in orchestrating the progression of T2DM through specific candidate genes.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Identification of candidate genes associated with asparagine in T2DM pathogenesis. <bold>(A)</bold> Volcano plot of DEGs in GSE15932 (Top 10 marked); <bold>(B)</bold> Distribution of DEGs in T2DM and healthy control group; <bold>(C)</bold> Venn plot of DEGs and ARGs; <bold>(D)</bold> BP analysis of 90 candidate genes; <bold>(E)</bold> CC analysis of 90 candidate genes; <bold>(F)</bold> MF analysis of 90 candidate genes; <bold>(G)</bold> KEGG pathway enrichment of 90 candidate genes.</p>
</caption>
<graphic xlink:href="fmolb-12-1733878-g001.tif">
<alt-text content-type="machine-generated">A multi-panel scientific figure includes: A. A volcano plot showing gene expression changes; B. Heatmap distribution of gene expression data; C. Venn diagram comparing DEGs and ARGs; D. and E. Networks illustrating gene ontology terms related to metabolic processes and vesicle lumens; F. Network highlighting activities such as protease and receptor binding; G. KEGG pathway enrichment analysis charting pathways like Alzheimer's, diabetes, and apoptosis.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-2">
<title>Biomarkers associated with asparagine in T2DM</title>
<p>PPI network analysis of 80 candidate genes (excluding 10 outlier proteins) revealed 813 interaction pairs, with SOD2, TGFB1, and MMP9 exhibiting the highest connectivity (<xref ref-type="fig" rid="F2">Figure 2A</xref>). Subsequent integration of four algorithmic approaches identified 25 candidate feature genes (<xref ref-type="fig" rid="F2">Figure 2B</xref>). Boruta algorithm further refined this set to 16 robust features, including APOA1, BRCA1, CTSD, FECH, GFM1, HBB, IGFBP3, MAPK3, PKM, PPP1CA, SOD2, TGFB1, TIMP1, and TTR (<xref ref-type="fig" rid="F2">Figure 2C</xref>). Permutation feature importance with optimal ntree &#x3d; 6 (minimum error rate) prioritized 5 feature genes, including CTSD, G6PD, PKM, PPP1CA, and TIMP1 (<xref ref-type="fig" rid="F2">Figure 2D</xref>). The intersection of these three algorithmic outputs yielded 4 shared feature genes (PPP1CA, CTSD, PKM, TIMP1) (<xref ref-type="fig" rid="F2">Figure 2E</xref>). In the training cohort (GSE15932), all four feature genes exhibited significant upregulation in T2DM samples compared to controls (<italic>P</italic> &#x3c; 0.01). Subsequent validation in the independent cohort (GSE26168) revealed that PPP1CA and CTSD maintained consistent overexpression patterns in T2DM samples (<italic>P</italic> &#x3c; 0.05). In contrast, TIMP1 showed nonsignificant expression trends, while PKM was excluded from analysis due to its absence in the validation cohort (<xref ref-type="fig" rid="F2">Figure 2F</xref>). To further assess the discriminatory potential of PPP1CA and CTSD, ROC analysis was performed. In the training cohort (GSE15932), PPP1CA achieved an AUC of 0.969 and CTSD an AUC of 0.984, both exceeding the threshold of 0.9 indicative of strong diagnostic utility. In the validation cohort (GSE26168), PPP1CA achieved an AUC of 0.806 and CTSD an AUC of 0.875, where both genes again demonstrated AUC values &#x3e;0.8 (<xref ref-type="fig" rid="F2">Figure 2G</xref>). Then, mRNA expression of PPP1CA and CTSD was validated by RT-qPCR. Results indicated PPP1CA and CTSD were significantly upregulated in T2DM samples (<italic>P</italic> &#x3c; 0.001, <xref ref-type="fig" rid="F2">Figure 2H</xref>). These results establish PPP1CA and CTSD as robust biomarkers for T2DM.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Identification of biomarkers associated with asparagine in T2DM. <bold>(A)</bold> PPI network analysis of 80 candidate genes; <bold>(B)</bold> Subsequent integration of four algorithmic approaches (EPC, Closeness, betweenness, MCC) for candidate feature genes; <bold>(C)</bold> Boruta algorithm plot; <bold>(D)</bold> Permutation feature importance with optimal ntree &#x3d; 6 (minimum error rate); <bold>(E)</bold> 4 shared feature genes between three algorithmic outputs yielded; <bold>(F)</bold> Violin plot of PPP1CA, CTSD, PKM, TIMP1 expression; <bold>(G)</bold> ROC analysis of PPP1CA and CTSD in the training cohort (GSE15932) and the validation cohort (GSE26168); <bold>(H)</bold> Relative mRNA expression of PPP1CA and CTSD in the T2DM and the healthy control (n &#x3d; 10).</p>
</caption>
<graphic xlink:href="fmolb-12-1733878-g002.tif">
<alt-text content-type="machine-generated">(A) Gene network diagram with connected nodes. (B) Venn diagram showing gene overlap using EPC, Closeness, MCC, and Betweenness metrics. (C) Box plot ranking variable importance with colored decision categories. (D) Bar chart of gene importance with color-coded scale. (E) Venn diagram from SVM-RFE, RF, and Boruta methods showing gene selection overlaps. (F) Violin plots comparing gene expression between control and T2DM across datasets GSE15932 and GSE26168. (G) ROC curves for CTSD and PPP1CA with AUC values. (H) Bar graphs of relative mRNA expression for PPP1CA and CTSD in T2DM versus control.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-3">
<title>Functional pathway enrichment revealed distinct roles of PPP1CA and CTSD in T2DM pathogenesis</title>
<p>To elucidate the biological pathways associated with PPP1CA and CTSD, GSEA was systematically performed. PPP1CA demonstrated significant enrichment in 8 hallmark pathways (&#x7c;NES&#x7c; &#x3e;1, adjusted <italic>P</italic> &#x3c; 0.05), with prominent involvement in MYC targets V1, E2F targets, G2M checkpoint, and myogenesis (<xref ref-type="fig" rid="F3">Figure 3A</xref>; <xref ref-type="sec" rid="s12">Supplementary Table S4</xref>). For CTSD, significant pathway enrichment was observed in myogenesis, G2M checkpoint, E2F targets, MYC targets V1 (<xref ref-type="fig" rid="F3">Figure 3B</xref>; <xref ref-type="sec" rid="s12">Supplementary Table S5</xref>). These results collectively highlight distinct yet complementary functional roles of PPP1CA and CTSD in T2DM progression.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>GSEA of PPP1CA and CTSD in T2DM. <bold>(A)</bold> GSEA of PPP1CA in T2DM; <bold>(B)</bold> GSEA of CTSD in T2DM.</p>
</caption>
<graphic xlink:href="fmolb-12-1733878-g003.tif">
<alt-text content-type="machine-generated">Two line graphs, labeled A and B, display Running Enrichment Scores against Rank in Ordered Dataset for gene sets. Graph A for PPP1CA shows trends for Apical Junction, E2F Targets, G2M Checkpoint, MYC Targets V1, and Myogenesis. Graph B for CTSD highlights E2F Targets, G2M Checkpoint, Interferon Gamma Response, MYC Targets V1, and Myogenesis. Each graph includes a barcode plot for ranked lists and a metric profile.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-4">
<title>Immune microenvironment remodeling in T2DM progression</title>
<p>Immune infiltration analysis unveiled significant alterations in immune cell composition between T2DM samples and controls. Activated dendritic cells (DCs, <italic>P</italic> &#x3c; 0.01), mast cells (<italic>P</italic> &#x3c; 0.05), and myeloid-derived suppressor cells (MDSCs) (<italic>P</italic> &#x3c; 0.05) exhibited elevated infiltration levels in T2DM samples compared to controls, while immature DCs showed marked depletion (<italic>P</italic> &#x3c; 0.001, <xref ref-type="fig" rid="F4">Figures 4A,B</xref>). Correlation analysis demonstrated a strong positive association between mast cells and activated DCs (cor &#x3d; 0.49, <italic>P</italic> &#x3c; 0.05), whereas MDSCs inversely correlated with immature DCs (cor &#x3d; &#x2212;0.54, <italic>P</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F4">Figure 4C</xref>). Notably, PPP1CA and CTSD displayed distinct immunomodulatory associations. PPP1CA was negatively correlated with immature DCs infiltration (cor &#x3d; &#x2212;0.61, <italic>P</italic> &#x3c; 0.05) but positively correlated with activated DCs (cor &#x3d; 0.65, <italic>P</italic> &#x3c; 0.01) and MDSCs (cor &#x3d; 0.62, <italic>P</italic> &#x3c; 0.01). CTSD showed positive correlations with activated DCs (cor &#x3d; 0.58, <italic>P</italic> &#x3c; 0.05) and mast cells (cor &#x3d; 0.53, <italic>P</italic> &#x3c; 0.05), alongside a negative correlation with immature DCs (cor &#x3d; &#x2212;0.54, <italic>P</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F4">Figure 4D</xref>; <xref ref-type="sec" rid="s12">Supplementary Table S6</xref>). These findings collectively indicated systemic remodeling of the immune microenvironment in T2DM. The biomarker-immunocyte correlations suggested that PPP1CA and CTSD might orchestrate immune-metabolic crosstalk, potentially linking asparagine metabolism to T2DM progression.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>Immune microenvironment analysis of T2DM progression. <bold>(A)</bold> Hotmap of immune-infiltrating cells between T2DM and healthy control group; <bold>(B)</bold> ssGSEA of immune-infiltrating cells scores between T2DM and healthy control group; <bold>(C)</bold> Correlation analysis of immune-infiltrating cells; <bold>(D)</bold> Correlation analysis of immune-infiltrating cells with PPP1CA and CTSD.</p>
</caption>
<graphic xlink:href="fmolb-12-1733878-g004.tif">
<alt-text content-type="machine-generated">Panel A shows a heatmap of immune cell infiltration across control and T2DM groups with color gradients. Panel B features a box plot comparing ssGSEA scores for different immune cells between control and T2DM groups, indicating statistical significance. Panel C is a correlogram displaying correlations between different immune cells, with color intensity representing correlation strength. Panel D is a correlation plot for MDSC, mast cells, and dendritic cells, with lines indicating correlation coefficients for CTSD and PPP1CA genes.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-5">
<title>Subcellular localization and multi-layer regulatory networks revealed functional roles of PPP1CA and CTSD in T2DM</title>
<p>Subcellular localization analysis revealed distinct compartmentalization patterns for the biomarkers. CTSD exhibited balanced distribution across cytoplasmic matrix, extracellular space, nucleus, and plasma membrane, with moderate presence in lysosomes, endoplasmic reticulum, Golgi apparatus, endosomes, cytoskeleton, and mitochondria, and minimal peroxisomal localization. In contrast, PPP1CA demonstrated predominant localization in cytoplasmic matrix, nucleus, and plasma membrane, followed by extracellular space and endoplasmic reticulum (<xref ref-type="fig" rid="F5">Figure 5A</xref>). GeneMANIA network analysis revealed PPP1CA and CTSD primarily interacted with co-expressed genes through physical interactions, co-expression, predicted, and co-localization. Functional enrichment of these interaction partners demonstrated significant involvement in phosphatase-related processes, such as regulation of dephosphorylation, regulation of protein dephosphorylation, phosphatase regulator activity, protein dephosphorylation, protein serine/threonine phosphatase complex formation, protein phosphatase regulator activity, and phosphatase complex assembly (<xref ref-type="fig" rid="F5">Figure 5B</xref>). PPP1CA demonstrated binding capacity with 69 TFs, while CTSD interacted with 38 TFs. Notably, RUNX1T1, MYC, and IRF1 exhibited dual regulatory control over both PPP1CA and CTSD, suggesting potential shared transcriptional mechanisms in T2DM pathophysiology (<xref ref-type="fig" rid="F5">Figure 5C</xref>). MicroRNA interaction profiling identified 75 miRNA-mRNA regulatory pairs, with PPP1CA targeted by 39 miRNAs and CTSD by 36 miRNAs. The conserved miRNAs hsa-miR-885-3p, hsa-miR-675-5p, and hsa-miR-940 emerged as co-regulators of both biomarkers, indicating potential post-transcriptional coordination (<xref ref-type="fig" rid="F5">Figure 5D</xref>). Exploration of competing endogenous RNA networks revealed lncRNA-mediated regulatory axes. The lncRNA AL355075.4 was predicted to simultaneously regulate both PPP1CA and CTSD through competitive binding to hsa-miR-330-5p, forming the AL355075.4-hsa-miR-330-5p-PPP1CA and AL355075.4-hsa-miR-330-5p-CTSD regulatory axes (<xref ref-type="fig" rid="F5">Figure 5E</xref>). Collectively, these results delineated multi-layered regulatory networks governing PPP1CA and CTSD expression, encompassing transcriptional, post-transcriptional, and competing endogenous RNA-mediated mechanisms, which might critically influence T2DM pathogenesis.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>Subcellular localization and multi-layer regulatory network analysis of PPP1CA and CTSD in T2DM. <bold>(A)</bold> Subcellular localization of PPP1CA and CTSD; <bold>(B)</bold> GeneMANIA network analysis of PPP1CA and CTSD; <bold>(C)</bold> Transcriptional regulation analysis of PPP1CA and CTSD; <bold>(D)</bold> miRNA-mRNA network analysis of PPP1CA and CTSD; <bold>(E)</bold> lncRNAs networks of PPP1CA and CTSD.</p>
</caption>
<graphic xlink:href="fmolb-12-1733878-g005.tif">
<alt-text content-type="machine-generated">A set of scientific diagrams: Panel A shows a stacked bar chart of subcellular location proportions for genes CTSD and PPP1CA, using multiple color-coded categories. Panel B displays a network of interactions involving CTSD and PPP1CA with different colored lines representing various types of networks and functions. Panel C is a gene interaction network centered on CTSD and PPP1C with connected genes in green. Panel D illustrates a microRNA-gene interaction network with nodes representing microRNAs connected to CTSD and PPP1C. Panel E presents a combined interaction network involving long non-coding RNAs and microRNAs linked to CTSD and PPP1CA.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-6">
<title>Norcantharidin and naringenin are pharmacological modulators for PPP1CA and CTSD</title>
<p>To explore therapeutic candidates targeting the identified biomarkers, pharmacological profiling was performed. A total of 103 compounds were predicted to interact with PPP1CA and CTSD, with 72 compounds specifically targeting PPP1CA and 31 targeting CTSD. Among these, norcantharidin was identified as a specific ligand for PPP1CA, while naringenin exhibited exclusive targeting toward CTSD. Notably, sarin, benzo[a]pyrene, and hydrogen peroxide demonstrated dual targeting capabilities for both biomarkers (<xref ref-type="fig" rid="F6">Figure 6A</xref>). Molecular docking simulations were conducted to validate binding interactions between the biomarkers and their top-scoring ligands. PPP1CA showed the strongest affinity for norcantharidin, with a binding energy of &#x2212;6.2 kcal/mol (<xref ref-type="table" rid="T2">Table 2</xref>; <xref ref-type="fig" rid="F6">Figure 6B</xref>), with key interactions with pocket 2 (primarily involves residues on protein chain B, such as PRO24, TYR69, and ASP71). Similarly, CTSD exhibited optimal structural compatibility with naringenin, achieving a binding energy of &#x2212;7.4 kcal/mol (<xref ref-type="table" rid="T2">Table 2</xref>; <xref ref-type="fig" rid="F6">Figure 6C</xref>), with key interactions with pocket 1 (primarily involves residues on protein chains C and D, including TYR78, HIS77, ASP33, ILE124, PHE126). The favorable binding energies observed in molecular docking supported the therapeutic potential of these compounds as modulators of PPP1CA and CTSD activity in T2DM pathogenesis.</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>Pharmacological compounds analysis of PPP1CA and CTSD. <bold>(A)</bold> Pharmacological compounds network analysis for PPP1CA and CTSD; <bold>(B)</bold> Molecular docking of norcantharidin and PPP1CA; <bold>(C)</bold> Molecular docking of naringenin and CTSD.</p>
</caption>
<graphic xlink:href="fmolb-12-1733878-g006.tif">
<alt-text content-type="machine-generated">A: Network diagram showing interactions between proteins and compounds. PPP1CA and CTSD are central, connected to various compounds labeled in blue circles. B: Structure of PPP1CA with norcantharidin, highlighting active site interactions. C: Structure of CTSD with naringenin, showing binding sites in detail.</alt-text>
</graphic>
</fig>
<table-wrap id="T2" position="float">
<label>TABLE 2</label>
<caption>
<p>Binding energy of norcantharidin, naringenin to PPP1CA and CTSD.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="center">Target</th>
<th align="center">Compounds</th>
<th align="center">Binding affinity (kcal/mol)</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="center">PPP1CA</td>
<td align="center">Norcantharidin</td>
<td align="center">&#x2212;6.2</td>
</tr>
<tr>
<td align="center">CTSD</td>
<td align="center">Naringenin</td>
<td align="center">&#x2212;7.4</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>The underlying molecular mechanisms of T2DM remained elusive. Meanwhile, the functional roles of asparagine and its related biomarkers in T2DM pathogenesis were still unclear and had not been explored before. In this study, we successfully identified PPP1CA and CTSD as core biomarkers associated with asparagine in the pathogenesis of T2DM through the integration of transcriptome data and machine learning, and validated their significant upregulation in T2DM with high diagnostic accuracy. Furthermore, our study revealed the critical roles of PPP1CA and CTSD in glucose metabolism, insulin receptor binding, and immune function, with notable enrichment in E2F targets, G2M checkpoint, and myogenesis pathway. Additionally, we found substantial alterations in the immune cell composition of T2DM patients, including increased infiltration of activated DCs, mast cells, and MDSCs. We revealed that PPP1CA was negatively correlated with immature DCs infiltration but positively correlated with activated DCs and MDSCs. CTSD showed positive correlations with activated DCs and mast cells, alongside a negative correlation with immature DCs. Moreover, we constructed a multi-level regulatory network involving TFs, miRNAs, and lncRNAs, which elucidates the complex regulatory mechanisms governing PPP1CA and CTSD. Finally, we identified several compounds&#x2014;such as norcantharidin and naringenin&#x2014;with high binding affinity to PPP1CA and CTSD, providing valuable evidence for clinical treatment and drug development in T2DM.</p>
<p>We successfully identified PPP1CA and CTSD as core biomarkers associated with asparagine in T2DM pathogenesis and validated their critical roles in glucose metabolism, insulin receptor binding, and immune function. PPP1CA is one of the core catalytic subunits of protein phosphatase 1 (PP1), involved in regulating glycogen metabolism, muscle contractility, and protein synthesis (<xref ref-type="bibr" rid="B23">Hoermann et al., 2020</xref>). The role of PPP1CA in T2DM is primarily linked to the dephosphorylation of AKT (also known as protein kinase B, PKB) and AMPK, which leads to a suppression of their activity (<xref ref-type="bibr" rid="B24">Huang et al., 2024</xref>). The AKT/PKB signaling pathway has a very important role in insulin resistance, glucose intolerance and glucose transportation. The pivotal role of AKT signaling in systemic glucose homeostasis is unequivocally demonstrated. Previous study demonstrated that targeted deletion of AKT isoforms results in insulin resistance and glucose intolerance (<xref ref-type="bibr" rid="B9">Cho et al., 2001</xref>). Mutations of AKT have been identified in patients with severe insulin resistance (<xref ref-type="bibr" rid="B18">George et al., 2004</xref>). PP1 is a major phosphatase that dephosphorylates AKT. PP1 and AKT can form an interacting complex, negatively regulating AKT activation (<xref ref-type="bibr" rid="B53">Xiao et al., 2010</xref>). Therefore, the downregulation of AKT results in reduced glycogen synthesis in the liver, insulin resistance and glucose intolerance in T2DM. Furthermore, PPP1CA also interacts with CARM1 to limit the effects of AMPK on glucose metabolism, and thus participates in the regulation of metabolism and metabolic reprogramming (<xref ref-type="bibr" rid="B55">Zhang L. et al., 2023</xref>). CTSD is a member of the cathepsin superfamily lysosome, residing aspartic protease that plays an important role in maintaining tissue homeostasis and metabolism (<xref ref-type="bibr" rid="B5">Benes et al., 2008</xref>). It has also been reported to be involved in the pathogenesis of T2DM (<xref ref-type="bibr" rid="B13">Ding et al., 2020a</xref>). Previous study has indicated higher CTSD levels in patients with T2DM and severity of diabetic retinopathy (<xref ref-type="bibr" rid="B41">Reddy et al., 2017</xref>). CTSD has been implicated in the regulation of insulin-like growth factors (IGFs) bioavailability, a process strongly associated with the development of insulin resistance. Functioning as a key metabolic node, CTSD both responds to various metabolic signals and modulates glucose metabolism through insulin and IGF-dependent pathways (<xref ref-type="bibr" rid="B14">Ding et al., 2020b</xref>). A key finding from prior research is that the suppression of circulating CTSD activity results in decreased plasma insulin levels in rats (<xref ref-type="bibr" rid="B27">Khurana et al., 2019</xref>). Those results support that PPP1CA and CTSD are potential therapeutic targets for T2DM. Furthermore, the identified biomarkers associated with asparagine offer valuable support and breakthrough directions for early diagnosis, disease progression monitoring, and targeted therapeutic development for T2DM.</p>
<p>GSEA analysis revealed that the expression of both PPP1CA and CTSD is significantly associated with the E2F targets pathway. The E2F transcription factor family serves as a core regulator controlling the transition from the G1 to S phase of the cell cycle (<xref ref-type="bibr" rid="B38">Ohtani, 1999</xref>; <xref ref-type="bibr" rid="B7">Bogdanow et al., 2021</xref>). In mature pancreatic &#x3b2;-cells, E2F activity is tightly regulated to maintain insulin secretion (<xref ref-type="bibr" rid="B8">Bourouh et al., 2022</xref>). However, aberrant or sustained activation of the E2F pathway can force &#x3b2;-cells to exit quiescence and re-enter the replication cycle, leading to their functional de-differentiation. This is characterized by downregulation of insulin gene expression, loss of glucose sensitivity, and impaired expression of transcription factors (<xref ref-type="bibr" rid="B37">Oger et al., 2023</xref>). Obviously, excessive E2F activation not only fails to promote &#x3b2;-cell proliferation but also impairs their secretory function. PPP1CA may indirectly relieve Rb-mediated suppression of E2F by dephosphorylating and activating inhibitors of Rb, thereby promoting transcriptional activation of E2F target genes (<xref ref-type="bibr" rid="B6">Berndt et al., 1997</xref>; <xref ref-type="bibr" rid="B30">Liu et al., 2006</xref>). Conversely, deficiency of CTSD has been shown to impair cell cycle progression (<xref ref-type="bibr" rid="B43">Secomandi et al., 2022</xref>). Therefore, elevated CTSD expression may reflect its role in providing necessary proteolytic and signaling support to meet the high metabolic and replicative demands driven by E2F activation. Therefore, PPP1CA and CTSD may cooperatively disrupt cell cycle homeostasis in pancreatic &#x3b2;-cells through PPP1CA-mediated dephosphorylation of Rb-E2F pathway and CTSD-maintained essential metabolic environment mechanisms, inducing functional inactivation and dedifferentiation, and ultimately leading to defective insulin secretion.</p>
<p>Our results revealed substantial alterations in the immune cell landscape of patients with T2DM, characterized by elevated infiltration of activated DCs, mast cells, and MDSCs. We revealed that PPP1CA was negatively correlated with immature DCs infiltration but positively correlated with activated DCs and MDSCs. CTSD showed positive correlations with activated DCs and mast cells, alongside a negative correlation with immature DCs. DCs function as professional antigen-presenting cells with the dual capacity to instigate and suppress immune reactions, thereby serving as a crucial bridge between the innate and adaptive arms of the immune system. The maturation of immature DCs, which is induced by damage- or pathogen-associated molecular patterns, is defined by a marked upregulation of surface markers and the release of cytokines that are indispensable for the priming and activation of na&#xef;ve T lymphocytes, thereby catalyzing antigen-specific adaptive immune responses (<xref ref-type="bibr" rid="B47">Sundara Rajan and Longhi, 2016</xref>). In addition to this immunostimulatory role, DCs are instrumental in the establishment and maintenance of immunological tolerance. Given their ability to modulate the functions of both T cells and macrophages, DCs are considered pivotal in orchestrating the recruitment of other immune cells to sites of immune response. Chronic low-grade inflammation characterized by increased accumulation of immune cells, especially macrophages and T lymphocytes, in adipose tissue is one of the main mechanisms associated with IR and T2DM (<xref ref-type="bibr" rid="B16">Esser et al., 2014</xref>). A potential explanation for the increased accumulation of activated DCs in patients with T2DM may be driven by elevated pro-inflammatory cytokines (such as tumor necrosis factor-&#x3b1; [TNF-&#x3b1;], interleukin 6 [IL-6], interleukin 1&#x3b2; [IL-1&#x3b2;]) and adipose tissue inflammation (<xref ref-type="bibr" rid="B45">Soedono and Cho, 2021</xref>). Meanwhile, we revealed that the asparagine-associated biomarkers, PPP1CA and CTSD are positively correlated with activated DCs. This correlation is mechanistically linked to the pro-inflammatory cytokine production regulated by PPP1CA and CTSD (<xref ref-type="bibr" rid="B11">Clavarino et al., 2012</xref>; <xref ref-type="bibr" rid="B57">Zou et al., 2013</xref>). In addition, we found that MDSCs also increase in T2DM patients. MDSCs consist of a diverse group of immature myeloid cells that originate from the bone marrow and serve as essential immunosuppressive agents by suppressing T cell and other immune cell functions. The accumulation of MDSCs enhances insulin response; conversely, the depletion of MDSCs results in reduced glucose tolerance and IR (<xref ref-type="bibr" rid="B48">Wang et al., 2021</xref>). The accumulation of MDSCs in patients with T2DM is mechanistically linked to a milieu of chronic inflammation and its associated chemokines and cytokines. Chemokines and cytokines present in chronic inflammation can recruit MDSCs from peripheral circulation and bone marrow to the inflammation site, adipose tissue and visceral fat (<xref ref-type="bibr" rid="B19">Ghemi&#x15f; et al., 2024</xref>). Specifically, the recruitment of monocytic MDSC subsets are regulated by CC-chemokine ligand 2 (CCL2), whereas polymorphonuclear MDSCs are recruited by CCL5. This result is supported by clinical evidence, as the concentrations of both CCL2 and CCL5 have been reported to be significantly elevated in T2DM patients compared to healthy controls (<xref ref-type="bibr" rid="B39">Pan et al., 2021</xref>; <xref ref-type="bibr" rid="B51">Wu and Ma, 2024</xref>). These findings propose an integrated analysis wherein dysregulated metabolic pathways and chronic inflammation orchestrate a unique immune cell profile, featuring concurrent immune activation and suppression, which contributes to the immunometabolic dysfunction in T2DM.</p>
<p>Subcellular localization analysis revealed CTSD exhibited balanced distribution across cytoplasmic matrix, extracellular space, nucleus, and plasma membrane, aligns with its known multifunctional roles in proteolysis, autophagy, and signal transduction (<xref ref-type="bibr" rid="B12">Di et al., 2021</xref>; <xref ref-type="bibr" rid="B25">Jiang et al., 2025</xref>). This suggests that CTSD may influence metabolic and inflammatory pathways in T2DM at multiple aspects, potentially through degrading specific substrates or activating precursor molecules in distinct cellular compartments. In contrast, PPP1CA demonstrated predominant localization in cytoplasmic matrix, nucleus, and plasma membrane, consistent with its core function as a catalytic subunit of serine/threonine protein phosphatases. It regulates the activity of metabolism-related kinases such as AKT and AMPK in the cytoplasm, while potentially directly influencing gene expression programs in the nucleus by dephosphorylating transcription factors or histones (<xref ref-type="bibr" rid="B53">Xiao et al., 2010</xref>). GeneMANIA network analysis identified three TFs: RUNX1T1, MYC, and IRF1, capable of co-regulating PPP1CA and CTSD. Among them, MYC, a master regulator of metabolism and proliferation (<xref ref-type="bibr" rid="B1">Adiamah et al., 2025</xref>; <xref ref-type="bibr" rid="B46">Staal et al., 2016</xref>), may form a pathway linking hypermetabolism to immune-inflammatory activation by simultaneously activating the expression of PPP1CA and CTSD. At the post-transcriptional level, miRNAs such as hsa-miR-885-3p, hsa-miR-675-5p, and hsa-miR-940 act as shared negative regulators. Dysregulation of these miRNAs may lead to uncontrolled upregulation of PPP1CA and CTSD in T2DM.</p>
<p>Conclusively, this study identified PPP1CA and CTSD as asparagine-related biomarkers driving immune-metabolic crosstalk in T2DM, enhancing the understanding of the pathogenesis of asparagine metabolism in T2DM, which provided novel insights into T2DM mechanisms and potential intervention strategies. However, several limitations of this study should be noted. Firstly, the bioinformatics analysis was primarily based on public databases. Although preliminary experimental validation was conducted, the specific molecular mechanisms by which PPP1CA and CTSD influence immune cell infiltration and metabolic homeostasis need to be further elucidated through gene knockout/overexpression experiments in both cellular and animal models. Secondly, the multi-layer regulatory networks, including TFs, miRNA, lncRNA, and the efficacy of candidate drugs require further experimental validation. Future research could focus on validating the diagnostic value of PPP1CA and CTSD in larger clinical cohorts, dissecting their downstream signaling pathways in specific cell types such as &#x3b2;-cells and immune cells, and conducting preclinical studies to evaluate the efficacy and safety of targeted drug interventions, thereby facilitating their translation into clinical applications.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="sec" rid="s12">Supplementary Material</xref>.</p>
</sec>
<sec sec-type="ethics-statement" id="s6">
<title>Ethics statement</title>
<p>The studies involving humans were approved by the ethics committee of the First Affiliated Hospital of Guizhou University of Traditional Chinese Medicine (Number: KL2024-017). The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.</p>
</sec>
<sec sec-type="author-contributions" id="s7">
<title>Author contributions</title>
<p>JX: Data curation, Methodology, Software, Writing &#x2013; original draft, Visualization, Formal Analysis. TC: Data curation, Software, Writing &#x2013; original draft, Methodology, Formal Analysis. PC: Data curation, Writing &#x2013; original draft, Methodology, Formal Analysis. LG: Writing &#x2013; original draft, Formal Analysis, Data curation, Visualization, Methodology. BC: Writing &#x2013; original draft, Conceptualization, Project administration, Supervision, Writing &#x2013; review and editing. MK: Validation, Writing &#x2013; review and editing, Supervision, Conceptualization, Writing &#x2013; original draft.</p>
</sec>
<ack>
<title>Acknowledgements</title>
<p>Our greatest acknowledgment is to all the reviewers who participated in the review work and all our colleagues in this study for their hard work.</p>
</ack>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s10">
<title>Generative AI statement</title>
<p>The author(s) declared that generative AI was not used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec sec-type="disclaimer" id="s11">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec sec-type="supplementary-material" id="s12">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fmolb.2025.1733878/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fmolb.2025.1733878/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Table1.xls" id="SM1" mimetype="application/xls" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table2.xls" id="SM2" mimetype="application/xls" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table3.xls" id="SM3" mimetype="application/xls" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table6.xlsx" id="SM4" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table4.xlsx" id="SM5" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table5.xlsx" id="SM6" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Table7.xlsx" id="SM7" mimetype="application/xlsx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image1.pdf" id="SM8" mimetype="application/pdf" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<fn-group>
<fn fn-type="custom" custom-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/987464/overview">Xiaoyan Xing</ext-link>, Chinese Academy of Medical Sciences and Peking Union Medical College, China</p>
</fn>
<fn fn-type="custom" custom-type="reviewed-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/965971/overview">Zhuolun Sun</ext-link>, Ludwig Maximilian University of Munich, Germany</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1355785/overview">Fahui Liu</ext-link>, Xiamen University, China</p>
</fn>
</fn-group>
<ref-list>
<title>References</title>
<ref id="B1">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Adiamah</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Poole</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Lindsey</surname>
<given-names>J. C.</given-names>
</name>
<name>
<surname>Kohe</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Morcavallo</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Burt&#xe9;</surname>
<given-names>F.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>MYC-dependent upregulation of the <italic>de novo</italic> serine and glycine synthesis pathway is a targetable metabolic vulnerability in group 3 medulloblastoma</article-title>. <source>Neuro Oncol.</source> <volume>27</volume> (<issue>1</issue>), <fpage>237</fpage>&#x2013;<lpage>253</lpage>. <pub-id pub-id-type="doi">10.1093/neuonc/noae179</pub-id>
<pub-id pub-id-type="pmid">39377369</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Adiga</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>Banawalikar</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Mayur</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Bansal</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Ameera</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Rao</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Association of insulin resistance and leptin receptor gene polymorphism in type 2 diabetes mellitus</article-title>. <source>J. Chin. Med. Assoc.</source> <volume>84</volume> (<issue>4</issue>), <fpage>383</fpage>&#x2013;<lpage>388</lpage>. <pub-id pub-id-type="doi">10.1097/JCMA.0000000000000507</pub-id>
<pub-id pub-id-type="pmid">33660621</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alderden</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Pepper</surname>
<given-names>G. A.</given-names>
</name>
<name>
<surname>Wilson</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Whitney</surname>
<given-names>J. D.</given-names>
</name>
<name>
<surname>Richardson</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Butcher</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Predicting pressure injury in critical care patients: a machine-learning model</article-title>. <source>Am. J. Crit. Care</source> <volume>27</volume> (<issue>6</issue>), <fpage>461</fpage>&#x2013;<lpage>468</lpage>. <pub-id pub-id-type="doi">10.4037/ajcc2018525</pub-id>
<pub-id pub-id-type="pmid">30385537</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arab Sadeghabadi</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Abbasalipourkabir</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Mohseni</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Ziamajidi</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Chicoric acid does not restore palmitate-induced decrease in irisin levels in PBMCs of newly diagnosed patients with T2D and healthy subjects</article-title>. <source>Arch. Physiol. Biochem.</source> <volume>128</volume> (<issue>2</issue>), <fpage>532</fpage>&#x2013;<lpage>538</lpage>. <pub-id pub-id-type="doi">10.1080/13813455.2019.1702060</pub-id>
<pub-id pub-id-type="pmid">31855067</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Benes</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Vetvicka</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Fusek</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Cathepsin D--many functions of one aspartic protease</article-title>. <source>Crit. Rev. Oncol. Hematol.</source> <volume>68</volume> (<issue>1</issue>), <fpage>12</fpage>&#x2013;<lpage>28</lpage>. <pub-id pub-id-type="doi">10.1016/j.critrevonc.2008.02.008</pub-id>
<pub-id pub-id-type="pmid">18396408</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Berndt</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Dohadwala</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>C. W.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>Constitutively active protein phosphatase 1alpha causes Rb-dependent G1 arrest in human cancer cells</article-title>. <source>Curr. Biol.</source> <volume>7</volume> (<issue>6</issue>), <fpage>375</fpage>&#x2013;<lpage>386</lpage>. <pub-id pub-id-type="doi">10.1016/s0960-9822(06)00185-0</pub-id>
<pub-id pub-id-type="pmid">9197238</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bogdanow</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Phan</surname>
<given-names>Q. V.</given-names>
</name>
<name>
<surname>Wiebusch</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Emerging mechanisms of G(1)/S cell cycle control by human and mouse cytomegaloviruses</article-title>. <source>mBio</source> <volume>12</volume> (<issue>6</issue>), <fpage>e0293421</fpage>. <pub-id pub-id-type="doi">10.1128/mBio.02934-21</pub-id>
<pub-id pub-id-type="pmid">34903047</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bourouh</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Courty</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Rolland</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Pasquetti</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Gromada</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Rabhi</surname>
<given-names>N.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>The transcription factor E2F1 controls the GLP-1 receptor pathway in pancreatic &#x3b2; cells</article-title>. <source>Cell Rep.</source> <volume>40</volume> (<issue>6</issue>), <fpage>111170</fpage>. <pub-id pub-id-type="doi">10.1016/j.celrep.2022.111170</pub-id>
<pub-id pub-id-type="pmid">35947949</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cho</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Mu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>J. K.</given-names>
</name>
<name>
<surname>Thorvaldsen</surname>
<given-names>J. L.</given-names>
</name>
<name>
<surname>Chu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Crenshaw</surname>
<given-names>E. B.</given-names>
<suffix>3rd</suffix>
</name>
<etal/>
</person-group> (<year>2001</year>). <article-title>Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta)</article-title>. <source>Science</source> <volume>292</volume> (<issue>5522</issue>), <fpage>1728</fpage>&#x2013;<lpage>1731</lpage>. <pub-id pub-id-type="doi">10.1126/science.292.5522.1728</pub-id>
<pub-id pub-id-type="pmid">11387480</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chung</surname>
<given-names>S. T.</given-names>
</name>
<name>
<surname>Hsia</surname>
<given-names>D. S.</given-names>
</name>
<name>
<surname>Chacko</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Rodriguez</surname>
<given-names>L. M.</given-names>
</name>
<name>
<surname>Haymond</surname>
<given-names>M. W.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Increased gluconeogenesis in youth with newly diagnosed type 2 diabetes</article-title>. <source>Diabetologia</source> <volume>58</volume> (<issue>3</issue>), <fpage>596</fpage>&#x2013;<lpage>603</lpage>. <pub-id pub-id-type="doi">10.1007/s00125-014-3455-x</pub-id>
<pub-id pub-id-type="pmid">25447079</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Clavarino</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Cl&#xe1;udio</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Dalet</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Terawaki</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Couderc</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Chasson</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Protein phosphatase 1 subunit Ppp1r15a/GADD34 regulates cytokine production in polyinosinic:polycytidylic acid-stimulated dendritic cells</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>109</volume> (<issue>8</issue>), <fpage>3006</fpage>&#x2013;<lpage>3011</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.1104491109</pub-id>
<pub-id pub-id-type="pmid">22315398</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Di</surname>
<given-names>Y. Q.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>X. L.</given-names>
</name>
<name>
<surname>Kang</surname>
<given-names>X. L.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J. X.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Autophagy triggers CTSD (cathepsin D) maturation and localization inside cells to promote apoptosis</article-title>. <source>Autophagy</source> <volume>17</volume> (<issue>5</issue>), <fpage>1170</fpage>&#x2013;<lpage>1192</lpage>. <pub-id pub-id-type="doi">10.1080/15548627.2020.1752497</pub-id>
<pub-id pub-id-type="pmid">32324083</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ding</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Goossens</surname>
<given-names>G. H.</given-names>
</name>
<name>
<surname>Oligschlaeger</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Houben</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Blaak</surname>
<given-names>E. E.</given-names>
</name>
<name>
<surname>Shiri-Sverdlov</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2020a</year>). <article-title>Plasma cathepsin D activity is negatively associated with hepatic insulin sensitivity in overweight and obese humans</article-title>. <source>Diabetologia</source> <volume>63</volume> (<issue>2</issue>), <fpage>374</fpage>&#x2013;<lpage>384</lpage>. <pub-id pub-id-type="doi">10.1007/s00125-019-05025-2</pub-id>
<pub-id pub-id-type="pmid">31690989</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ding</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Houben</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Oligschlaeger</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Bitorina</surname>
<given-names>A. V.</given-names>
</name>
<name>
<surname>Verwer</surname>
<given-names>B. J.</given-names>
</name>
<name>
<surname>Tushuizen</surname>
<given-names>M. E.</given-names>
</name>
<etal/>
</person-group> (<year>2020b</year>). <article-title>Plasma cathepsin D activity rather than levels correlates with metabolic parameters of type 2 diabetes in Male individuals</article-title>. <source>Front. Endocrinol. (Lausanne)</source> <volume>11</volume>, <fpage>575070</fpage>. <pub-id pub-id-type="doi">10.3389/fendo.2020.575070</pub-id>
<pub-id pub-id-type="pmid">33101209</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>ElSayed</surname>
<given-names>N. A.</given-names>
</name>
<name>
<surname>Aleppo</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Aroda</surname>
<given-names>V. R.</given-names>
</name>
<name>
<surname>Bannuru</surname>
<given-names>R. R.</given-names>
</name>
<name>
<surname>Brown</surname>
<given-names>F. M.</given-names>
</name>
<name>
<surname>Bruemmer</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>2. Classification and diagnosis of diabetes: standards of care in diabetes-2023</article-title>. <source>Diabetes Care</source> <volume>46</volume> (<issue>Suppl. 1</issue>), <fpage>S19</fpage>&#x2013;<lpage>S40</lpage>. <pub-id pub-id-type="doi">10.2337/dc23-S002</pub-id>
<pub-id pub-id-type="pmid">36507649</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Esser</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Legrand-Poels</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Piette</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Scheen</surname>
<given-names>A. J.</given-names>
</name>
<name>
<surname>Paquot</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Inflammation as a link between obesity, metabolic syndrome and type 2 diabetes</article-title>. <source>Diabetes Res. Clin. Pract.</source> <volume>105</volume> (<issue>2</issue>), <fpage>141</fpage>&#x2013;<lpage>150</lpage>. <pub-id pub-id-type="doi">10.1016/j.diabres.2014.04.006</pub-id>
<pub-id pub-id-type="pmid">24798950</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>ggVennDiagram: an intuitive, easy-to-use, and highly customizable R package to generate venn diagram</article-title>. <source>Front. Genet.</source> <volume>12</volume>, <fpage>706907</fpage>. <pub-id pub-id-type="doi">10.3389/fgene.2021.706907</pub-id>
<pub-id pub-id-type="pmid">34557218</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>George</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Rochford</surname>
<given-names>J. J.</given-names>
</name>
<name>
<surname>Wolfrum</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Gray</surname>
<given-names>S. L.</given-names>
</name>
<name>
<surname>Schinner</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wilson</surname>
<given-names>J. C.</given-names>
</name>
<etal/>
</person-group> (<year>2004</year>). <article-title>A family with severe insulin resistance and diabetes due to a mutation in AKT2</article-title>. <source>Science</source> <volume>304</volume> (<issue>5675</issue>), <fpage>1325</fpage>&#x2013;<lpage>1328</lpage>. <pub-id pub-id-type="doi">10.1126/science.1096706</pub-id>
<pub-id pub-id-type="pmid">15166380</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ghemi&#x15f;</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Goriuc</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Minea</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Botnariu</surname>
<given-names>G. E.</given-names>
</name>
<name>
<surname>M&#xe2;r&#x21b;u</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>En&#x21b;uc</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Myeloid-derived suppressor cells (MDSCs) and obesity-induced inflammation in type 2 diabetes</article-title>. <source>Diagnostics (Basel)</source> <volume>14</volume> (<issue>21</issue>), <fpage>2453</fpage>. <pub-id pub-id-type="doi">10.3390/diagnostics14212453</pub-id>
<pub-id pub-id-type="pmid">39518420</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gu</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Eils</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Schlesner</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Complex heatmaps reveal patterns and correlations in multidimensional genomic data</article-title>. <source>Bioinformatics</source> <volume>32</volume> (<issue>18</issue>), <fpage>2847</fpage>&#x2013;<lpage>2849</lpage>. <pub-id pub-id-type="doi">10.1093/bioinformatics/btw313</pub-id>
<pub-id pub-id-type="pmid">27207943</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gustavsson</surname>
<given-names>E. K.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Reynolds</surname>
<given-names>R. H.</given-names>
</name>
<name>
<surname>Garcia-Ruiz</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Ryten</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Ggtranscript: an R package for the visualization and interpretation of transcript isoforms using ggplot2</article-title>. <source>Bioinformatics</source> <volume>38</volume> (<issue>15</issue>), <fpage>3844</fpage>&#x2013;<lpage>3846</lpage>. <pub-id pub-id-type="doi">10.1093/bioinformatics/btac409</pub-id>
<pub-id pub-id-type="pmid">35751589</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>H&#xe4;nzelmann</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Castelo</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Guinney</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>GSVA: gene set variation analysis for microarray and RNA-seq data</article-title>. <source>BMC Bioinforma.</source> <volume>14</volume>, <fpage>7</fpage>. <pub-id pub-id-type="doi">10.1186/1471-2105-14-7</pub-id>
<pub-id pub-id-type="pmid">23323831</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hoermann</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Kokot</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Helm</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Heinzlmeir</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Chojnacki</surname>
<given-names>J. E.</given-names>
</name>
<name>
<surname>Schubert</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Dissecting the sequence determinants for dephosphorylation by the catalytic subunits of phosphatases PP1 and PP2A</article-title>. <source>Nat. Commun.</source> <volume>11</volume> (<issue>1</issue>), <fpage>3583</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-020-17334-x</pub-id>
<pub-id pub-id-type="pmid">32681005</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Ren</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Pan</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>A novel peptide PDHK1-241aa encoded by circPDHK1 promotes ccRCC progression via interacting with PPP1CA to inhibit AKT dephosphorylation and activate the AKT-mTOR signaling pathway</article-title>. <source>Mol. Cancer</source> <volume>23</volume> (<issue>1</issue>), <fpage>34</fpage>. <pub-id pub-id-type="doi">10.1186/s12943-024-01940-0</pub-id>
<pub-id pub-id-type="pmid">38360682</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>F.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Cathepsin D promotes acute myeloid leukemia progression through stabilization of the anti-apoptotic proteins</article-title>. <source>Cell Death Dis.</source> <volume>16</volume> (<issue>1</issue>), <fpage>611</fpage>. <pub-id pub-id-type="doi">10.1038/s41419-025-07949-7</pub-id>
<pub-id pub-id-type="pmid">40796615</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khan</surname>
<given-names>M. A. B.</given-names>
</name>
<name>
<surname>Hashim</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>King</surname>
<given-names>J. K.</given-names>
</name>
<name>
<surname>Govender</surname>
<given-names>R. D.</given-names>
</name>
<name>
<surname>Mustafa</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Al Kaabi</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Epidemiology of type 2 diabetes - global burden of disease and forecasted trends</article-title>. <source>J. Epidemiol. Glob. Health</source> <volume>10</volume> (<issue>1</issue>), <fpage>107</fpage>&#x2013;<lpage>111</lpage>. <pub-id pub-id-type="doi">10.2991/jegh.k.191028.001</pub-id>
<pub-id pub-id-type="pmid">32175717</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khurana</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Yadati</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Goyal</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Dolas</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Houben</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Oligschlaeger</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Inhibiting extracellular cathepsin D reduces hepatic steatosis in sprague-dawley rats (&#x2020;)</article-title>. <source>Biomolecules</source> <volume>9</volume> (<issue>5</issue>), <fpage>171</fpage>. <pub-id pub-id-type="doi">10.3390/biom9050171</pub-id>
<pub-id pub-id-type="pmid">31060228</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname>
<given-names>S. G.</given-names>
</name>
<name>
<surname>Yim</surname>
<given-names>Y. S.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>B. W.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>H. S.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>K. S.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Fasting serum amino acids concentration is associated with insulin resistance and pro-inflammatory cytokines</article-title>. <source>Diabetes Res. Clin. Pract.</source> <volume>140</volume>, <fpage>107</fpage>&#x2013;<lpage>117</lpage>. <pub-id pub-id-type="doi">10.1016/j.diabres.2018.03.028</pub-id>
<pub-id pub-id-type="pmid">29601913</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Mao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Su</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Integrating machine learning and multi-omics analysis to develop an asparagine metabolism immunity index for improving clinical outcome and drug sensitivity in lung adenocarcinoma</article-title>. <source>Immunol. Res.</source> <volume>72</volume> (<issue>6</issue>), <fpage>1447</fpage>&#x2013;<lpage>1469</lpage>. <pub-id pub-id-type="doi">10.1007/s12026-024-09544-y</pub-id>
<pub-id pub-id-type="pmid">39320693</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>C. W.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>R. H.</given-names>
</name>
<name>
<surname>Berndt</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Protein phosphatase 1alpha activity prevents oncogenic transformation</article-title>. <source>Mol. Carcinog.</source> <volume>45</volume> (<issue>9</issue>), <fpage>648</fpage>&#x2013;<lpage>656</lpage>. <pub-id pub-id-type="doi">10.1002/mc.20191</pub-id>
<pub-id pub-id-type="pmid">16550609</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Pan</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Peng</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Type 2 diabetes mellitus in adults: pathogenesis, prevention and therapy</article-title>. <source>Signal Transduct. Target Ther.</source> <volume>9</volume> (<issue>1</issue>), <fpage>262</fpage>. <pub-id pub-id-type="doi">10.1038/s41392-024-01951-9</pub-id>
<pub-id pub-id-type="pmid">39353925</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luo</surname>
<given-names>H. H.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>X. F.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>X. L.</given-names>
</name>
<name>
<surname>Hou</surname>
<given-names>R. Q.</given-names>
</name>
<name>
<surname>Fang</surname>
<given-names>Z. Z.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Interactive effects of asparagine and aspartate homeostasis with sex and age for the risk of type 2 diabetes risk</article-title>. <source>Biol. Sex. Differ.</source> <volume>11</volume> (<issue>1</issue>), <fpage>58</fpage>. <pub-id pub-id-type="doi">10.1186/s13293-020-00328-1</pub-id>
<pub-id pub-id-type="pmid">33092635</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>M&#x142;ynarska</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Czarnik</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Dzie&#x17c;a</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>J&#x119;draszak</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Majchrowicz</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Prusinowski</surname>
<given-names>F.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Type 2 diabetes mellitus: new pathogenetic mechanisms, treatment and the most important complications</article-title>. <source>Int. J. Mol. Sci.</source> <volume>26</volume> (<issue>3</issue>), <fpage>1094</fpage>. <pub-id pub-id-type="doi">10.3390/ijms26031094</pub-id>
<pub-id pub-id-type="pmid">39940862</pub-id>
</mixed-citation>
</ref>
<ref id="B34">
<mixed-citation publication-type="journal">
<collab>NCD Risk Factor Collaboration</collab> (<year>2024</year>). <article-title>Worldwide trends in diabetes prevalence and treatment from 1990 to 2022: a pooled analysis of 1108 population-representative studies with 141 million participants</article-title>. <source>Lancet</source> <volume>404</volume> (<issue>10467</issue>), <fpage>2077</fpage>&#x2013;<lpage>2093</lpage>. <pub-id pub-id-type="doi">10.1016/S0140-6736(24)02317-1</pub-id>
<pub-id pub-id-type="pmid">39549716</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ndlovu</surname>
<given-names>I. S.</given-names>
</name>
<name>
<surname>Tshilwane</surname>
<given-names>S. I.</given-names>
</name>
<name>
<surname>Vosloo</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Chaisi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Mukaratirwa</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Metabolomics of type 2 diabetes mellitus in Sprague dawley Rats-In search of potential metabolic biomarkers</article-title>. <source>Int. J. Mol. Sci.</source> <volume>24</volume> (<issue>15</issue>), <fpage>12467</fpage>. <pub-id pub-id-type="doi">10.3390/ijms241512467</pub-id>
<pub-id pub-id-type="pmid">37569840</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Newgard</surname>
<given-names>C. B.</given-names>
</name>
<name>
<surname>An</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Bain</surname>
<given-names>J. R.</given-names>
</name>
<name>
<surname>Muehlbauer</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Stevens</surname>
<given-names>R. D.</given-names>
</name>
<name>
<surname>Lien</surname>
<given-names>L. F.</given-names>
</name>
<etal/>
</person-group> (<year>2009</year>). <article-title>A branched-chain amino acid-related metabolic signature that differentiates obese and lean humans and contributes to insulin resistance</article-title>. <source>Cell Metab.</source> <volume>9</volume> (<issue>4</issue>), <fpage>311</fpage>&#x2013;<lpage>326</lpage>. <pub-id pub-id-type="doi">10.1016/j.cmet.2009.02.002</pub-id>
<pub-id pub-id-type="pmid">19356713</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Oger</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Bourouh</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Friano</surname>
<given-names>M. E.</given-names>
</name>
<name>
<surname>Courty</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Rolland</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Gromada</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>&#x3b2;-Cell-specific E2f1 deficiency impairs glucose homeostasis, &#x3b2;-cell identity, and insulin secretion</article-title>. <source>Diabetes</source> <volume>72</volume> (<issue>8</issue>), <fpage>1112</fpage>&#x2013;<lpage>1126</lpage>. <pub-id pub-id-type="doi">10.2337/db22-0604</pub-id>
<pub-id pub-id-type="pmid">37216637</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ohtani</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Implication of transcription factor E2F in regulation of DNA replication</article-title>. <source>Front. Biosci.</source> <volume>4</volume>, <fpage>D793</fpage>&#x2013;<lpage>D804</lpage>. <pub-id pub-id-type="doi">10.2741/ohtani</pub-id>
<pub-id pub-id-type="pmid">10577392</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pan</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Kaminga</surname>
<given-names>A. C.</given-names>
</name>
<name>
<surname>Wen</surname>
<given-names>S. W.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Chemokines in prediabetes and type 2 diabetes: a meta-analysis</article-title>. <source>Front. Immunol.</source> <volume>12</volume>, <fpage>622438</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2021.622438</pub-id>
<pub-id pub-id-type="pmid">34054797</pub-id>
</mixed-citation>
</ref>
<ref id="B40">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pan</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Fang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>W.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Global burden of diabetes mellitus 1990-2021: epidemiological trends, geospatial disparities, and risk factor dynamics</article-title>. <source>Front. Endocrinol. (Lausanne)</source> <volume>16</volume>, <fpage>1596127</fpage>. <pub-id pub-id-type="doi">10.3389/fendo.2025.1596127</pub-id>
<pub-id pub-id-type="pmid">40666058</pub-id>
</mixed-citation>
</ref>
<ref id="B41">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Reddy</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Amutha</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Rajalakshmi</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Bhaskaran</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Monickaraj</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Rangasamy</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Association of increased levels of MCP-1 and cathepsin-D in young onset type 2 diabetes patients (T2DM-Y) with severity of diabetic retinopathy</article-title>. <source>J. Diabetes Complicat.</source> <volume>31</volume> (<issue>5</issue>), <fpage>804</fpage>&#x2013;<lpage>809</lpage>. <pub-id pub-id-type="doi">10.1016/j.jdiacomp.2017.02.017</pub-id>
<pub-id pub-id-type="pmid">28336215</pub-id>
</mixed-citation>
</ref>
<ref id="B42">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ritchie</surname>
<given-names>M. E.</given-names>
</name>
<name>
<surname>Phipson</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Law</surname>
<given-names>C. W.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>W.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>limma powers differential expression analyses for RNA-sequencing and microarray studies</article-title>. <source>Nucleic Acids Res.</source> <volume>43</volume> (<issue>7</issue>), <fpage>e47</fpage>. <pub-id pub-id-type="doi">10.1093/nar/gkv007</pub-id>
<pub-id pub-id-type="pmid">25605792</pub-id>
</mixed-citation>
</ref>
<ref id="B43">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Secomandi</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Salwa</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Vidoni</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Ferraresi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Follo</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Isidoro</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>High expression of the lysosomal protease cathepsin D confers better prognosis in neuroblastoma patients by contrasting EGF-induced neuroblastoma cell growth</article-title>. <source>Int. J. Mol. Sci.</source> <volume>23</volume> (<issue>9</issue>), <fpage>4782</fpage>. <pub-id pub-id-type="doi">10.3390/ijms23094782</pub-id>
<pub-id pub-id-type="pmid">35563171</pub-id>
</mixed-citation>
</ref>
<ref id="B44">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seeliger</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>de Groot</surname>
<given-names>B. L.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Ligand docking and binding site analysis with PyMOL and Autodock/Vina</article-title>. <source>J. Comput. Aided Mol. Des.</source> <volume>24</volume> (<issue>5</issue>), <fpage>417</fpage>&#x2013;<lpage>422</lpage>. <pub-id pub-id-type="doi">10.1007/s10822-010-9352-6</pub-id>
<pub-id pub-id-type="pmid">20401516</pub-id>
</mixed-citation>
</ref>
<ref id="B45">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Soedono</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Cho</surname>
<given-names>K. W.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Adipose tissue dendritic cells: critical regulators of obesity-induced inflammation and insulin resistance</article-title>. <source>Int. J. Mol. Sci.</source> <volume>22</volume> (<issue>16</issue>), <fpage>8666</fpage>. <pub-id pub-id-type="doi">10.3390/ijms22168666</pub-id>
<pub-id pub-id-type="pmid">34445379</pub-id>
</mixed-citation>
</ref>
<ref id="B46">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Staal</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Pei</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Rood</surname>
<given-names>B. R.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>A proteogenomic approach to understanding MYC function in metastatic medulloblastoma tumors</article-title>. <source>Int. J. Mol. Sci.</source> <volume>17</volume> (<issue>10</issue>), <fpage>1744</fpage>. <pub-id pub-id-type="doi">10.3390/ijms17101744</pub-id>
<pub-id pub-id-type="pmid">27775567</pub-id>
</mixed-citation>
</ref>
<ref id="B47">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sundara Rajan</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Longhi</surname>
<given-names>M. P.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Dendritic cells and adipose tissue</article-title>. <source>Immunology</source> <volume>149</volume> (<issue>4</issue>), <fpage>353</fpage>&#x2013;<lpage>361</lpage>. <pub-id pub-id-type="doi">10.1111/imm.12653</pub-id>
<pub-id pub-id-type="pmid">27479803</pub-id>
</mixed-citation>
</ref>
<ref id="B48">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Hou</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Dou</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Emerging roles of myeloid-derived suppressor cells in diabetes</article-title>. <source>Front. Pharmacol.</source> <volume>12</volume>, <fpage>798320</fpage>. <pub-id pub-id-type="doi">10.3389/fphar.2021.798320</pub-id>
<pub-id pub-id-type="pmid">34975496</pub-id>
</mixed-citation>
</ref>
<ref id="B49">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>X.</given-names>
</name>
<etal/>
</person-group> (<year>2022a</year>). <article-title>Amino acids, microbiota-related metabolites, and the risk of incident diabetes among normoglycemic Chinese adults: findings from the 4C study</article-title>. <source>Cell Rep. Med.</source> <volume>3</volume> (<issue>9</issue>), <fpage>100727</fpage>. <pub-id pub-id-type="doi">10.1016/j.xcrm.2022.100727</pub-id>
<pub-id pub-id-type="pmid">35998626</pub-id>
</mixed-citation>
</ref>
<ref id="B50">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Ren</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Jia</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2022b</year>). <article-title>Metabolomics analysis of stool in rats with type 2 diabetes mellitus after single-anastomosis duodenal-ileal bypass with sleeve gastrectomy</article-title>. <source>Front. Endocrinol. (Lausanne)</source> <volume>13</volume>, <fpage>1013959</fpage>. <pub-id pub-id-type="doi">10.3389/fendo.2022.1013959</pub-id>
<pub-id pub-id-type="pmid">36204098</pub-id>
</mixed-citation>
</ref>
<ref id="B51">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>CCL2-CCR2 signaling axis in obesity and metabolic diseases</article-title>. <source>J. Cell Physiol.</source> <volume>239</volume> (<issue>4</issue>), <fpage>e31192</fpage>. <pub-id pub-id-type="doi">10.1002/jcp.31192</pub-id>
<pub-id pub-id-type="pmid">38284280</pub-id>
</mixed-citation>
</ref>
<ref id="B52">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Dai</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>clusterProfiler 4.0: a universal enrichment tool for interpreting omics data</article-title>. <source>Innovation (Camb)</source> <volume>2</volume> (<issue>3</issue>), <fpage>100141</fpage>. <pub-id pub-id-type="doi">10.1016/j.xinn.2021.100141</pub-id>
<pub-id pub-id-type="pmid">34557778</pub-id>
</mixed-citation>
</ref>
<ref id="B53">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xiao</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Gong</surname>
<given-names>L. L.</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Deng</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Zeng</surname>
<given-names>X. M.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>L. L.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Protein phosphatase-1 regulates Akt1 signal transduction pathway to control gene expression, cell survival and differentiation</article-title>. <source>Cell Death Differ.</source> <volume>17</volume> (<issue>9</issue>), <fpage>1448</fpage>&#x2013;<lpage>1462</lpage>. <pub-id pub-id-type="doi">10.1038/cdd.2010.16</pub-id>
<pub-id pub-id-type="pmid">20186153</pub-id>
</mixed-citation>
</ref>
<ref id="B54">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Miao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Lei</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Q.</given-names>
</name>
</person-group> (<year>2023a</year>). <article-title>Identification of mitochondrial related signature associated with immune microenvironment in Alzheimer&#x27;s disease</article-title>. <source>J. Transl. Med.</source> <volume>21</volume> (<issue>1</issue>), <fpage>458</fpage>. <pub-id pub-id-type="doi">10.1186/s12967-023-04254-9</pub-id>
<pub-id pub-id-type="pmid">37434203</pub-id>
</mixed-citation>
</ref>
<ref id="B55">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Jiao</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>You</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2023b</year>). <article-title>Arginine methylation of PPP1CA by CARM1 regulates glucose metabolism and affects osteogenic differentiation and osteoclastic differentiation</article-title>. <source>Clin. Transl. Med.</source> <volume>13</volume> (<issue>9</issue>), <fpage>e1369</fpage>. <pub-id pub-id-type="doi">10.1002/ctm2.1369</pub-id>
<pub-id pub-id-type="pmid">37649137</pub-id>
</mixed-citation>
</ref>
<ref id="B56">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Xin</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>A diabetes prediction model based on Boruta feature selection and ensemble learning</article-title>. <source>BMC Bioinforma.</source> <volume>24</volume> (<issue>1</issue>), <fpage>224</fpage>. <pub-id pub-id-type="doi">10.1186/s12859-023-05300-5</pub-id>
<pub-id pub-id-type="pmid">37264332</pub-id>
</mixed-citation>
</ref>
<ref id="B57">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zou</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Kawai</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Tsuchida</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kozaki</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Tanaka</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Shin</surname>
<given-names>K. S.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Poly IC triggers a cathepsin D- and IPS-1-dependent pathway to enhance cytokine production and mediate dendritic cell necroptosis</article-title>. <source>Immunity</source> <volume>38</volume> (<issue>4</issue>), <fpage>717</fpage>&#x2013;<lpage>728</lpage>. <pub-id pub-id-type="doi">10.1016/j.immuni.2012.12.007</pub-id>
<pub-id pub-id-type="pmid">23601685</pub-id>
</mixed-citation>
</ref>
</ref-list>
</back>
</article>