<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" 'JATS-journalpublishing1-3-mathml3.dtd'>
<article article-type="research-article" dtd-version="1.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Mol. Biosci.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Molecular Biosciences</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Mol. Biosci.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">2296-889X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1730177</article-id>
<article-id pub-id-type="doi">10.3389/fmolb.2025.1730177</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>TNF&#x3b1; protein, DNA methylation, mRNA and miRNA expression evaluation in multiple sclerosis</article-title>
<alt-title alt-title-type="left-running-head">Costantini et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fmolb.2025.1730177">10.3389/fmolb.2025.1730177</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Costantini</surname>
<given-names>E.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/84885"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis/">Formal Analysis</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing &#x2013; review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Greig</surname>
<given-names>N. H.</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing &#x2013; review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Aielli</surname>
<given-names>L.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1984865"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing &#x2013; review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Silva</surname>
<given-names>P. C.</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1389571"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing &#x2013; review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Di Carlo</surname>
<given-names>M.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing &#x2013; review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Konstantinidou</surname>
<given-names>F.</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing &#x2013; review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Reale</surname>
<given-names>M.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/84897"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing &#x2013; review and editing</role>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
<institution>Department of Innovative Technologies in Medicine and Dentistry, University &#x201c;G. D&#x2019;Annunzio&#x201d;</institution>, <city>Chieti</city>, <country country="IT">Italy</country>
</aff>
<aff id="aff2">
<label>2</label>
<institution>Drug Design &#x26; Development Section, Translational Gerontology Branch, Intramural Research Program, National Institute on Aging, National Institutes of Health</institution>, <city>Baltimore</city>, <state>MD</state>, <country country="US">United States</country>
</aff>
<aff id="aff3">
<label>3</label>
<institution>School of Medicine and Biomedical Sciences. Instituto de Ci&#xea;ncias Biom&#xe9;dicas Abel Salazar, University Porto</institution>, <city>Porto</city>, <country country="PT">Portugal</country>
</aff>
<aff id="aff4">
<label>4</label>
<institution>Department of Neuroscience, Imaging and Clinical Sciences, School of Medicine and Health Sciences, &#x201c;G. d&#x2019;Annunzio&#x201d; University of Chieti-Pescara</institution>, <city>Chieti</city>, <country country="IT">Italy</country>
</aff>
<aff id="aff5">
<label>5</label>
<institution>Unit of Molecular Genetics, Center for Advanced Studies and Technology (CAST), &#x201c;G. d&#x2019;Annunzio&#x201d; University of Chieti-Pescara</institution>, <city>Chieti</city>, <country country="IT">Italy</country>
</aff>
<author-notes>
<corresp id="c001">
<label>&#x2a;</label>Correspondence: E. Costantini, <email xlink:href="mailto:erica.costantini@unich.it">erica.costantini@unich.it</email>; M. Di Carlo, <email xlink:href="mailto:dicarlomartina17@gmail.com">dicarlomartina17@gmail.com</email>
</corresp>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2025-12-17">
<day>17</day>
<month>12</month>
<year>2025</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2025</year>
</pub-date>
<volume>12</volume>
<elocation-id>1730177</elocation-id>
<history>
<date date-type="received">
<day>22</day>
<month>10</month>
<year>2025</year>
</date>
<date date-type="rev-recd">
<day>19</day>
<month>11</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>25</day>
<month>11</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Costantini, Greig, Aielli, Silva, Di Carlo, Konstantinidou and Reale.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Costantini, Greig, Aielli, Silva, Di Carlo, Konstantinidou and Reale</copyright-holder>
<license>
<ali:license_ref start_date="2025-12-17">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>Tumor necrosis factor alpha (TNF&#x3b1;) is a key cytokine involved in the inflammatory and neurodegenerative processes underlying multiple sclerosis (MS). Its expression is finely regulated by epigenetic and post-transcriptional mechanisms, including promoter methylation and miRNA activity. The objective of this study is to investigate TNF&#x3b1; expression, promoter methylation, and its regulation by miR-130a-3p in patients with relapsing&#x2013;remitting (RR)MS, evaluating both serum and saliva as potential diagnostic biofluids.</p>
</sec>
<sec>
<title>Methods</title>
<p>RRMS patients in clinical remission and sex and age-matched healthy controls (HC) were enrolled. TNF&#x3b1; levels were quantified in serum, peripheral blood mononuclear cell (PBMC) supernatants, and saliva using ELISA. TNF&#x3b1; mRNA expression and promoter methylation were analyzed by qPCR and pyrosequencing, respectively. Bioinformatic tools (TargetScan, miRTargetLink 2.0, miEAA 2) were used to explore miRNA&#x2013;TNF&#x3b1; interactions, and miR-130a-3p expression was evaluated in serum and saliva by qPCR.</p>
</sec>
<sec>
<title>Results</title>
<p>RRMS patients showed significantly higher TNF&#x3b1; mRNA and protein levels compared to HC, paralleled by significant hypomethylation of the TNF&#x3b1; promoter in PBMCs. miR-130a-3p was markedly downregulated in both serum and saliva, exhibiting an inverse trend with TNF&#x3b1; expression. Salivary TNF&#x3b1; levels mirrored serum alterations, supporting the feasibility of saliva as a noninvasive biomarker source.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>The data indicate that TNF&#x3b1; upregulation in RRMS is associated with promoter hypomethylation and reduced miR-130a-3p expression, suggesting a coordinated epigenetic and post-transcriptional control of this cytokine. The parallel trends observed in saliva and serum highlight the potential use of salivary TNF&#x3b1; and miR-130a-3p as minimally invasive biomarkers for MS monitoring and early diagnosis.</p>
</sec>
</abstract>
<kwd-group>
<kwd>multiple sclerosis</kwd>
<kwd>TNF&#x3b1;</kwd>
<kwd>miR-130a-3p</kwd>
<kwd>DNA methylation</kwd>
<kwd>saliva biomarkers</kwd>
<kwd>epigenetic regulation</kwd>
</kwd-group>
<funding-group>
<funding-statement>The authors declare that financial support was received for the research and/or publication of this article. NHG is supported by the Intramural Research Program of the National Institute on Aging, NIH, United States (AG000964).</funding-statement>
</funding-group>
<counts>
<fig-count count="6"/>
<table-count count="5"/>
<equation-count count="0"/>
<ref-count count="55"/>
<page-count count="12"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Structural Biology</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="s1">
<title>Introduction</title>
<p>Multiple sclerosis (MS) is an autoimmune and neurodegenerative disorder characterized by chronic inflammation of the central nervous system (CNS) and has a high prevalence worldwide, affecting approximately two million individuals. MS primarily impacts young adults, and women at a 2-fold higher rate than men.</p>
<p>The pathogenesis of MS is complex, and it is postulated that a combination of genetic, epigenetic, microbial, and environmental factors may predispose individuals to MS (<xref ref-type="bibr" rid="B35">Olsson et al., 2017</xref>). MS is characterized by immune cell infiltration into the CNS, leading to both local and systemic inflammation. This infiltration results in neuroinflammation, axonal damage, and destruction of myelin, the protective sheath surrounding nerve fibers. This leads to disrupted communication between the brain and the rest of the body, manifesting in multiple symptoms, including motor, sensory, and cognitive impairments. Histopathologically, MS sclerosing lesions or plaques occur throughout the CNS but are commonly found in the periventricular regions, optic nerves, brainstem, and the spinal cord. They are characterized by focal demyelination, gliosis, and axonal loss (<xref ref-type="bibr" rid="B3">Bagnato et al., 2024</xref>). Clinically, the most frequent phenotype of MS is relapsing-remitting MS (RRMS), distinguished by episodes of reversible neurological attacks followed by total or local recovery. Over time, in the majority patients diagnosed with RRMS, neurologic deficits become permanent, and secondary progressive (SP) MS develops. However, 10%&#x2013;15% of MS cases follow a primary-progressive (PP) course, in which patients accumulate progressive disability from the onset with no apparent distinct relapses (<xref ref-type="bibr" rid="B27">Lublin et al., 2014</xref>). Current research on the pathophysiological changes that occur in MS has identified agents such as cytokines, chemokines, nitric oxide, reactive oxygen species, glutamate, and free radicals, as well as mechanisms contributing to the establishment and maintenance of MS associated inflammatory processes. Among the different cytokines found elevated in patients, a growing body of evidence has indicated that tumor necrosis factor alpha (TNF&#x3b1;) plays a pivotal role in the MS development (<xref ref-type="bibr" rid="B21">Kahl et al., 2002</xref>), inducing a chronic inflammatory demyelinating disorder, synaptic instability in the brain, and subsequent sensory and cognitive damage that correlates with the degree of disability in MS patients (<xref ref-type="bibr" rid="B4">Begum et al., 2013</xref>; <xref ref-type="bibr" rid="B31">McCoy and Tansey, 2008</xref>).</p>
<p>Many cell types produce TNF&#x3b1;. Primarily activated macrophages, effector CD4<sup>&#x2b;</sup> and CD8<sup>&#x2b;</sup> T cells, and B lymphocytes do so in the peripheral blood, and they regulate each other&#x2019;s function through the secretion of cytokines, forming a complicated network. Microglia are the main TNF&#x3b1; source within the brain, especially when stimulated by proinflammatory signals; however, neurons and astrocytes also contribute significantly to TNF&#x3b1; production (<xref ref-type="bibr" rid="B38">Probert, 2015</xref>; <xref ref-type="bibr" rid="B18">Heir et al., 2024</xref>). TNF&#x3b1; exerts potent proinflammatory activity by activating two specific TNF&#x3b1; receptors (TNFRs): TNF receptor type-1 (TNFR1) and type-2 (TNFR2) (<xref ref-type="bibr" rid="B40">Ribeiro et al., 2019</xref>). However, characterizing the precise mechanisms underlying TNF&#x3b1; signaling in human MS has proved difficult, and thus studies of MS animal models, such as experimental autoimmune encephalomyelitis (EAE), have led to hypotheses regarding the actions of TNF&#x3b1; (<xref ref-type="bibr" rid="B32">Mehta et al., 2018</xref>; <xref ref-type="bibr" rid="B43">Sayed et al., 2010</xref>).</p>
<p>Although studies on DNA methylation in MS are relatively few, there is increasing evidence that epigenetic modifications may confer risk for MS, and promoter methylation in a number of genes is reported to be associated with the status of multiple diseases and with functions of the immune system (<xref ref-type="bibr" rid="B51">Sokratous et al., 2016</xref>; <xref ref-type="bibr" rid="B6">Celarain and Tomas-Roig, 2020</xref>), highlighting the usefulness of evaluating DNA methylation in gene promoters for disease prediction and treatment.</p>
<p>MicroRNAs (miRNAs) are non-protein-coding, single-stranded, 18&#x2013;25 nucleotide RNA molecules that do not encode any proteins but modify post-transcriptional gene expression, and multiple microRNAs can regulate the same mRNA sequence. Micro-RNAs have been recognized as potent regulators of several pathways and genes implicated in the pathophysiology of inflammatory disorders. Recent studies have found that miRNAs affecting glial cells and peripheral immune cells are involved in MS pathogenesis (<xref ref-type="bibr" rid="B14">Gao et al., 2021</xref>; <xref ref-type="bibr" rid="B1">Al-Temaimi et al., 2024</xref>; <xref ref-type="bibr" rid="B13">Gandhi, 2015</xref>). Given the hypothesis that measurement of the mRNA level of TNF&#x3b1; in peripheral blood mononuclear cells (PBMCs) and the protein level in serum could reflect the general TNF&#x3b1; expression status and the inter-regulation among cells, it is also necessary to consider epigenetic changes, such as DNA methylation and miRNA expression, which have been functionally linked to transcriptional and post-transcriptional modulation of associated genes in playing a significant role in regulating TNF&#x3b1; production and function.</p>
<p>Exploring the connection between TNF&#x3b1;, its miRNA targets, and promoter methylation in a noninvasive, safe, and easily accessible collection fluid may lay the foundation for identifying biomarkers to enable assessment of disease risk at the earliest possible stage, aid in the prevention of disease progression, and enhance public health outcomes by facilitating timely interventions. Towards this objective, our aim is to bridge the gap between potential salivary markers and those present in other biological fluids, such as cerebrospinal fluid (CSF) and serum, with a particular focus on TNF&#x3b1;, which could represent a clinically valuable diagnostic tool.</p>
<p>To address this issue, the expression, production, and circulating levels of TNF&#x3b1;, a gene-associated miRNA selected for its reported involvement in inflammation, as well as the promoter methylation of the TNF&#x3b1; gene, were evaluated in samples from patients with MS and in HC.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and methods</title>
<sec id="s2-1">
<title>Study population and ethical statement</title>
<p>The study included 14 subjects (7 males, 7 females) diagnosed with MS according to the McDonald 2010 criteria (<xref ref-type="bibr" rid="B37">Polman et al., 2011</xref>) and recruited at the Multiple Sclerosis Center of the University &#x201c;G. d&#x2019;Annunzio&#x201d; of Chieti. Patient demographics (sex and age) and clinical data (disease course, disease duration, and disability level), evaluated using the Expanded Disability Status Scale (EDSS) (<xref ref-type="bibr" rid="B24">Kurtzke, 1983</xref>), were collected. All patients with MS were in the remission clinical phase, defined as the period of recovery with no relapse episodes and without any immunomodulatory treatment within the last 3 months before their time of enrollment in the study. They, therefore, were defined as having RRMS. The control group comprised 14 healthy subjects with similar demographic characteristics. Specifically, this control group did not present with clinical symptoms or laboratory parameters of inflammation, MS, or any other autoimmune disease. The local ethics committee (University &#x201c;G. d&#x2019;Annunzio&#x201d; of Chieti) approved the study (CRRM; 2023; 07; 11; 03), and all participants signed informed written consent that followed the ethical standards laid down in the 1964 Declaration of Helsinki.</p>
</sec>
<sec id="s2-2">
<title>Sample collection</title>
<p>A total of 20 mL of peripheral blood samples and 1 mL of serum were collected, respectively, in an EDTA tube and clot activator tube, from each RRMS subject and HC at the time of enrollment. Saliva sampling was performed for all participants between 9 a.m. and 11 a.m., by passive unstimulated drooling into a sterile tube. Specimens were processed within 1&#x2013;2 h of collection. Serum and saliva were obtained by centrifugation (1500xg for 10 min) and aliquoted into tubes for storage at &#x2212;80 &#xb0;C until use.</p>
<p>PBMCs were isolated from EDTA tubes by centrifugation using a Ficoll-Hypaque density gradient. Cells were harvested from the interface, washed twice with Dulbecco&#x2019;s phosphate-buffered saline (DPBS), and resuspended in RPMI 1640 medium (Merck KGaA, Germany) supplemented with 10% fetal bovine serum (FBS) (Euroclone S. p.a, Italy), 4 mM L-glutamine, 50 U/mL penicillin, and 50 mg/L streptomycin (Merck KGaA, Germany). Cells were then seeded at a concentration of 2 &#xd7; 10<sup>6</sup> in 5 mL polypropylene culture tubes (BD Falcon&#x2122;, Two Oak Park Bedford, United States) and grown in an incubator at 37 &#xb0;C and 5% CO<sub>2</sub> for 24 h.</p>
<p>All reagents were screened before use and found to be negative for endotoxin (&#x3c;10 pg/mL; Associates of Cape Cod, Inc., Woods Hole, MA, United States) and <italic>mycoplasma</italic> contamination (MycoAlert&#x2122; <italic>Mycoplasma</italic> Detection Kits, Lonza Bioscience, United States). More than 98% of the PBMCs were viable, as determined by trypan blue dye exclusion at the beginning of the culture, and more than 90% were viable before the supernatants were collected.</p>
</sec>
<sec id="s2-3">
<title>TNF&#x3b1; enzyme-linked immunosorbent assay</title>
<p>TNF&#x3b1; concentrations in serum, PBMC culture supernatants, and saliva were evaluated using an enzyme-linked immunosorbent assay (ELISA) with a commercially available &#x201c;Human TNF&#x3b1; ELISA Kit&#x201d; (OriGene Technologies GmbH, United States) with a specificity of 70 ng/mL and a sensitivity of 7 pg/mL. To ensure the accurate performance of the immunoassay in the salivary matrix, representative samples of saliva were first tested for dilution and recovery. The optimal dilution of saliva was determined to ensure that measurements were performed in the dynamic range of the assay. All samples were analyzed in duplicate at the same time and reading, at 450 nm &#x3bb;, of the relative concentrations were performed using the Glomax Multidetection System (Promega, Italy).</p>
</sec>
<sec id="s2-4">
<title>RNA extraction and real-time polymerase chain reaction</title>
<p>Total RNA was extracted from PBMCs using QIAzol reagent (Qiagen, Germany) according to the manufacturer&#x2019;s protocol. The RNA concentration was determined by measuring the absorbance of the samples at 260 nm &#x3bb; using a NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific, United States), and its purity was assessed by the absorbance ratio of 260/280 nm and 260/230 nm &#x3bb; (<xref ref-type="bibr" rid="B11">Fleige and Pfaffl, 2006</xref>). For each sample, 1 &#x3bc;g of RNA was reverse transcribed into complementary DNA (cDNA) using the QuantiTect Reverse Transcription Kit (Qiagen, Germany). Subsequently, Real-Time Polymerase Chain Reaction (RT-PCR) was performed using the GoTaq&#xae; qPCR Master Mix (Promega, Italy), to evaluate the gene expression of TNF&#x3b1; and Ribosomal Protein S18 (RPS18). Specific primer pairs were used to evaluate the gene expression of TNF&#x3b1; (FW:5&#x2032;-CCTTCCTGATCGTGGCAG-3&#x2019;; RW:5&#x2032;-GCTTGAGGGTTTGCTACAAC-3&#x2032;), and the housekeeping gene RPS18 (FW 5&#x2032;-CTTTGCCATCACTGCCATTAAG-3&#x2032;, RW 5&#x2032;-TCCATCCTTTACATCCTTCTGTC-3&#x2032;).</p>
<p>The expression of the TNF&#x3b1; gene was first normalized with the expression of the housekeeping gene, obtaining a &#x394;Ct for patients and controls (&#x394;Ct &#x3d; Ct<sub>TNF&#x3b1;</sub>&#x2013;Ct<sub>18s</sub>). The &#x394;&#x394;Ct was then calculated (&#x394;&#x394;Ct &#x3d; &#x394;Ct patient&#x2013;&#x394;Ct control), and changes in gene expression levels were expressed as 2<sup>&#x2212;&#x394;&#x394;Ct</sup> (<xref ref-type="bibr" rid="B26">Livak and Schmittgen, 2001</xref>). All RT-PCR reactions were performed in triplicate using a CFX96 Real-Time PCR Detection System (Biorad, United States) under the following conditions: initial incubation at 95 &#xb0;C for 2 min, followed by 40 cycles at 95 &#xb0;C for 30 s, followed by 60 &#xb0;C for 1 min and 30 s at 68 &#xb0;C.</p>
</sec>
<sec id="s2-5">
<title>DNA isolation and pyrosequencing</title>
<p>Genomic DNA was extracted from blood samples using the NucleoSpin Tissue Kit (Macherey-Nagel, Germany). The quantity and quality of the DNA were assessed using Qubit 2.0 (Invitrogen, Italy). DNA was bisulfite-converted using the EpiTect Plus DNA Bisulfite Kit (Qiagen, Germany), converting unmethylated cytosines to uracils, and stored at &#x2212;20 &#xb0;C until use. PCR amplification of the TNF&#x3b1; promoters was performed using 2&#xd7; PyroMark PCR Master Mix and 10&#xd7; Coral Load Concentrate (Qiagen, Germany), 0.2 &#x3bc;M of each primer, 1 &#x3bc;L of bisulfite-converted DNA, and nuclease-free water to a final volume of 25 &#x3bc;L. The sequences of primers used for DNA methylation analysis are: FW PCR primer 5&#x2019;-[Biotin]- TGAGGGGTATTTTTGATGTTTGT-3&#x2032;; RW PCR Primer 5&#x2032;-CCAACAACT ACCTTTATATATCCC-3&#x2032;; Sequencing Primer 5&#x2032;-ATAAACCCTACACCTTCTAT-3&#x2032; and Sequence to Analyze CTCA/GATTTCTTCTCCATCA/GCA/GAAAACA/GAAAATTT.</p>
<p>The PCR conditions were as follows: 57 &#xb0;C for 30s, 72 &#xb0;C for 30 s, and a final extension at 72 &#xb0;C for 10 min. To evaluate the methylation status of specific CpG sites of major interest located in the promoters of the TNF&#x3b1; gene in a single experimental approach, the pyrosequencing reaction plates were loaded on a PyroMark Q96ID (Qiagen, Germany), and CpG methylation analysis was conducted using PyroMark CpG software (Qiagen, Germany). Triplicates were generated for each PCR. The methylation of each amplicon was calculated as the median methylation status of each analyzed CpG. Four CpGs were evaluated in the TNF&#x3b1; gene promoter.</p>
</sec>
<sec id="s2-6">
<title>Identification and analysis of miRNA</title>
<p>Saliva and serum samples from RRMS patients and HC were used to isolate miRNAs using the miRNeasy kit (Qiagen, Germany), following the manufacturer&#x2019;s instructions. This approach ensured the extraction of miRNAs of high purity and quality, which is essential for the accuracy of subsequent molecular analyses. The concentration and quality of the extracted miRNAs were determined by spectrophotometry using NanoDrop 2000UV-Vis (Thermo Fisher, United States) at &#x3bb; &#x3d; 260 nm. For complementary DNA (cDNA) synthesis, miRNAs were reverse transcribed using the miRCURY LNA RT kit (Qiagen, Germany). Reverse transcription was performed using 5 ng of total RNA for each sample, following the manufacturer&#x2019;s protocol, to obtain high-quality cDNA. The analysis of miR-130a-3p, identified through bioinformatics and literature analysis, was performed using miR-16 as a housekeeping gene. miRNA expression levels in the serum and saliva samples of RRMS patients and HC were evaluated using Real-time PCR with the CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, United States). Gene expression analysis was performed using the 2<sup>&#x2212;&#x394;&#x394;Ct</sup> method.</p>
</sec>
<sec id="s2-7">
<title>Bioinformatics analysis of TNF targets</title>
<p>Bioinformatic analysis using the prediction software TargetScan Human (<ext-link ext-link-type="uri" xlink:href="https://www.targetscan.org/">https://www.targetscan.org</ext-link>), <ext-link ext-link-type="uri" xlink:href="https://ccb-compute.cs.uni-saarland.de/mirtargetlink2/">miRTargetLink 2.0</ext-link> (<ext-link ext-link-type="uri" xlink:href="https://ccb-compute.cs.uni-saarland.de/mirtargetlink2">https://ccb-compute.cs.uni-saarland.de/mirtargetlink2</ext-link>) and miEAA 2 (<ext-link ext-link-type="uri" xlink:href="https://ccb-compute2.cs.uni-saarland.de/mieaa">https://ccb-compute2.cs.uni-saarland.de/mieaa</ext-link>) was performed to identify key miRNAs involved through the TNF-&#x3b1;-activated signaling pathway in MS progression. TargetScan predicts microRNA (miRNA)&#x2013;mRNA interactions by identifying conserved complementarity between the miRNA seed region and the 3&#x2032;untranslated regions (3&#x2032;-UTRs) of target genes, integrating evolutionary conservation and context scoring to prioritize predictions. miRTargetLink 2.0 is an interactive platform for the visualization and exploration of both experimentally validated and predicted miRNA&#x2013;target relationships, enabling network-based analysis and functional filtering, and miEAA 2 (microRNA Enrichment Analysis and Annotation tool, version 2) performs enrichment and overrepresentation analyses on defined miRNA sets, integrating multiple annotation databases to identify significantly enriched pathways, biological functions, and disease associations.</p>
</sec>
<sec id="s2-8">
<title>Statistical analysis</title>
<p>The anamnestic and clinical data of the patients were summarized as quantitative variables and reported as median and interquartile range (IQR), and qualitative variables as frequencies and percentages. The statistical differences in gene expression fold changes between MS patients and HC subjects were determined using a 95% confidence interval. The Mann-Whitney U test was used to compare quantitative variables between the two groups. Comparative analysis and correlation were evaluated using Spearman (rho). In all tests, the threshold for statistical significance was set at p &#x3c; 0.05. Data were analyzed using GraphPad software.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec id="s3-1">
<title>Patient demographics, clinical characteristics, and TNF&#x3b1; serum levels</title>
<p>The study group comprised 14 patients with RRMS (seven women and seven men; median age, 45.0 years; range, 36&#x2013;54 years) and 14 HC (eight Women and six men; median age, 46 years; range, 37&#x2013;57 years). There were no significant differences in age and sex ratio between the patients and controls (p &#x3e; 0.05). The median disease duration was 15 years (range 5&#x2013;21). The median EDSS score in patients with RRMS was 3.7 (range 2&#x2013;5.8) (<xref ref-type="table" rid="T1">Table 1</xref>).</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Features of patients with RRMS and HC.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th colspan="2" align="left">Variables</th>
<th align="left">MS (n &#x3d; 14)</th>
<th align="left">HC (14)</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td colspan="4" align="left">Sex, n (%)</td>
</tr>
<tr>
<td align="left"/>
<td align="left">Male</td>
<td align="left">7 (50%)</td>
<td align="left">6 (42.85%)</td>
</tr>
<tr>
<td align="left"/>
<td align="left">Female</td>
<td align="left">7 (50%)</td>
<td align="left">8 (57.14%)</td>
</tr>
<tr>
<td colspan="2" align="left">Age (years), mean (DS)</td>
<td align="left">45 (&#xb1;9)</td>
<td align="left">46 (&#xb1;9)</td>
</tr>
<tr>
<td colspan="4" align="left">Smoke, n (%)</td>
</tr>
<tr>
<td align="left"/>
<td align="left">No</td>
<td align="left">8 (57.14%)</td>
<td align="left">5 (35.71%)</td>
</tr>
<tr>
<td align="left"/>
<td align="left">Yes</td>
<td align="left">4 (28.57%)</td>
<td align="left">3 (21.42%)</td>
</tr>
<tr>
<td align="left"/>
<td align="left">Ex</td>
<td align="left">2 (14.28%)</td>
<td align="left">6 (42.85%)</td>
</tr>
<tr>
<td align="left">EDSS, median (IQR)</td>
<td align="left"/>
<td align="left">3.7 (2.0&#x2013;5.8)</td>
<td align="left">&#x2014;</td>
</tr>
<tr>
<td align="left">Age of onset (years), median (IQR)</td>
<td align="left"/>
<td align="left">31 (23&#x2013;35)</td>
<td align="left">&#x2014;</td>
</tr>
<tr>
<td align="left">Disease duration (years), median (IQR)</td>
<td align="left"/>
<td align="left">15 (5&#x2013;21)</td>
<td align="left">&#x2014;</td>
</tr>
<tr>
<td align="left">OCB, n (%)</td>
<td align="left"/>
<td align="left"/>
<td align="left">&#x2014;</td>
</tr>
<tr>
<td align="left"/>
<td align="left">Present</td>
<td align="left">8 (57.14%)</td>
<td align="left">&#x2014;</td>
</tr>
<tr>
<td align="left"/>
<td align="left">Absent</td>
<td align="left">1 (7.14%)</td>
<td align="left">&#x2014;</td>
</tr>
<tr>
<td align="left"/>
<td align="left">nd</td>
<td align="left">5 (35.71%)</td>
<td align="left">&#x2014;</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>nd: non detected.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>Serum levels of TNF&#x3b1; in patients with RRMS were significantly (p &#x3d; 0.007) higher than those in the control group (14.4 &#xb1; 6.5 pg/mL vs. 5.8 &#xb1; 3.2 pg/mL, respectively) (<xref ref-type="fig" rid="F1">Figure 1</xref>). There was no statistically significant correlation between the serum TNF&#x3b1; level and EDSS score in RRMS patients.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Serum TNF&#x3b1; levels in patients with MS and HC subjects. Data are reported as median &#xb1;standard deviation (SD). MS vs. healthy subjects p &#x3c; 0.05.</p>
</caption>
<graphic xlink:href="fmolb-12-1730177-g001.tif">
<alt-text content-type="machine-generated">Box plot comparing serum levels of TNF&#x3B1; in pg/ml between healthy controls (HC) and relapsing-remitting multiple sclerosis (RRMS) patients. RRMS shows higher median TNF&#x3B1; levels with a significant p-value of 0.007.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-2">
<title>Expression and production of TNF&#x3b1; in PBMCs</title>
<p>TNF&#x3b1; serum levels represent the sum of immune and non-immune cellular sources and are influenced by the clearance rate. To determine whether the higher circulating levels observed in RRMS patients result from increased production and gene transduction by PBMCs, we evaluated TNF&#x3b1; expression and production in PBMCs isolated from both MS patients and HC subjects (<xref ref-type="fig" rid="F2">Figure 2a</xref>). In RRMS patients, the expression levels of TNF&#x3b1; were significantly higher than those in HC subjects, in accordance with the levels of TNF&#x3b1; detected in the supernatant of cell culture (<xref ref-type="fig" rid="F2">Figure 2b</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>
<bold>(a)</bold> TNF&#x3b1; expression levels in PBMCs isolated from RRMS patients and HC subjects. Data are reported as median &#xb1;standard deviation. RRMS vs. HC p &#x3c; 0.05. <bold>(b)</bold> Cell-free supernatant TNF&#x3b1; levels in RRMS patients and HC subjects. Data are reported as median &#xb1;standard deviation. MS vs. HC p &#x3c; 0.05.</p>
</caption>
<graphic xlink:href="fmolb-12-1730177-g002.tif">
<alt-text content-type="machine-generated">Bar graph and box plot comparing TNF-alpha levels. Graph a) shows TNF-alpha expression levels significantly higher in RRMS than HC, with p&#x3C;0.001. Graph b) depicts suprenant levels of TNF-alpha in pg/mL, also higher in RRMS with statistical significance, p&#x3C;0.001.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-3">
<title>TNF&#x3b1; epigenetic regulation</title>
<sec id="s3-3-1">
<title>Methylation analysis</title>
<p>Changes in promoter methylation of the TNF&#x3b1; gene and their effects on gene expression were analyzed. Total methylation, as the mean value of all CpG sites analyzed, comparing 14 HC with 14 RRMS samples, revealed a significant reduction in CpG methylation in its promoter region (p &#x3d; 0.001).</p>
<p>This finding implicates the involvement of promoter methylation in the regulation of TNF&#x3b1; expression, the significant role of TNF&#x3b1; methylation in the immune system, and its potential as an epigenetic marker for diseases. At the single CpG level, the methylation values of CpG2, CpG3, and CpG4 in PBMCs showed significant hypomethylation, supporting the notion that the upregulation of TNF&#x3b1; protein levels in PBMCs is probably related to differential DNA methylation.</p>
<p>We detected a negative association between TNF&#x3b1; promoter methylation and gene expression in PBMCs, and an association analysis was conducted by evaluating changes in promoter methylation and gene expression (<xref ref-type="fig" rid="F3">Figure 3</xref>).</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>
<bold>(a)</bold> TNF&#x3b1; methylation index in patients with MS and HC subjects. Data are reported as median &#xb1;standard deviation. MS vs. HC subjects p &#x3c; 0.05. <bold>(b)</bold> TNF&#x3b1; methylation levels of individual CpG dinucleotides.</p>
</caption>
<graphic xlink:href="fmolb-12-1730177-g003.tif">
<alt-text content-type="machine-generated">Bar chart and table comparing methylation index and CpG sites between HC and RRMS groups. Chart shows higher methylation in HC with significant difference (p&#x3C;0.001). Table lists TNF alpha CpG site data with significant differences at CpG2, CpG3, and CpG4 (p&#x3d;0.001).</alt-text>
</graphic>
</fig>
<p>TNF&#x3b1; promoter methylation in the blood was not correlated with sex or age (data not shown).</p>
</sec>
<sec id="s3-3-2">
<title>miRNA evaluation</title>
<p>Gene expression is not only regulated by genetic sequence methylation but is also influenced by other epigenetic mechanisms, including non-coding RNAs, such as miRNAs.</p>
<p>To explore the relevance between TNF&#x3b1; and miRNA, we applied the bioinformatic prediction software TargetScan Human (<ext-link ext-link-type="uri" xlink:href="https://www.targetscan.org/">https://www.targetscan.org</ext-link>) and miRTargetLink 2.0 (<ext-link ext-link-type="uri" xlink:href="https://ccb-compute.cs.uni-saarland.de/mirtargetlink2">https://ccb-compute.cs.uni-saarland.de/mirtargetlink2</ext-link>). The main target gene predicted by TargetScan Human was miR-130a-3p, as reported in <xref ref-type="table" rid="T2">Table 2</xref>, with the complementary sequence identified in the 3&#x2032;-UTR of TNF&#x3b1;, followed by other miRNAs with less site specificity.</p>
<table-wrap id="T2" position="float">
<label>TABLE 2</label>
<caption>
<p>TargetScan Human predicted complementary sequence of TNF&#x3b1;.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left"/>
<th align="center">Predicted miRNA</th>
<th align="center">Site type</th>
<th align="center">Context&#x2b;&#x2b; score</th>
<th align="center">Context&#x2b;&#x2b; score percentile</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="center">
<ext-link ext-link-type="uri" xlink:href="https://mirbase.org/results/?query=hsa-miR-130a-3p">hsa-miR-130a-3p</ext-link>
</td>
<td align="center">5&#x27; &#x2026;UCCCUCUAUUUAUGUUUGCACUU&#x2026;<break/>&#x7c;&#x7c;&#x7c;&#x7c; &#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;<break/>3&#x2032;UACGGGAAAAUUGUAACGUGAC</td>
<td align="center">7mer-m8</td>
<td align="center">&#x2212;0.38</td>
<td align="center">98</td>
</tr>
<tr>
<td align="center">
<ext-link ext-link-type="uri" xlink:href="https://mirbase.org/results/?query=hsa-miR-454-3p">hsa-miR-454-3p</ext-link>
</td>
<td align="center">5&#x27;&#x2026;UCCCUCUAUUUAUGUUUGCACUU&#x2026;<break/>&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;<break/>3&#x2032;UGGGAUAUUCGUUAUAACGUGAU</td>
<td align="center">7mer-m8</td>
<td align="center">&#x2212;0.36</td>
<td align="center">98</td>
</tr>
<tr>
<td align="center">
<ext-link ext-link-type="uri" xlink:href="https://mirbase.org/results/?query=hsa-miR-3666">hsa-miR-3666</ext-link>
</td>
<td align="center">5&#x27;&#x2026;UCCCUCUAUUUAUGUUUGCACUU&#x2026;<break/>&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;<break/>3&#x2032;AGCCGUAGAUGUGAACGUGAC</td>
<td align="center">7mer-m8</td>
<td align="center">&#x2212;0.35</td>
<td align="center">98</td>
</tr>
<tr>
<td align="center">
<ext-link ext-link-type="uri" xlink:href="https://mirbase.org/results/?query=hsa-miR-301a-3p">hsa-miR-301a-3p</ext-link>
</td>
<td align="center">5&#x27;&#x2026;UCCCUCUAUUUAUGUUUGCACUU&#x2026;<break/>&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;<break/>3&#x2032;CGAAACUGUUAUGAUAACGUGAC</td>
<td align="center">7mer-m8</td>
<td align="center">&#x2212;0.34</td>
<td align="center">98</td>
</tr>
<tr>
<td align="center">
<ext-link ext-link-type="uri" xlink:href="https://mirbase.org/results/?query=hsa-miR-130b-3p">hsa-miR-130b-3p</ext-link>
</td>
<td align="center">5&#x27;&#x2026;UCCCUCUAUUUAUGU-UUGCACUU&#x2026;<break/>&#x7c;&#x7c;&#x7c; &#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;<break/>3&#x2032;UACGGGAAAGUAGUAACGUGAC</td>
<td align="center">7mer-m8</td>
<td align="center">&#x2212;0.36</td>
<td align="center">98</td>
</tr>
<tr>
<td align="center">
<ext-link ext-link-type="uri" xlink:href="https://mirbase.org/results/?query=hsa-miR-301b-3p">hsa-miR-301b-3p</ext-link>
</td>
<td align="center">5&#x27;&#x2026;UCCCUCUAUUUAUGUUUGCACUU&#x2026;<break/>&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;<break/>3&#x2032;CGAAACUGUUAUAGUAACGUGAC</td>
<td align="center">7mer-m8</td>
<td align="center">&#x2212;0.34</td>
<td align="center">97</td>
</tr>
<tr>
<td align="center">
<ext-link ext-link-type="uri" xlink:href="https://mirbase.org/results/?query=hsa-miR-4295">hsa-miR-4295</ext-link>
</td>
<td align="center">5&#x27;&#x2026;UCCCUCUAUUUAUGUUUGCACUU&#x2026;<break/>&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;&#x7c;<break/>3&#x2032;UUCCUUUUGUAACGUGAC</td>
<td align="center">7mer-m8</td>
<td align="center">&#x2212;0.30</td>
<td align="center">96</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Context&#x2b;&#x2b; score and features that contribute to the Context &#x2b;&#x2b; score percentile were evaluated as in <xref ref-type="bibr" rid="B49">Agarwal et al. (2015)</xref>.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>Moreover, analysis with miRTargetLink 2.0 identified miR-130a-3p as a strongly validated target of TNF&#x3b1; (<xref ref-type="fig" rid="F4">Figure 4a</xref>), supporting its potential role in TNF&#x3b1;-mediated signaling. To further explore the functional context, a complementary enrichment analysis was conducted using miEAA 2 (<ext-link ext-link-type="uri" xlink:href="https://ccb-compute2.cs.uni-saarland.de/mieaa">https://ccb-compute2.cs.uni-saarland.de/mieaa</ext-link>). This analysis revealed a significant overrepresentation of TNF&#x3b1; as the principal subcategory, reflecting the observed distribution of counts across the identified miRNAs. The results are visually summarized in a word cloud plot, where the prominence of TNF&#x3b1; underscores its central involvement in the regulatory network (<xref ref-type="fig" rid="F4">Figure 4b</xref>; <xref ref-type="table" rid="T3">Table 3</xref>).</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>
<bold>(a)</bold> Interaction graph obtained using miRTargetLink 2.0; <bold>(b)</bold> Visualization of a word-cloud of the target for identified miRNAs, with relevance for TNF&#x3b1;, associated with the seven searched miRNAs.</p>
</caption>
<graphic xlink:href="fmolb-12-1730177-g004.tif">
<alt-text content-type="machine-generated">a) Diagram showing TNF as a central node connected to six miRNAs: hsa-miR-125b-5p, hsa-miR-143-3p, hsa-miR-130a-3p, hsa-miR-17-5p, hsa-miR-19a-3p, and hsa-miR-203a-3p in blue circles. b) Word cloud displaying names of various genes, highlighting TNF among others in various colors and sizes.</alt-text>
</graphic>
</fig>
<table-wrap id="T3" position="float">
<label>TABLE 3</label>
<caption>
<p>Interaction table obtained using miRTargetLink 2.0</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="center">miRNA</th>
<th align="center">Target/Target pathway</th>
<th align="center">Support</th>
<th align="center">Source</th>
<th align="center">Reference - PMID</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="center">hsa-miR-130a-3p</td>
<td align="center">TNF&#x3b1;</td>
<td align="center">Functional MTI</td>
<td align="center">MIRT054762</td>
<td align="center">24885472/26435691</td>
</tr>
<tr>
<td align="center">hsa-miR-125b-5p</td>
<td align="center">TNF&#x3b1;</td>
<td align="center">Functional MTI</td>
<td align="center">MIRT733472</td>
<td align="center">26435691</td>
</tr>
<tr>
<td align="center">hsa-miR-143-3p</td>
<td align="center">TNF&#x3b1;</td>
<td align="center">Functional MTI</td>
<td align="center">MIRT437418</td>
<td align="center">23804075</td>
</tr>
<tr>
<td align="center">hsa-miR-17-5p</td>
<td align="center">TNF&#x3b1;</td>
<td align="center">Functional MTI</td>
<td align="center">MIRT734730</td>
<td align="center">26041742</td>
</tr>
<tr>
<td align="center">hsa-miR-187-3p</td>
<td align="center">TNF&#x3b1;</td>
<td align="center">Functional MTI</td>
<td align="center">MIRT054325</td>
<td align="center">23071313</td>
</tr>
<tr>
<td align="center">hsa-miR-19a-3p</td>
<td align="center">TNF&#x3b1;</td>
<td align="center">Functional MTI</td>
<td align="center">MIRT006787</td>
<td align="center">21271217/26041742</td>
</tr>
<tr>
<td align="center">hsa-miR-203a-3p</td>
<td align="center">TNF&#x3b1;</td>
<td align="center">Functional MTI</td>
<td align="center">MIRT006857</td>
<td align="center">22917968</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>Moreover, we assessed miR-130a-3p expression levels in patients with RRMS. Interestingly, real-time PCR analysis revealed that miR-130a-3p was significantly downregulated in the serum of RRMS patients as compared to that in HC subjects (<xref ref-type="fig" rid="F5">Figure 5</xref>). Based on the results, an inverse correlation emerged, suggesting that the reduced levels of this miRNA relieve its repression on TNF&#x3b1; translation, thereby contributing to its increased gene expression and production levels.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>miR-130a-3p levels in RRMS patients and HC subjects. Data are reported as median &#xb1;standard deviation. RRMS vs. HC subjects, p &#x3c; 0.001.</p>
</caption>
<graphic xlink:href="fmolb-12-1730177-g005.tif">
<alt-text content-type="machine-generated">Bar graph showing miR-130a-3p fold change. The HC group has a fold change of approximately 1.9, while the RRMS group is significantly lower at about 0.1. Statistical significance noted as p&#x3C;0.001.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-3-3">
<title>Comparative evaluation of serum and salivary samples</title>
<p>Considering the known relationship between serum and saliva, both of which represent biological systems useful in the evaluation of key molecules indicative of the systemic health status of an individual, we evaluated whether this correlation was present in our patients with RRMS in relation to TNF&#x3b1; and miR-130a-3p.</p>
<p>First, we evaluated the levels of TNF&#x3b1; in saliva using ELISA and detected a significant increase in RRMS patients compared to HC subjects (p &#x3d; 0.002), in agreement with the increase in serum levels. Interestingly, TNF&#x3b1; levels detected in saliva were higher than those measured in serum (66.6 &#xb1; 23.03 pg/mL and 14.13 &#xb1; 7 pg/mL, respectively), indicating intense endogenous production (<xref ref-type="bibr" rid="B10">Ferrari et al., 2023</xref>) (<xref ref-type="fig" rid="F6">Figure 6a</xref>).</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>
<bold>(a)</bold> miR-130a-3p gene expression levels in RRMS patients compared to HC subjects. Data are reported as median &#xb1;standard deviation. RRMS vs. HC subjects p &#x3c; 0.001. <bold>(b)</bold> TNF&#x3b1; levels in the saliva of RRMS patients and HC subjects. Data are reported as median &#xb1;standard deviation. MS vs. HC p &#x3c; 0.05.</p>
</caption>
<graphic xlink:href="fmolb-12-1730177-g006.tif">
<alt-text content-type="machine-generated">Two box plots labeled a and b comparing salivary biomarkers between two groups: HC and RRMS. Plot a shows miR-one hundred and fifty-one a dash 3p fold change, significantly higher in HC compared to RRMS, p less than zero point zero zero one. Plot b shows TNF alpha levels, significantly higher in RRMS than in HC, p equals zero point zero zero two.</alt-text>
</graphic>
</fig>
<p>Subsequently, miR-130a-3p gene expression levels were assessed in saliva samples, and a significant reduction was observed (p &#x3c; 0.001), following the well-established biological principle that miRNA expression inversely regulates the production of their target proteins (<xref ref-type="fig" rid="F6">Figure 6b</xref>). Spearman correlation analysis showed a negative correlation between TNF&#x3b1; production and miR130a-3p expression in saliva, although this was not statistically significant (r &#x3d; &#x2212;0.13; p &#x3d; 0.71).</p>
</sec>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>TNF&#x3b1; plays a crucial role in immunomodulation and inflammatory responses (<xref ref-type="bibr" rid="B5">Bradley, 2008</xref>), highlighting the importance of elucidating the mechanisms regulating its expression. In this light, several studies have demonstrated the involvement of TNF&#x3b1; signaling in the pathogenesis of MS, and its correlation with disease severity (<xref ref-type="bibr" rid="B45">Sharief and Hentges, 1991</xref>; <xref ref-type="bibr" rid="B12">Fresegna et al., 2020</xref>). Whereas much of our knowledge derives from studies using the rodent EAE model of MS, the exact mechanisms underlying TNF&#x3b1; signaling in patients with MS have remained difficult to dissect. Nevertheless, TNF&#x3b1; appears to contribute to immune cell activation and infiltration into the CNS, as well as to the ensuing demyelination and axonal injury (<xref ref-type="bibr" rid="B30">Mazziotti et al., 2024</xref>).</p>
<p>Peripheral TNF&#x3b1; signaling increases blood&#x2013;brain barrier (BBB) permeability and promotes immune cell activation and trafficking, while elevated TNF&#x3b1; levels within the CNS further enhance microglial and astrocytic activation and antibody and cytokine secretion, ultimately leading to oligodendrocyte death, demyelination, and neuronal damage (<xref ref-type="bibr" rid="B19">Hofman et al., 1989</xref>). In addition, TNF&#x3b1; has been implicated in synaptic dysfunction; peripheral TNF&#x3b1; production during preclinical EAE has been shown to induce synaptic instability in the primary somatosensory cortex, potentially contributing to sensory and cognitive impairments (<xref ref-type="bibr" rid="B54">Yang et al., 2013</xref>).</p>
<p>Of note, TNF&#x3b1; is reported to exert both pathogenic and protective effects in MS, depending on the receptor subtype engagement: signaling via TNFR1 generally promotes inflammation, apoptosis, and demyelination, whereas TNFR2 activation supports remyelination and neuroprotection, particularly through regulatory T cells and oligodendrocyte precursor cells (<xref ref-type="bibr" rid="B2">Arnett et al., 2001</xref>; <xref ref-type="bibr" rid="B12">Fresegna et al., 2020</xref>). This dual role complicates therapeutic approaches targeting TNF&#x3b1;, as illustrated by the paradoxical worsening of MS observed in patients treated with nonselective TNF&#x3b1; inhibitors (<xref ref-type="bibr" rid="B22">Kemanetzoglou and Andreadou 2017</xref>).</p>
<p>At the molecular level, TNF&#x3b1; expressions are tightly regulated at both the transcriptional and post-transcriptional levels (<xref ref-type="bibr" rid="B9">Falvo et al., 2010</xref>). Epigenetic mechanisms play a central role in regulating this process. DNA methylation has been shown to inversely correlate with TNF&#x3b1; transcription, and aberrant methylation patterns have been reported in MS patients during relapse. Moreover, histone modifications influence the accessibility of TNF&#x3b1; promoter regions, contributing to disease-specific expression patterns.</p>
<p>MicroRNAs add a layer of regulation by post-transcriptionally controlling TNF&#x3b1; and related signaling pathways. For example, dysregulation of miR-146a and miR-155, both of which are key modulators of innate and adaptive immune responses, has been associated with MS pathogenesis and progression (<xref ref-type="bibr" rid="B23">Koch et al., 2013</xref>; <xref ref-type="bibr" rid="B50">Junker et al., 2009</xref>). MiR-146a generally exerts anti-inflammatory effects, whereas miR-155 promotes pro-inflammatory responses, highlighting the complex interplay of non-coding RNAs in shaping TNF&#x3b1;-mediated pathologies.</p>
<p>Collectively, these findings emphasize that TNF&#x3b1; is a pivotal mediator in MS, acting at multiple levels of disease initiation and progression, with its expression and signaling tightly modulated by epigenetic and posttranscriptional mechanisms. A deeper understanding of these regulatory networks could open new therapeutic opportunities, particularly strategies targeting epigenetic regulators and miRNAs to fine-tune TNF&#x3b1; expression in a cell-type- and context-specific manner.</p>
<p>In the current study, first we detected higher TNF&#x3b1; mRNA and protein levels in patients with RRMS than in HC subjects, and this finding is consistent with other reports in the field (<xref ref-type="bibr" rid="B30">Mazziotti et al., 2024</xref>). To test the hypothesis that the observed increased TNF&#x3b1; levels in the serum of RRMS patients is triggered by upregulation of mRNA expression in PBMCs, the spontaneous expression of TNF&#x3b1; was evaluated, and significantly higher expression was detected in RRMS patients than in HC subjects, in accordance with the levels of TNF&#x3b1; detected in cell-free supernatants. Our deliberate focus on treatment-free RRMS patients in clinical remission was aimed to isolate disease-related molecular signals by reducing two major confounding sources: relapse-driven inflammation and therapy-induced epigenetic modulation. Relapses and remission differ meaningfully at the level of circulating small RNAs, with several studies showing opposite or state-dependent shifts in miRNA profiles, which could mask or mimic associations in the event that activity phases are mixed within a small cohort (<xref ref-type="bibr" rid="B33">Mu&#xf1;oz-Culla et al., 2016</xref>). Likewise, multiple disease-modifying therapies may potentially reshape epigenetic and post-transcriptional landscapes, for example, interferon-&#x3b2; altering DNA-methylation at interferon-response genes, fumarates affecting miR-21 methylation, and natalizumab normalizing or modulating dysregulated miRNAs; therefore, excluding recently treated patients was necessary to avoid pharmacologic signature overlay (<xref ref-type="bibr" rid="B47">Xavier et al. 2023</xref>). However, this design choice narrows generalizability. Progressive phenotypes exhibit distinct molecular architectures, including genetic&#x2013;epigenetic and transcriptomic features in PPMS, and biomarker differences relative to RRMS; therefore, our hypomethylation and miRNA findings should not be assumed to be representative of SPMS, PPMS, or relapse states without direct testing (<xref ref-type="bibr" rid="B36">Pahlevan Kakhki et al., 2024</xref>). Additional proteomic screening studies and evaluation of TNF&#x3b1; and miR-130a-3p expression levels in a larger population are necessary to identify biomarkers and post-translational modifications to understand their ability to differentiate whether patients are in the RRMS course or have converted to the SPMS course or are in the impending flare-up of MS.</p>
<p>Recent reviews have also underscored that MS epigenetics and miRNA biology are heterogeneous across stages and compartments, reinforcing the need for validation in broader phenotypes and during clinically active phases (<xref ref-type="bibr" rid="B28">Manna et al., 2024</xref>). Subsequently, we tested the hypothesis that in RRMS patients, hypomethylation of the TNF&#x3b1; promoter region upregulates the expression of this gene. Our results showed that at the level of individual CpG islands, the methylation values of CpGs 2&#x2013;4 were significantly hypomethylated. This suggests that the hypomethylation status of the TNF&#x3b1; promoter region in RRMS may be a determinant of increased TNF&#x3b1; mRNA expression. The inverse relationship between TNF&#x3b1; promoter methylation and mRNA expression broadens the understanding of the regulatory mechanisms involved in TNF&#x3b1; expression in RRMS and suggests the potential application of TNF&#x3b1; promoter methylation as an epigenetic marker of RRMS pathogenesis.</p>
<p>Several studies have shown that the expression of several miRNAs involved in innate immunity and inflammation is altered in PBMCs, CSF, and brain tissue of MS patients (<xref ref-type="bibr" rid="B14">Gao et al., 2021</xref>; <xref ref-type="bibr" rid="B41">Ridolfi et al., 2013</xref>). Notably, miRNAs are detectable across body fluids (e.g., plasma, serum, CSF, and urine), and their remarkable stability in extracellular environments makes them attractive candidates for minimally invasive biomarkers. Specific circulating miRNA signatures have been proposed as potential diagnostic and prognostic biomarkers for RRMS, with some profiles correlating with disease activity and treatment responses (<xref ref-type="bibr" rid="B20">Jagot and Davoust, 2016</xref>; <xref ref-type="bibr" rid="B34">Mu&#xf1;oz-San Mart&#xed;n et al., 2022</xref>). Functionally, miRNAs are not merely passive biomarkers; they actively regulate pathogenic processes. For example, miR-155 and miR-326 promote Th1/Th17 inflammatory responses, whereas miR-146a negatively modulates innate immunity (<xref ref-type="bibr" rid="B53">Wu et al., 2016</xref>). Alterations in miRNA expression in oligodendrocytes and neurons can influence demyelination, remyelination, and synaptic integrity, directly linking them to disease progression. These mechanisms suggest that miRNAs may serve not only as biomarkers for disease diagnosis and monitoring but also as potential therapeutic targets, offering new perspectives for precision medicine in MS.</p>
<p>In this regard, miR-130a-3p has attracted attention in clinical settings. A serum study found that miR-130a-3p, along with miR-221-3p and miR-146a-3p, exhibited high accuracy in stratifying patient response, suggesting a potential role as a biomarker (<xref ref-type="bibr" rid="B52">Wade et al., 2020</xref>). Furthermore, a circulating prognostic score (in oncology), based on combined expression, including Exo-miR-130a-3p, demonstrated predictive capabilities in disease progression (<xref ref-type="bibr" rid="B29">Marconi et al., 2022</xref>). Although not specific to MS, these data underscore the potential value of miR-130a-3p as a biomarker in inflammatory and degenerative diseases.</p>
<p>Recently, MiRNA-130a has been found to be implicated in critical processes across various human diseases and miR-130a has been reported to directly target and negatively regulate TNF&#x3b1; expression. Since the involvement of miRNA-130a-3p in the regulation of inflammation during the development of MS has not been fully clarified and remains poorly understood, we evaluated circulating levels of both miRNA130a and TNF&#x3b1;, and obtained the following data. First, increased TNF&#x3b1; and decreased miRNA-130a were observed in serum as well in saliva of MS patients, suggesting that epigenetic regulation of TNF&#x3b1; was mediated, at least partially, through downregulation of miRNA-130a and TNF&#x3b1; promoter methylation upregulation of TNF&#x3b1;. A second interesting result was obtained by evaluating levels of TNF&#x3b1; and miRNA-130a-3p in saliva from RRMS patients and HC subjects, and highlighted comparable trends to those observed in serum. In this regard, saliva represents a promising diagnostic biofluid whose collection is noninvasive and stress-free. Indeed, large quantities can be obtained without need of special storage conditions or clinician training (<xref ref-type="bibr" rid="B16">Goldoni et al., 2022</xref>). Moreover, saliva is easier to handle than blood, it does not clot, it is stable over time and provides little to no risk of cross-contamination or exposure to pathogens, particularly in comparison to CSF sampling that generally involves a highly invasive procedure and hospitalization (<xref ref-type="bibr" rid="B8">Cross et al., 2024</xref>). In addition, the high comparative cost for the procedure and patient compliance make it difficult to perform repeated measurements involving CSF.</p>
<p>Some suggestions have been proposed to explain the presence of TNF&#x3b1; and miRNA in saliva. These include the passage from the blood via active transport, passive intracellular diffusion, microfiltration, production by the salivary gland-infiltrating T helper 1 and T cytotoxic 1 cells and salivary gland epithelium (<xref ref-type="bibr" rid="B15">Gleerup et al., 2019</xref>; <xref ref-type="bibr" rid="B39">Reale et al., 2020</xref>; <xref ref-type="bibr" rid="B7">Costantini et al.2020</xref>).</p>
<p>In the present study, low expression of miR-130a-3p was observed in the RRMS patients. Consistently, the dysregulation of miR-130a-3p has also been identified in other neurodegenerative diseases. In Parkinson&#x2019;s disease, low expression of miR-130a-3p was detected, and overexpression of miR-130a-3p is involved in the neuroprotective role of laminin-511 (LM511)-Yes-associated protein 1 (YAP) signaling against neuron degeneration during Parkinson&#x2019;s disease (<xref ref-type="bibr" rid="B55">Zhang et al., 2017</xref>). In addition, in a study describing the beneficial effect of intermittent fasting in Alzheimer&#x2019;s disease, miR-130a-3p was suggested to be involved in protective mechanisms (<xref ref-type="bibr" rid="B17">Greco and Rameshwar, 2007</xref>). These data support our hypothesis that miR-130a-3p and its decline are implicated in the development of RRMS.</p>
<p>In our RRMS remission cohort, we did not observe a significant correlation between serum TNF&#x3b1; and EDSS, nor between TNF&#x3b1; and salivary miR-130a-3p (inverse trend, r &#x3d; &#x2212;0.13; p &#x3d; 0.71). Two non-exclusive explanations merit consideration. First, statistical considerations: the small sample and relatively narrow EDSS range likely reduced power to detect small-to-moderate associations, increasing the risk of a type II error; thus, the null findings should be interpreted as inconclusive rather than as evidence of no relationship (<xref ref-type="bibr" rid="B44">Serdar et al., 2021</xref>). Second, biological considerations: during clinical remission, peripheral TNF&#x3b1; can reflect transient immune activity and systemic influences, such as circadian variation, rather than the cumulative neurological disability indexed by EDSS, which accrues over years through progression independent of relapses. This temporal and compartmental mismatch can weaken cross-sectional correlations (<xref ref-type="bibr" rid="B48">Zielinski and Gibbons, 2022</xref>). Matrix specificity may further contribute, because cytokine&#x2013;miRNA relationships differ across biological fluids (serum vs. saliva vs. CNS), and saliva, in particular, is sensitive to local oral inflammatory status and pre-analytical factors (e.g., collection timing, fasting, handling), which can add variability to a small patient number (<xref ref-type="bibr" rid="B46">Song et al., 2023</xref>).</p>
<p>Regarding saliva, the inverse but non-significant TNF&#x3b1;&#x2013;miR-130a-3p trend suggests a plausible directionality. However, the effect size appears modest with wide uncertainty; replication in a larger, prospectively powered cohort - ideally with standardized sampling across times of day, is warranted (<xref ref-type="bibr" rid="B25">Lakens, 2022</xref>).</p>
<p>The study of Ruiz-Alguer&#xf3; et al. suggested that MS may begin earlier than previously thought (<xref ref-type="bibr" rid="B42">Ruiz-Alguer&#xf3; et al., 2025</xref>). Thus, in addition to the evaluation of potential risk factors such as exposure to Epstein-Barr virus (EBV) or genetic susceptibility, the early evaluation of potential biomarkers may help to recognize and manage MS earlier in its disease course. Our findings suggesting that the pathogenic mechanisms of RRMS may be mediated, at least in part, by the downregulation of miR-130a-3p and the upregulation of TNF&#x3b1; can pave the way for additional studies. In fact, although an association between TNF&#x3b1; and miR-130a-3p was observed, we could not establish a direct mutual regulatory relationship in RRMS. Nevertheless, the combined analysis of TNF&#x3b1; and miR-130a-3p level variations, including their detection in saliva, may represent a promising approach to support MS diagnosis. In this regard, a greater understanding of the complex molecular processes by which TNF&#x3b1; is involved in the pathogenesis and progression of MS requires further research. Specifically, by increasing the sample size, including subjects with different MS disease courses and tracing clinical parameters of the patients included in this study.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec sec-type="ethics-statement" id="s6">
<title>Ethics statement</title>
<p>The studies involving humans were approved by University G.d&#x2019;Annunzio Chieti-Pescara. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.</p>
</sec>
<sec sec-type="author-contributions" id="s7">
<title>Author contributions</title>
<p>EC: Conceptualization, Formal Analysis, Investigation, Methodology, Writing &#x2013; original draft, Writing &#x2013; review and editing. NG: Validation, Visualization, Writing &#x2013; review and editing. LA: Investigation, Methodology, Writing &#x2013; review and editing. PS: Validation, Visualization, Writing &#x2013; review and editing. MD: Investigation, Methodology, Writing &#x2013; review and editing. FK: Investigation, Writing &#x2013; review and editing. MR: Conceptualization, Project administration, Writing &#x2013; original draft, Writing &#x2013; review and editing.</p>
</sec>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s10">
<title>Generative AI statement</title>
<p>The authors declare that no Generative AI was used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec sec-type="disclaimer" id="s11">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<fn-group>
<fn fn-type="custom" custom-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/67571/overview">Luciana Mosca</ext-link>, Sapienza University of Rome, Italy</p>
</fn>
<fn fn-type="custom" custom-type="reviewed-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2253952/overview">Zaigham Khan</ext-link>, St. Jude Children&#x2019;s Research Hospital, United States</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2527478/overview">Janani Prahlad</ext-link>, University of Minnesota, United States</p>
</fn>
</fn-group>
<ref-list>
<title>References</title>
<ref id="B49">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Agarwal</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Bell</surname>
<given-names>G. W.</given-names>
</name>
<name>
<surname>Nam</surname>
<given-names>J. W.</given-names>
</name>
<name>
<surname>Bartel</surname>
<given-names>D. P.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Predicting effective microRNA target sites in mammalian mRNAs</article-title>. <source>Elife</source> <volume>4</volume>, <fpage>e05005</fpage>. <pub-id pub-id-type="doi">10.7554/eLife.05005</pub-id>
<pub-id pub-id-type="pmid">26267216</pub-id>
</mixed-citation>
</ref>
<ref id="B1">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Al-Temaimi</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Alshammari</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Alroughani</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Analysis of potential microRNA biomarkers for multiple sclerosis</article-title>. <source>Exp. Mol. Pathology</source> <volume>137</volume>, <fpage>104903</fpage>. <pub-id pub-id-type="doi">10.1016/j.yexmp.2024.104903</pub-id>
<pub-id pub-id-type="pmid">38772208</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Arnett</surname>
<given-names>H. A.</given-names>
</name>
<name>
<surname>Mason</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Marino</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Suzuki</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Matsushima</surname>
<given-names>G. K.</given-names>
</name>
<name>
<surname>Ting</surname>
<given-names>J. P.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>TNF alpha promotes proliferation of oligodendrocyte progenitors and remyelination</article-title>. <source>Nat. Neurosci.</source> <volume>4</volume> (<issue>11</issue>), <fpage>1116</fpage>&#x2013;<lpage>1122</lpage>. <pub-id pub-id-type="doi">10.1038/nn738</pub-id>
<pub-id pub-id-type="pmid">11600888</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bagnato</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Sati</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Hemond</surname>
<given-names>C. C.</given-names>
</name>
<name>
<surname>Elliott</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Gauthier</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Harrison</surname>
<given-names>D. M.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Imaging chronic active lesions in multiple sclerosis: a consensus statement</article-title>. <source>Brain</source> <volume>147</volume> (<issue>9</issue>), <fpage>2913</fpage>&#x2013;<lpage>2933</lpage>. <pub-id pub-id-type="doi">10.1093/brain/awae013</pub-id>
<pub-id pub-id-type="pmid">38226694</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Begum</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Cortes</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>MacNeil</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Namaka</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Elevation of tumor necrosis factor &#x3b1; in dorsal root ganglia and spinal cord is associated with neuroimmune modulation of pain in an animal model of multiple sclerosis</article-title>. <source>J. Neuroimmune Pharmacol.</source> <volume>8</volume> (<issue>3</issue>), <fpage>677</fpage>&#x2013;<lpage>690</lpage>. <pub-id pub-id-type="doi">10.1007/s11481-013-9449-5</pub-id>
<pub-id pub-id-type="pmid">23483352</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bradley</surname>
<given-names>J. R.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>TNF-Mediated inflammatory disease</article-title>. <source>J. Pathology</source> <volume>214</volume> (<issue>2</issue>), <fpage>149</fpage>&#x2013;<lpage>160</lpage>. <pub-id pub-id-type="doi">10.1002/path.2287</pub-id>
<pub-id pub-id-type="pmid">18161752</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Celarain</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Tomas-Roig</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Aberrant DNA methylation profile exacerbates inflammation and neurodegeneration in multiple sclerosis patients</article-title>. <source>J. Neuroinflammation</source> <volume>17</volume> (<issue>1</issue>), <fpage>21</fpage>. <pub-id pub-id-type="doi">10.1186/s12974-019-1667-1</pub-id>
<pub-id pub-id-type="pmid">31937331</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Costantini</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Sinjari</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Piscopo</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Porreca</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Reale</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Caputi</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Evaluation of salivary cytokines and vitamin D levels in periodontopathic patients</article-title>. <source>Int. J. Mol. Sci.</source> <volume>21</volume> (<issue>8</issue>), <fpage>2669</fpage>. <pub-id pub-id-type="doi">10.3390/ijms21082669</pub-id>
<pub-id pub-id-type="pmid">32290474</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cross</surname>
<given-names>A. H.</given-names>
</name>
<name>
<surname>Gelfand</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Thebault</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Bennett</surname>
<given-names>J. L.</given-names>
</name>
<name>
<surname>von B&#xfc;dingen</surname>
<given-names>H. C.</given-names>
</name>
<name>
<surname>Cameron</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Emerging cerebrospinal fluid biomarkers of disease activity and progression in multiple sclerosis</article-title>. <source>JAMA Neurol.</source> <volume>81</volume> (<issue>4</issue>), <fpage>373</fpage>&#x2013;<lpage>383</lpage>. <pub-id pub-id-type="doi">10.1001/jamaneurol.2024.0017</pub-id>
<pub-id pub-id-type="pmid">38466277</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Falvo</surname>
<given-names>J. V.</given-names>
</name>
<name>
<surname>Tsytsykova</surname>
<given-names>A. V.</given-names>
</name>
<name>
<surname>Goldfeld</surname>
<given-names>A. E.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Transcriptional control of the TNF gene</article-title>. <source>Curr. Dir. Autoimmun.</source> <volume>11</volume>, <fpage>27</fpage>&#x2013;<lpage>60</lpage>. <pub-id pub-id-type="doi">10.1159/000289196</pub-id>
<pub-id pub-id-type="pmid">20173386</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ferrari</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Gallo</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Spisni</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Antonelli</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Meleti</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Pertinhez</surname>
<given-names>T. A.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Human serum and salivary metabolomes: diversity and closeness</article-title>. <source>Int. J. Mol. Sci.</source> <volume>24</volume> (<issue>23</issue>), <fpage>16603</fpage>. <pub-id pub-id-type="doi">10.3390/ijms242316603</pub-id>
<pub-id pub-id-type="pmid">38068926</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fleige</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Pfaffl</surname>
<given-names>M. W.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>RNA integrity and the effect on the real-time qRT-PCR performance</article-title>. <source>Mol. Aspects Med.</source> <volume>27</volume> (<issue>2-3</issue>), <fpage>126</fpage>&#x2013;<lpage>139</lpage>. <pub-id pub-id-type="doi">10.1016/j.mam.2005.12.003</pub-id>
<pub-id pub-id-type="pmid">16469371</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fresegna</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Bullitta</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Musella</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Rizzo</surname>
<given-names>F. R.</given-names>
</name>
<name>
<surname>De Vito</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Guadalupi</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Re-Examining the role of TNF in MS pathogenesis and therapy</article-title>. <source>Cells</source> <volume>9</volume> (<issue>10</issue>), <fpage>2290</fpage>. <pub-id pub-id-type="doi">10.3390/cells9102290</pub-id>
<pub-id pub-id-type="pmid">33066433</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gandhi</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>miRNA in multiple sclerosis: search for novel biomarkers</article-title>. <source>Mult. Scler.</source> <volume>21</volume> (<issue>9</issue>), <fpage>1095</fpage>&#x2013;<lpage>1103</lpage>. <pub-id pub-id-type="doi">10.1177/1352458515578771</pub-id>
<pub-id pub-id-type="pmid">25921051</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Han</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>MicroRNA in multiple sclerosis</article-title>. <source>Clin. Chim. Acta</source> <volume>516</volume>, <fpage>92</fpage>&#x2013;<lpage>99</lpage>. <pub-id pub-id-type="doi">10.1016/j.cca.2021.01.020</pub-id>
<pub-id pub-id-type="pmid">33545109</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gleerup</surname>
<given-names>H. S.</given-names>
</name>
<name>
<surname>Hasselbalch</surname>
<given-names>S. G.</given-names>
</name>
<name>
<surname>Simonsen</surname>
<given-names>A. H.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Biomarkers for alzheimer&#x27;s disease in saliva: a systematic review</article-title>. <source>Dis. Markers</source> <volume>2019</volume>, <fpage>4761054</fpage>. <pub-id pub-id-type="doi">10.1155/2019/4761054</pub-id>
<pub-id pub-id-type="pmid">31191751</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Goldoni</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Dolci</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Boccalari</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Inchingolo</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Paghi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Strambini</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Salivary biomarkers of neurodegenerative and demyelinating diseases and biosensors for their detection</article-title>. <source>Ageing Res. Rev.</source> <volume>76</volume>, <fpage>101587</fpage>. <pub-id pub-id-type="doi">10.1016/j.arr.2022.101587</pub-id>
<pub-id pub-id-type="pmid">35151849</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Greco</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Rameshwar</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>MicroRNAs regulate synthesis of the neurotransmitter substance P in human mesenchymal stem cell-derived neuronal cells</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>104</volume> (<issue>39</issue>), <fpage>15484</fpage>&#x2013;<lpage>15489</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.0703037104</pub-id>
<pub-id pub-id-type="pmid">17855557</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Heir</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Abbasi</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Komal</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Altimimi</surname>
<given-names>H. F.</given-names>
</name>
<name>
<surname>Franquin</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Moschou</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Astrocytes are the source of TNF mediating homeostatic synaptic plasticity</article-title>. <source>J. Neurosci.</source> <volume>44</volume> (<issue>14</issue>), <fpage>e2278222024</fpage>. <pub-id pub-id-type="doi">10.1523/JNEUROSCI.2278-22.2024</pub-id>
<pub-id pub-id-type="pmid">38395613</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hofman</surname>
<given-names>F. M.</given-names>
</name>
<name>
<surname>Hinton</surname>
<given-names>D. R.</given-names>
</name>
<name>
<surname>Johnson</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Merrill</surname>
<given-names>J. E.</given-names>
</name>
</person-group> (<year>1989</year>). <article-title>Tumor necrosis factor identified in multiple sclerosis brain</article-title>. <source>J. Exp. Med.</source> <volume>170</volume> (<issue>2</issue>), <fpage>607</fpage>&#x2013;<lpage>612</lpage>. <pub-id pub-id-type="doi">10.1084/jem.170.2.607</pub-id>
<pub-id pub-id-type="pmid">2754393</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jagot</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Davoust</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Is it worth considering circulating microRNAs in multiple sclerosis?</article-title> <source>Front. Immunol.</source> <volume>7</volume>, <fpage>129</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2016.00129</pub-id>
<pub-id pub-id-type="pmid">27092141</pub-id>
</mixed-citation>
</ref>
<ref id="B50">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Junker</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Krumbholz</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Eisele</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Mohan</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Augstein</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Bittner</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2009</year>). <article-title>MicroRNA profiling of multiple sclerosis lesions identifies modulators of the regulatory protein CD47</article-title>. <source>Brain</source> <volume>132</volume> (<issue>Pt 12</issue>), <fpage>3342</fpage>&#x2013;<lpage>3352</lpage>. <pub-id pub-id-type="doi">10.1093/brain/awp300</pub-id>
<pub-id pub-id-type="pmid">19952055</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kahl</surname>
<given-names>K. G.</given-names>
</name>
<name>
<surname>Kruse</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Faller</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Weiss</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Rieckmann</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Expression of tumor necrosis factor-alpha and interferon-gamma mRNA in blood cells correlates with depression scores during an acute attack in patients with multiple sclerosis</article-title>. <source>Psychoneuroendocrinology</source> <volume>27</volume> (<issue>6</issue>), <fpage>671</fpage>&#x2013;<lpage>681</lpage>. <pub-id pub-id-type="doi">10.1016/s0306-4530(01)00068-3</pub-id>
<pub-id pub-id-type="pmid">12084660</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kemanetzoglou</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Andreadou</surname>
<given-names>E.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>CNS demyelination with TNF-&#x3b1; blockers</article-title>. <source>Curr. Neurol. Neurosci. Rep.</source> <volume>17</volume> (<issue>4</issue>), <fpage>36</fpage>. <pub-id pub-id-type="doi">10.1007/s11910-017-0742-1</pub-id>
<pub-id pub-id-type="pmid">28337644</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Koch</surname>
<given-names>M. W.</given-names>
</name>
<name>
<surname>Metz</surname>
<given-names>L. M.</given-names>
</name>
<name>
<surname>Kovalchuk</surname>
<given-names>O.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Epigenetics and miRNAs in the diagnosis and treatment of multiple sclerosis</article-title>. <source>Trends Mol. Med.</source> <volume>19</volume> (<issue>1</issue>), <fpage>23</fpage>&#x2013;<lpage>30</lpage>. <pub-id pub-id-type="doi">10.1016/j.molmed.2012.10.008</pub-id>
<pub-id pub-id-type="pmid">23153574</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kurtzke</surname>
<given-names>J. F.</given-names>
</name>
</person-group> (<year>1983</year>). <article-title>Rating neurologic impairment in multiple sclerosis: an expanded disability status scale (EDSS)</article-title>. <source>Neurology</source> <volume>33</volume> (<issue>11</issue>), <fpage>1444</fpage>&#x2013;<lpage>1452</lpage>. <pub-id pub-id-type="doi">10.1212/wnl.33.11.1444</pub-id>
<pub-id pub-id-type="pmid">6685237</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lakens</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Sample size justification</article-title>. <source>Collabra Psychol.</source> <volume>8</volume> (<issue>1</issue>), <fpage>33267</fpage>. <pub-id pub-id-type="doi">10.1525/collabra.33267</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livak</surname>
<given-names>K. J.</given-names>
</name>
<name>
<surname>Schmittgen</surname>
<given-names>T. D.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method</article-title>. <source>Methods</source> <volume>25</volume> (<issue>4</issue>), <fpage>402</fpage>&#x2013;<lpage>408</lpage>. <pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id>
<pub-id pub-id-type="pmid">11846609</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lublin</surname>
<given-names>F. D.</given-names>
</name>
<name>
<surname>Reingold</surname>
<given-names>S. C.</given-names>
</name>
<name>
<surname>Cohen</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Cutter</surname>
<given-names>G. R.</given-names>
</name>
<name>
<surname>S&#xf8;rensen</surname>
<given-names>P. S.</given-names>
</name>
<name>
<surname>Thompson</surname>
<given-names>A. J.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>Defining the clinical course of multiple sclerosis: the 2013 revisions</article-title>. <source>Neurology</source> <volume>83</volume> (<issue>3</issue>), <fpage>278</fpage>&#x2013;<lpage>286</lpage>. <pub-id pub-id-type="doi">10.1212/WNL.0000000000000560</pub-id>
<pub-id pub-id-type="pmid">24871874</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Manna</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>De Benedittis</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Porro</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>A comprehensive examination of the role of epigenetic factors in multiple sclerosis</article-title>. <source>Int. J. Mol. Sci.</source> <volume>25</volume> (<issue>16</issue>), <fpage>8921</fpage>. <pub-id pub-id-type="doi">10.3390/ijms25168921</pub-id>
<pub-id pub-id-type="pmid">39201606</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marconi</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Croce</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Chiorino</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Rossi</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Guana</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Profumo</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>A circulating risk score, based on combined expression of Exo-miR-130a-3p and fibrinopeptide A, as predictive biomarker of relapse in resectable non-small cell lung cancer patients</article-title>. <source>Cancers</source> <volume>14</volume> (<issue>14</issue>), <fpage>3412</fpage>. <pub-id pub-id-type="doi">10.3390/cancers14143412</pub-id>
<pub-id pub-id-type="pmid">35884472</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mazziotti</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Crescenzo</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Turano</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Guandalini</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Bertolazzo</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ziccardi</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>The contribution of tumor necrosis factor to multiple sclerosis: a possible role in progression independent of relapse?</article-title> <source>J. Neuroinflammation</source> <volume>21</volume> (<issue>1</issue>), <fpage>209</fpage>. <pub-id pub-id-type="doi">10.1186/s12974-024-03193-6</pub-id>
<pub-id pub-id-type="pmid">39169320</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>McCoy</surname>
<given-names>M. K.</given-names>
</name>
<name>
<surname>Tansey</surname>
<given-names>M. G.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>TNF signaling inhibition in the CNS: implications for normal brain function and neurodegenerative disease</article-title>. <source>J. Neuroinflammation</source> <volume>5</volume>, <fpage>45</fpage>. <pub-id pub-id-type="doi">10.1186/1742-2094-5-45</pub-id>
<pub-id pub-id-type="pmid">18925972</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mehta</surname>
<given-names>A. K.</given-names>
</name>
<name>
<surname>Gracias</surname>
<given-names>D. T.</given-names>
</name>
<name>
<surname>Croft</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>TNF activity and T cells</article-title>. <source>Cytokine</source> <volume>101</volume>, <fpage>14</fpage>&#x2013;<lpage>18</lpage>. <pub-id pub-id-type="doi">10.1016/j.cyto.2016.08.003</pub-id>
<pub-id pub-id-type="pmid">27531077</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mu&#xf1;oz-Culla</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Irizar</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>S&#xe1;enz-Cuesta</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Castillo-Trivi&#xf1;o</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Osorio-Querejeta</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Sep&#xfa;lveda</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>SncRNA (microRNA and snoRNA) opposite expression pattern found in multiple sclerosis relapse and remission is sex dependent</article-title>. <source>Sci. Rep.</source> <volume>6</volume> (<issue>1</issue>), <fpage>20126</fpage>. <pub-id pub-id-type="doi">10.1038/srep20126</pub-id>
<pub-id pub-id-type="pmid">26831009</pub-id>
</mixed-citation>
</ref>
<ref id="B34">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mu&#xf1;oz-San Mart&#xed;n</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>G&#xf3;mez</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Quiroga-Varela</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Gonzalez-Del R&#xed;o</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Robles Cede&#xf1;o</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>&#xc1;lvarez</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>miRNA signature in CSF from patients with primary progressive multiple sclerosis</article-title>. <source>Neurology, Neuroimmunol. and Neuroinflammation</source> <volume>10</volume> (<issue>1</issue>), <fpage>e200069</fpage>. <pub-id pub-id-type="doi">10.1212/NXI.0000000000200069</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Olsson</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Barcellos</surname>
<given-names>L. F.</given-names>
</name>
<name>
<surname>Alfredsson</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Interactions between genetic, lifestyle and environmental risk factors for multiple sclerosis</article-title>. <source>Nat. Rev. Neurol.</source> <volume>13</volume> (<issue>1</issue>), <fpage>25</fpage>&#x2013;<lpage>36</lpage>. <pub-id pub-id-type="doi">10.1038/nrneurol.2016.187</pub-id>
<pub-id pub-id-type="pmid">27934854</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pahlevan Kakhki</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Giordano</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Starvaggi Cucuzza</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Venkata</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Badam</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Samudyata</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>A genetic-epigenetic interplay at 1q21.1 locus underlies CHD1L-mediated vulnerability to primary progressive multiple sclerosis</article-title>. <source>Nat. Commun.</source> <volume>15</volume> (<issue>1</issue>), <fpage>6419</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-024-50794-z</pub-id>
<pub-id pub-id-type="pmid">39079955</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Polman</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Reingold</surname>
<given-names>S. C.</given-names>
</name>
<name>
<surname>Banwell</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Clanet</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Cohen</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Filippi</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>Diagnostic criteria for multiple sclerosis: 2010 revisions to the McDonald criteria</article-title>. <source>Ann. Neurology</source> <volume>69</volume> (<issue>2</issue>), <fpage>292</fpage>&#x2013;<lpage>302</lpage>. <pub-id pub-id-type="doi">10.1002/ana.22366</pub-id>
<pub-id pub-id-type="pmid">21387374</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Probert</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>TNF and its receptors in the CNS: the essential, the desirable and the deleterious effects</article-title>. <source>Neuroscience</source> <volume>302</volume>, <fpage>2</fpage>&#x2013;<lpage>22</lpage>. <pub-id pub-id-type="doi">10.1016/j.neuroscience.2015.06.038</pub-id>
<pub-id pub-id-type="pmid">26117714</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Reale</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Velluto</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Di Nicola</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>D&#x27;Angelo</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Costantini</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Marchioni</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Cholinergic markers and cytokines in OSA patients</article-title>. <source>Int. J. Mol. Sci.</source> <volume>21</volume> (<issue>9</issue>), <fpage>3264</fpage>. <pub-id pub-id-type="doi">10.3390/ijms21093264</pub-id>
<pub-id pub-id-type="pmid">32380702</pub-id>
</mixed-citation>
</ref>
<ref id="B40">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ribeiro</surname>
<given-names>C. M.</given-names>
</name>
<name>
<surname>Oliveira</surname>
<given-names>S. R.</given-names>
</name>
<name>
<surname>Alfieri</surname>
<given-names>D. F.</given-names>
</name>
<name>
<surname>Flauzino</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kaimen-Maciel</surname>
<given-names>D. R.</given-names>
</name>
<name>
<surname>Sim&#xe3;o</surname>
<given-names>A. N. C.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Tumor necrosis factor alpha (TNF-&#x3b1;) and its soluble receptors are associated with disability, disability progression and clinical forms of multiple sclerosis</article-title>. <source>Inflamm. Res.</source> <volume>68</volume> (<issue>12</issue>), <fpage>1049</fpage>&#x2013;<lpage>1059</lpage>. <pub-id pub-id-type="doi">10.1007/s00011-019-01286-0</pub-id>
<pub-id pub-id-type="pmid">31559449</pub-id>
</mixed-citation>
</ref>
<ref id="B41">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ridolfi</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Fenoglio</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Cantoni</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Calvi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>De Riz</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Pietroboni</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Expression and genetic analysis of MicroRNAs involved in multiple sclerosis</article-title>. <source>Int. J. Mol. Sci.</source> <volume>14</volume>, <fpage>4375</fpage>&#x2013;<lpage>4384</lpage>. <pub-id pub-id-type="doi">10.3390/ijms14034375</pub-id>
<pub-id pub-id-type="pmid">23439547</pub-id>
</mixed-citation>
</ref>
<ref id="B42">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ruiz-Alguer&#xf3;</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Chertcoff</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Marrie</surname>
<given-names>R. A.</given-names>
</name>
<name>
<surname>Tremlett</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Health care use before multiple sclerosis symptom onset</article-title>. <source>JAMA Netw. Open</source> <volume>8</volume> (<issue>8</issue>), <fpage>e2524635</fpage>. <pub-id pub-id-type="doi">10.1001/jamanetworkopen.2025.24635</pub-id>
<pub-id pub-id-type="pmid">40748636</pub-id>
</mixed-citation>
</ref>
<ref id="B43">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sayed</surname>
<given-names>B. A.</given-names>
</name>
<name>
<surname>Christy</surname>
<given-names>A. L.</given-names>
</name>
<name>
<surname>Walker</surname>
<given-names>M. E.</given-names>
</name>
<name>
<surname>Brown</surname>
<given-names>M. A.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Meningeal mast cells affect early T cell central nervous system infiltration and blood-brain barrier integrity through TNF: a role for neutrophil recruitment?</article-title> <source>J. Immunol.</source> <volume>184</volume> (<issue>12</issue>), <fpage>6891</fpage>&#x2013;<lpage>6900</lpage>. <pub-id pub-id-type="doi">10.4049/jimmunol.1000126</pub-id>
<pub-id pub-id-type="pmid">20488789</pub-id>
</mixed-citation>
</ref>
<ref id="B44">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Serdar</surname>
<given-names>C. C.</given-names>
</name>
<name>
<surname>Cihan</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Y&#xfc;cel</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Serdar</surname>
<given-names>M. A.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Sample size, power and effect size revisited: simplified and practical approaches in pre-clinical, clinical and laboratory studies</article-title>. <source>Biochem. Medica</source> <volume>31</volume> (<issue>1</issue>), <fpage>27</fpage>&#x2013;<lpage>53</lpage>. <pub-id pub-id-type="doi">10.11613/bm.2021.010502</pub-id>
<pub-id pub-id-type="pmid">33380887</pub-id>
</mixed-citation>
</ref>
<ref id="B45">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sharief</surname>
<given-names>M. K.</given-names>
</name>
<name>
<surname>Hentges</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>1991</year>). <article-title>Association between tumor necrosis factor-alpha and disease progression in patients with multiple sclerosis</article-title>. <source>N. Engl. J. Med.</source> <volume>325</volume> (<issue>7</issue>), <fpage>467</fpage>&#x2013;<lpage>472</lpage>. <pub-id pub-id-type="doi">10.1056/NEJM199108153250704</pub-id>
<pub-id pub-id-type="pmid">1852181</pub-id>
</mixed-citation>
</ref>
<ref id="B51">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sokratous</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Dardiotis</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Bellou</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Tsouris</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Michalopoulou</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Dardioti</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>CpG island methylation patterns in relapsing-remitting multiple sclerosis</article-title>. <source>J. Mol. Neurosci.</source> <volume>64</volume>, <fpage>478</fpage>&#x2013;<lpage>484</lpage>. <pub-id pub-id-type="doi">10.1007/s12031-018-1046-x</pub-id>
<pub-id pub-id-type="pmid">29516350</pub-id>
</mixed-citation>
</ref>
<ref id="B46">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Bai</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Ying</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Promising applications of human-derived saliva biomarker testing in clinical diagnostics</article-title>. <source>Int. J. Oral Sci.</source> <volume>15</volume> (<issue>1</issue>), <fpage>2</fpage>. <pub-id pub-id-type="doi">10.1038/s41368-022-00209-w</pub-id>
<pub-id pub-id-type="pmid">36596771</pub-id>
</mixed-citation>
</ref>
<ref id="B52">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wade</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>McGarry</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Wade</surname>
<given-names>S. C.</given-names>
</name>
<name>
<surname>Fearon</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>Veale</surname>
<given-names>D. J.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Serum MicroRNA signature as a diagnostic and therapeutic marker in patients with psoriatic arthritis</article-title>. <source>J. Rheumatol.</source> <volume>47</volume> (<issue>12</issue>), <fpage>1760</fpage>&#x2013;<lpage>1767</lpage>. <pub-id pub-id-type="doi">10.3899/jrheum.190602</pub-id>
<pub-id pub-id-type="pmid">32115427</pub-id>
</mixed-citation>
</ref>
<ref id="B53">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Zeng</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Deng</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>MicroRNA-210 overexpression promotes psoriasis-like inflammation by inducing Th1 and Th17 cell differentiation</article-title>. <source>J. Clin. Invest.</source> <volume>128</volume> (<issue>6</issue>), <fpage>2551</fpage>&#x2013;<lpage>2568</lpage>. <pub-id pub-id-type="doi">10.1172/JCI97426</pub-id>
<pub-id pub-id-type="pmid">29757188</pub-id>
</mixed-citation>
</ref>
<ref id="B47">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xavier</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Campagna</surname>
<given-names>M. P.</given-names>
</name>
<name>
<surname>Maltby</surname>
<given-names>V. E.</given-names>
</name>
<name>
<surname>Kilpatrick</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Taylor</surname>
<given-names>B. V.</given-names>
</name>
<name>
<surname>Butzkueven</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Interferon beta treatment is a potent and targeted epigenetic modifier in multiple sclerosis</article-title>. <source>Front. Immunol.</source> <volume>14</volume>, <fpage>1162796</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2023.1162796</pub-id>
<pub-id pub-id-type="pmid">37325639</pub-id>
</mixed-citation>
</ref>
<ref id="B54">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Parkhurst</surname>
<given-names>C. N.</given-names>
</name>
<name>
<surname>Hayes</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Gan</surname>
<given-names>W. B.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Peripheral elevation of TNF-&#x3b1; leads to early synaptic abnormalities in the mouse somatosensory cortex in experimental autoimmune encephalomyelitis</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>110</volume> (<issue>25</issue>), <fpage>10306</fpage>&#x2013;<lpage>10311</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.1222895110</pub-id>
<pub-id pub-id-type="pmid">23733958</pub-id>
</mixed-citation>
</ref>
<ref id="B55">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Toledo</surname>
<given-names>E. M.</given-names>
</name>
<name>
<surname>Gyllborg</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Salt&#xf3;</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Carlos Villaescusa</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Niche-derived laminin-511 promotes midbrain dopaminergic neuron survival and differentiation through YAP</article-title>. <source>Sci. Signal</source> <volume>10</volume> (<issue>493</issue>), <fpage>eaal4165</fpage>. <pub-id pub-id-type="doi">10.1126/scisignal.aal4165</pub-id>
<pub-id pub-id-type="pmid">28831020</pub-id>
</mixed-citation>
</ref>
<ref id="B48">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zielinski</surname>
<given-names>M. R.</given-names>
</name>
<name>
<surname>Gibbons</surname>
<given-names>A. J.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Neuroinflammation, sleep, and circadian rhythms</article-title>. <source>Front. Cell. Infect. Microbiol.</source> <volume>12</volume>, <fpage>853096</fpage>. <pub-id pub-id-type="doi">10.3389/fcimb.2022.853096</pub-id>
<pub-id pub-id-type="pmid">35392608</pub-id>
</mixed-citation>
</ref>
</ref-list>
</back>
</article>