<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Mol. Biosci.</journal-id>
<journal-title>Frontiers in Molecular Biosciences</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Mol. Biosci.</abbrev-journal-title>
<issn pub-type="epub">2296-889X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1512970</article-id>
<article-id pub-id-type="doi">10.3389/fmolb.2025.1512970</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Molecular Biosciences</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>A CRISPR-Cas-based recombinase polymerase amplification assay for ultra-sensitive detection of active <italic>Trypanosoma brucei evansi</italic> infections</article-title>
<alt-title alt-title-type="left-running-head">&#xc1;lvarez-Rodr&#xed;guez et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fmolb.2025.1512970">10.3389/fmolb.2025.1512970</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>&#xc1;lvarez-Rodr&#xed;guez</surname>
<given-names>Andr&#xe9;s</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1994392/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Zeng</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jin</surname>
<given-names>Bo-Kyung</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1992639/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Stijlemans</surname>
<given-names>Benoit</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2545907/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Geldhof</surname>
<given-names>Peter</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/389988/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Magez</surname>
<given-names>Stefan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/497719/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Lab of Cellular and Molecular Immunology</institution>, <institution>Brussels Center for Immunology (BCIM)</institution>, <institution>Vrije Universiteit Brussel</institution>, <addr-line>Brussels</addr-line>, <country>Belgium</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Biochemistry and Microbiology (WE10)</institution>, <institution>Ghent University</institution>, <addr-line>Ghent</addr-line>, <country>Belgium</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Myeloid Cell Immunology Lab</institution>, <institution>VIB Center for Inflammation Research</institution>, <addr-line>Brussels</addr-line>, <country>Belgium</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Laboratory for Parasitology and Parasitic Diseases</institution>, <institution>Department of Translational Physiology</institution>, <institution>Infectiology and Public Health (DI04)</institution>, <institution>Ghent University</institution>, <addr-line>Ghent</addr-line>, <country>Belgium</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1318516/overview">Rohit Upadhyay</ext-link>, Tulane University, United States</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/258879/overview">Pawan Kumar Kanaujia</ext-link>, Mahayogi Gorakhnath University, Gorakhpur, India</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2789811/overview">Munna Lal Yadav</ext-link>, Indian Council of Medical Research (ICMR), India</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/313974/overview">Prakash Ghosh</ext-link>, International Centre for Diarrhoeal Disease Research (ICDDR), Bangladesh</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2735518/overview">Debolina Hati</ext-link>, National Institutes of Health (NIH), United States</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Andr&#xe9;s &#xc1;lvarez-Rodr&#xed;guez, <email>andres.alvarez.rodriguez@vub.be</email>; Stefan Magez, <email>stefan.magez@vub.be</email>
</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>14</day>
<month>02</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>12</volume>
<elocation-id>1512970</elocation-id>
<history>
<date date-type="received">
<day>17</day>
<month>10</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>06</day>
<month>01</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 &#xc1;lvarez-Rodr&#xed;guez, Li, Jin, Stijlemans, Geldhof and Magez.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>&#xc1;lvarez-Rodr&#xed;guez, Li, Jin, Stijlemans, Geldhof and Magez</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Introduction</title>
<p>Control of <italic>Trypanosoma brucei evansi</italic> (<italic>T. b. evansi</italic>) infections remains a significant challenge in managing Surra, a widespread veterinary disease affecting both wild and domestic animals. In the absence of an effective vaccine, accurate diagnosis followed by treatment is crucial for successful disease management. However, existing diagnostic methods often fail to detect active infections, particularly in field conditions. Recent advancements in CRISPR-Cas technology, combined with state-of-the-art isothermal amplification assays, offer a promising solution. This approach has led us to the development of a <italic>Tev</italic>RPA-CRISPR assay, a highly sensitive and specific <italic>T. b. evansi</italic> diagnostic tool suitable for both laboratory and field settings.</p>
</sec>
<sec>
<title>Methods</title>
<p>First, the <italic>Tev</italic>CRISPR-Cas12b cleavage assay was developed and optimized, and its analytical sensitivity was evaluated. Next, this technology was integrated with the <italic>Tev</italic>RPA to create the <italic>Tev</italic>RPA-CRISPR test, with the reaction conditions being optimized and its analytical sensitivity and specificity assessed. Finally, the test&#x2019;s accuracy in detecting both active and cured <italic>T. b. evansi</italic> infections was evaluated.</p>
</sec>
<sec>
<title>Results</title>
<p>The optimized <italic>Tev</italic>CRISPR-Cas12b cleavage assay demonstrated the ability to detect <italic>T. b. evansi</italic> target DNA at picomolar concentrations. Integrating <italic>Tev</italic>CRISPR-Cas12b with RPA in Two-Pot and One-Pot <italic>Tev</italic>RPA-CRISPR tests achieved up to a 100-fold increase in analytical sensitivity over RPA alone, detecting attomolar concentrations of <italic>T. b. evansi</italic> target DNA, while maintaining analytical specificity for <italic>T. b. evansi</italic>. Both assays exhibited performance comparable to the gold standard <italic>Tev</italic>PCR in experimental mouse infections, validating their effectiveness for detecting active infections and assessing treatment efficacy.</p>
</sec>
<sec>
<title>Discussion</title>
<p>The <italic>Tev</italic>RPA-CRISPR tests prove highly effective for diagnosing active infections and assessing treatment efficacy, while being adaptable for both laboratory and field use. Thus, the <italic>Tev</italic>RPA-CRISPR assays emerge as a promising addition to current diagnostic tools, offering efficient and reliable detection of active <italic>T. b. evansi</italic> infections.</p>
</sec>
</abstract>
<kwd-group>
<kwd>Trypanosoma brucei evansi</kwd>
<kwd>Surra</kwd>
<kwd>CRISPR-Cas</kwd>
<kwd>RPA</kwd>
<kwd>diagnosis</kwd>
</kwd-group>
<contract-num rid="cn001">1S91225N</contract-num>
<contract-sponsor id="cn001">Fonds Wetenschappelijk Onderzoek<named-content content-type="fundref-id">10.13039/501100003130</named-content>
</contract-sponsor>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Molecular Diagnostics and Therapeutics</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1">
<title>Introduction</title>
<p>
<italic>Trypanosoma brucei evansi</italic> (<italic>T. b. evansi</italic>) is a hemoflagellate parasite causing Surra, the most widespread trypanosomal disease, primarily affecting domestic and wild animals including camels, cattle, buffaloes, horses, pigs, or deer (<xref ref-type="bibr" rid="B26">Kim et al., 2023</xref>; <xref ref-type="bibr" rid="B31">Li et al., 2020</xref>). Unlike other subspecies of <italic>Trypanosoma brucei</italic> (<italic>T. brucei</italic>) such as <italic>T. b. rhodesiense</italic> and <italic>T. b. gambiense</italic> (the causative agents of the human disease Sleeping Sickness), <italic>T. b. evansi</italic> has evolved to rely on mechanical transmission via biting flies (e.g., <italic>Tabanus</italic>, <italic>Glossina, Stomoxys</italic>, <italic>Haematopoda</italic>, <italic>Chrypsos</italic> or <italic>Lyperosia</italic>) or mammals (e.g., <italic>Desmodus rotundus</italic>) (<xref ref-type="bibr" rid="B10">Brun et al., 1998</xref>; <xref ref-type="bibr" rid="B5">Austen and Barbosa, 2021</xref>; <xref ref-type="bibr" rid="B43">Pays et al., 2023</xref>). This adaptation has allowed <italic>T. b. evansi</italic> to spread beyond the geographical constraints of tsetse-transmitted trypanosomes, widening its geographical distribution beyond Africa (<xref ref-type="bibr" rid="B33">Lun and Desser, 1995</xref>). Hence, it is prevalent in Asia, Africa, and South America, and has occasionally even been reported in Europe (<xref ref-type="bibr" rid="B4">Aregawi et al., 2019</xref>; <xref ref-type="bibr" rid="B19">Gutierrez et al., 2010</xref>). While <italic>T. b. evansi</italic> has traditionally been considered non-infective to humans, reports exist of atypical Human Trypanosomiasis (aHT) cases in Vietnam, India, and Sri Lanka, thereby highlighting the potential zoonotic risk associated with this parasite (<xref ref-type="bibr" rid="B44">Powar et al., 2006</xref>; <xref ref-type="bibr" rid="B23">Joshi et al., 2005</xref>; <xref ref-type="bibr" rid="B54">Van Vinh Chau et al., 2016</xref>). This situation is currently exacerbated by climate change-driven redistribution of vectors, as well as the encroachment of grazing areas into wildlife reservoirs, resulting in heightened human-parasite interactions (<xref ref-type="bibr" rid="B35">Mojahed et al., 2022</xref>; <xref ref-type="bibr" rid="B25">Kasozi et al., 2021</xref>).</p>
<p>In the absence of a vaccine against <italic>T. b. evansi</italic> trypanosomosis, current recommended control measures depend on accurate diagnosis, followed by individualized treatment of the infected animals (<xref ref-type="bibr" rid="B45">Radwanska et al., 2008</xref>). Available diagnostic tests for <italic>T. b. evansi</italic> differentiate between <italic>T. b. evansi</italic> type A, characterized by the presence of the Rode <italic>Trypanozoon</italic> antigenic type 1.2 Variant Surface Glycoprotein (RoTat1.2 VSG) gene (<xref ref-type="bibr" rid="B37">Ngaira et al., 2004</xref>), or <italic>T. b. evansi</italic> type B, characterized by the absence of that gene (<xref ref-type="bibr" rid="B8">Birhanu et al., 2016</xref>). While <italic>T. b. evansi</italic> type B trypanosomosis is restricted to certain regions in Africa (<xref ref-type="bibr" rid="B8">Birhanu et al., 2016</xref>; <xref ref-type="bibr" rid="B38">Ngaira et al., 2005</xref>; <xref ref-type="bibr" rid="B6">Behour and Abd El Fattah, 2023</xref>; <xref ref-type="bibr" rid="B40">Njiru et al., 2006</xref>; <xref ref-type="bibr" rid="B47">Salim et al., 2011</xref>; <xref ref-type="bibr" rid="B9">Boushaki et al., 2019</xref>), <italic>T. b. evansi</italic> type A is spread worldwide (<xref ref-type="bibr" rid="B4">Aregawi et al., 2019</xref>; <xref ref-type="bibr" rid="B19">Gutierrez et al., 2010</xref>). Diagnosis of <italic>T. b. evansi</italic> infections involves direct visualization of the parasite, detection of parasite-induced host antibodies (Abs), or detection of parasite nucleic acids (<xref ref-type="bibr" rid="B50">Tehseen et al., 2015</xref>). While microscopy-based techniques can effectively detect <italic>T. b. evansi</italic> parasites in infected samples, their use is limited to the acute stage of infection, failing to identify both latent and chronic stages when parasitemia is low (<xref ref-type="bibr" rid="B7">Behour et al., 2019</xref>). Additionally, these techniques require specialized equipment and trained personnel to ensure reliability, which limits their feasibility for point-of-care (POC) field testing. Therefore, the current standard protocol for assessing possible <italic>T. b. evansi</italic> infections recommends the use of antibody-based tests such as the Card Agglutination Test (CATT/<italic>T. b. evansi</italic>), the Latex Agglutination Test (LATEX/<italic>T. b. evansi</italic>), and the Enzyme-Linked Immunosorbent Assay (ELISA/<italic>T. b. evansi</italic>) (<xref ref-type="bibr" rid="B42">Pathak et al., 1997</xref>; <xref ref-type="bibr" rid="B28">Lejon et al., 2005</xref>; <xref ref-type="bibr" rid="B46">Reyna-Bello et al., 1998</xref>; <xref ref-type="bibr" rid="B56">WOAH, 2021</xref>). These tests are indeed useful for field testing but cannot discriminate between previous exposure to <italic>T. b. evansi</italic> or current infections. The presence of parasite-induced host Abs may indicate an active or past infection, but it can also result from repeated exposure to the parasite without successful infection or from polyclonal B cell activation due to other infectious agents (<xref ref-type="bibr" rid="B20">Harris and Gause, 2011</xref>; <xref ref-type="bibr" rid="B17">Fikru et al., 2015</xref>). Moreover, these tests often exhibit low specificity due to cross-reactions with Abs against closely related parasites, resulting in low specificity and low positive predictive values (PPV) (<xref ref-type="bibr" rid="B17">Fikru et al., 2015</xref>; <xref ref-type="bibr" rid="B2">Alvarez-Rodriguez et al., 2022</xref>). Consequently, the World Organization for Animal Health recommends the verification of the previous test results by specific Polymerase Chain Reaction (PCR) amplification in a controlled laboratory setting (<xref ref-type="bibr" rid="B56">WOAH, 2021</xref>). Recommended specific PCR primers include RoTat1.2 for <italic>T. b. evansi</italic> type A, and EVAB for <italic>T. b. evansi</italic> type B (<xref ref-type="bibr" rid="B56">WOAH, 2021</xref>). PCR detection of parasite DNA is effective at all stages of infection and allows the assessment of subsequent treatment effectiveness and the cure of infected animals (<xref ref-type="bibr" rid="B31">Li et al., 2020</xref>; <xref ref-type="bibr" rid="B14">Davila et al., 2003</xref>; <xref ref-type="bibr" rid="B34">Masiga et al., 1992</xref>). Nevertheless, this technique is limited to the use in lab settings mainly due to the need for specialized temperature control devices and well-trained technicians. As a solution, isothermal amplification methods for <italic>T. b. evansi</italic> have been recently developed as a good alternative to PCR. These include <italic>T. b. evansi</italic> type A and B Loop-Mediated Isothermal Amplification (LAMP) assays, which can be run at around 65&#xb0;C for 1 h (<xref ref-type="bibr" rid="B53">Tong et al., 2018</xref>; <xref ref-type="bibr" rid="B41">Njiru et al., 2010</xref>), or <italic>T. b. evansi</italic> type A Recombinase Polymerase Amplification (RPA), which can be run at around 39&#xb0;C for 30 min (<xref ref-type="bibr" rid="B31">Li et al., 2020</xref>). These assays, while optimal for both lab and field settings, do eventually suffer from non-specific amplifications resulting in lower sensitivity and specificity as compared to the gold standard PCR (<xref ref-type="bibr" rid="B57">Zou et al., 2020</xref>).</p>
<p>In recent years, the emergence of CRISPR-Cas technology has marked a significant step forward towards the generation of improved versions of diagnostic tests (<xref ref-type="bibr" rid="B49">Sima et al., 2022</xref>). The CRISPR-Cas complex can be programmed by using a synthetic single guide RNA (sgRNA) fragment together with a Cas endonuclease to target and cleave a specific DNA/RNA sequence (<xref ref-type="bibr" rid="B22">Jinek et al., 2012</xref>) (<xref ref-type="fig" rid="F1">Figure 1A</xref>). Many Cas proteins, upon their inherent <italic>cis</italic>-cleavage activity on the specific DNA/RNA target, display an additional non-specific <italic>collateral</italic> or <italic>trans</italic>-cleavage activity on surrounding single-stranded DNA/RNAs (<xref ref-type="bibr" rid="B48">Sereno et al., 2022</xref>; <xref ref-type="bibr" rid="B16">East-Seletsky et al., 2016</xref>; <xref ref-type="bibr" rid="B18">Gootenberg et al., 2017</xref>). This property has been effectively harnessed as a sensitive diagnostic approach to specifically identify nucleic acids present in a sample, by coupling current diagnostic tests together with the CRISPR-Cas complex and ssDNA/RNA probes containing fluorescent reporters (<xref ref-type="bibr" rid="B11">Chen et al., 2018</xref>; <xref ref-type="bibr" rid="B30">Li et al., 2018</xref>; <xref ref-type="bibr" rid="B29">Li et al., 2019</xref>). When combined with isothermal amplification methods, CRISPR-Cas-based diagnostic tests have demonstrated enhanced sensitivity and specificity, while preserving their usability for POC and Point of Need (PON) field testing (<xref ref-type="bibr" rid="B57">Zou et al., 2020</xref>; <xref ref-type="bibr" rid="B27">Lee et al., 2020</xref>; <xref ref-type="bibr" rid="B13">Cunningham et al., 2021</xref>; <xref ref-type="bibr" rid="B1">Ali et al., 2020</xref>).</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Development and Optimization of the <italic>Tev</italic>CRISPR-Cas12b cleavage assays. <bold>(A)</bold> The <italic>Tev</italic>CRISPR-Cas12b cleavage assay is performed in a 60 min reaction at 50&#xb0;C. First, the ribonucleoprotein CRISPR-<italic>Aap</italic>Cas12b complex is formed between the <italic>Aap</italic>Cas12b protein and the single-guide RNA (sgRNA). Then, the Cas protein scans through the double-stranded DNA amplicon for the presence of a specific 5&#x2032;-TTN-3&#x2032; Protospacer Adjacent Motif (PAM). Upon PAM recognition, the spacer region of the sgRNA hybridizes with the complementary protospacer sequence adjacent to the PAM site. As a result, the RuvC endonuclease domain of <italic>Aap</italic>Cas12b is activated, leading to the <italic>cis</italic>-cleavage of both DNA strands. This leads to the non-specific <italic>trans</italic>-cleavage of the FAM-Q probes, resulting in a measurable fluorescence signal of the released FAM reporters (<xref ref-type="bibr" rid="B52">Teng et al., 2019</xref>). <bold>(B, C)</bold> Temperature range analysis of both <italic>Tev</italic>CRISPR-Cas12b <italic>cis</italic>- <bold>(B)</bold> and <italic>trans</italic>-cleavage assays <bold>(C)</bold>. The <italic>cis</italic>-cleavage results were visualized on a 1% agarose gel pre-stained with ethidium bromide (t &#x3d; 60 min). The <italic>trans</italic>-cleavage results were plotted as the background subtracted fluorescence of mean &#xb1; standard deviation (SD) of 3 technical replicates (t &#x3d; 120 min). <bold>(D)</bold> Analytical sensitivity assessment of the <italic>Tev</italic>CRISPR-Cas12b cleavage assay. Background subtracted fluorescence of 3 technical replicates is plotted as mean &#xb1; SD. A Cut-off (NTC average &#x2b;3 times the SD) is indicated by the dashed line. All statistical analyses were conducted using a one-way ANOVA, followed by Dunnett&#x2019;s multiple comparison test. Significant differences between groups are denoted with the corresponding p-values listed above.</p>
</caption>
<graphic xlink:href="fmolb-12-1512970-g001.tif"/>
</fig>
<p>In this study, we describe the development of the first CRISPR-Cas-based RPA Assay for the detection of active <italic>T. b. evansi</italic> infections (<italic>Tev</italic>RPA-CRISPR). We demonstrate the versatility and sensitivity of <italic>Tev</italic>CRISPR-Cas12b cleavage assays, showing how this technology outperforms the current <italic>Tev</italic>RPA assay when integrated into a combined <italic>Tev</italic>RPA-CRISPR test, and its accuracy in assessing both active and cured <italic>T. b. evansi</italic> infections.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and methods</title>
<sec id="s2-1">
<title>Nucleic acid preparations</title>
<p>Total genomic DNA (gDNA) from different <italic>Trypanosoma</italic> parasites (<xref ref-type="table" rid="T1">Table 1</xref>) was extracted and purified from infected mouse whole blood (at &#x223c;10<sup>8</sup> Trypanosomes mL<sup>&#x2212;1</sup>) using the DNeasy Blood &#x26; Tissue Kit (Qiagen, Germany) following the manufacturer&#x2019;s guidelines. DNA samples were eluted in DNase/RNase-free water and diluted to 1 ng &#x3bc;L<sup>&#x2212;1</sup> before storage at &#x2212;20&#xb0;C until further use. The concentration and quality of the purified total gDNA was assessed through gel electrophoresis and spectrophotometric analysis (performed on Nanodrop ND-1000, Thermo Scientific). To determine the analytical sensitivity of the Two-Pot and One-Pot tests with total gDNA, the extraction and purification of <italic>T. b. evansi</italic> RoTat 1.2 total gDNA was followed by a 1:10 serial dilution from 20 ng &#x3bc;L<sup>&#x2212;1</sup> up to 200 fg &#x3bc;L<sup>&#x2212;1</sup> with DNase/RNase-free water.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Specifications of the <italic>Trypanosoma</italic> parasites employed in this study.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Strain</th>
<th align="left">Host</th>
<th align="left">Country</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">
<italic>T. b. gambiense</italic> ANTAT 9.1</td>
<td align="left">Human</td>
<td align="left">Cameroon</td>
</tr>
<tr>
<td align="left">
<italic>T. b. rhodesiense</italic> STIB 850</td>
<td align="left">Human</td>
<td align="left">Uganda</td>
</tr>
<tr>
<td align="left">
<italic>T. b. brucei</italic> ANTAT 1.8</td>
<td align="left">Bushbuck</td>
<td align="left">Uganda</td>
</tr>
<tr>
<td align="left">
<italic>T. b. equiperdum</italic> BOTAT 1.1</td>
<td align="left">Horse</td>
<td align="left">Morocco</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> ROTAT 1.2</td>
<td align="left">Water Buffalo</td>
<td align="left">Indonesia</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> ANTAT 3.1</td>
<td align="left">Capybara</td>
<td align="left">South America</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> KAZAKHSTAN</td>
<td align="left">Camel</td>
<td align="left">Kazakhstan</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> COLOMBIA</td>
<td align="left">Horse</td>
<td align="left">Colombia</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> VIETNAM</td>
<td align="left">Water Buffalo</td>
<td align="left">Vietnam</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> MERZOUGA 93</td>
<td align="left">Camel</td>
<td align="left">Morocco</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> MERZOUGA 56</td>
<td align="left">Camel</td>
<td align="left">Morocco</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> ZAGORA I.17</td>
<td align="left">Camel</td>
<td align="left">Morocco</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> ZAGORA II.28</td>
<td align="left">Camel</td>
<td align="left">Morocco</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> ZAGORA III.25</td>
<td align="left">Camel</td>
<td align="left">Morocco</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> CAN 86 K</td>
<td align="left">Dog</td>
<td align="left">Brazil</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> STIB 816</td>
<td align="left">Camel</td>
<td align="left">China</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> KETRI 2480</td>
<td align="left">Camel</td>
<td align="left">Kenya</td>
</tr>
<tr>
<td align="left">
<italic>T. b. evansi</italic> KETRI 2479</td>
<td align="left">Camel</td>
<td align="left">Kenya</td>
</tr>
<tr>
<td align="left">
<italic>T. congolense</italic> TRT 17</td>
<td align="left">Cattle</td>
<td align="left">Zambia</td>
</tr>
<tr>
<td align="left">
<italic>T. vivax</italic> ILRAD 700</td>
<td align="left">Cattle</td>
<td align="left">Nigeria</td>
</tr>
<tr>
<td align="left">
<italic>T. cruzi</italic> TULAHUEN</td>
<td align="left">Arthropod</td>
<td align="left">Chile</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>Total gDNA of <italic>T. b. evansi</italic> type A strains was used as a template to amplify by PCR a 615 bp fragment of the Rode <italic>Trypanozoon</italic> antigenic type 1.2 VSG (RoTat 1.2 VSG) gene (GenBank accession code: AF317914.1). The PCR amplification reaction was as follows: Ten &#x3bc;l of extracted total gDNA (at 1 ng &#x3bc;L<sup>&#x2212;1</sup>) were mixed with 15 &#x3bc;L of a PCR-mastermix containing: 2 U GoTaq G2 DNA Polymerase (Promega, United Kingdom), 1x Colorless GoTaq Reaction Buffer (Promega, United Kingdom), 0.4 mM dNTPs (Thermo Fisher Scientific, United States), 0.8 &#x3bc;M <italic>Tev</italic>PCR-Fw primer (Integrated DNA Technologies, United States) and 0.8 &#x3bc;M <italic>Tev</italic>PCR-Rv primer (Integrated DNA Technologies, United States) (See primer sequence in <xref ref-type="table" rid="T2">Table 2</xref>). Amplifications were performed in a Biometra Trio-block thermocycler at the following cycling conditions: denaturation for 4 min at 94&#xb0;C, followed by 35 amplification cycles of 1 min, denaturation at 94&#xb0;C, 1 min primer-template annealing at 55&#xb0;C, and 1 min polymerization at 72&#xb0;C. A final elongation step was carried out for 5 min at 72&#xb0;C. The resulting amplicon DNAs (aDNA) were purified with the GenElute PCR Clean-Up kit (Sigma-Aldrich) following the kit&#x2019;s guidelines eluting in DNase/RNase-free water and diluted to 100 nM before storage at &#x2212;20&#xb0;C until further use. The concentration and quality of the purified aDNA were assessed through gel electrophoresis and spectrophotometric analysis (performed on a Nanodrop ND-1000, Thermo Scientific). To determine the analytical sensitivity of the CRISPR-Cas12b cleavage reactions and the Two-Pot and One-Pot tests with aDNA, <italic>T. b. evansi</italic> RoTat 1.2 aDNA was 1:10 serially diluted from 100 nM up to 1 aM with DNase/RNase-free water.</p>
<table-wrap id="T2" position="float">
<label>TABLE 2</label>
<caption>
<p>Primers, probes and sgRNAs employed in this study.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Assay type</th>
<th align="left">Primer name</th>
<th align="left">Oligonucleotide (5&#x2032;-3&#x2032;)</th>
<th align="left">Reference</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td rowspan="2" align="left">PCR</td>
<td align="left">
<italic>Tev</italic>PCR-Fw</td>
<td align="left">CACCGAAGCAAGCGCAGCAAGAG</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">
<italic>Tev</italic>PCR-Rv</td>
<td align="left">AGTTCCGGTACCTTCTCCATTTC</td>
<td align="left">This study</td>
</tr>
<tr>
<td rowspan="2" align="left">
<italic>Tev</italic>RPA</td>
<td align="left">
<italic>Tev</italic>RPA-Fw</td>
<td align="left">CACCGAAGCAAGCGCAGCAAGAGGGTTAGCA</td>
<td align="left">
<xref ref-type="bibr" rid="B31">Li et al. (2020)</xref>
</td>
</tr>
<tr>
<td align="left">
<italic>Tev</italic>RPA-Rv</td>
<td align="left">GTAGCTGTCTCCTGGGGCCGAGGTGTCATAG</td>
<td align="left">
<xref ref-type="bibr" rid="B31">Li et al. (2020)</xref>
</td>
</tr>
<tr>
<td rowspan="4" align="left">
<italic>Tev</italic>RPA-CRISPR Two-Pot and One-Pot</td>
<td align="left">
<italic>Tev</italic>RPA-Fw</td>
<td align="left">CACCGAAGCAAGCGCAGCAAGAGGGTTAGCA</td>
<td align="left">
<xref ref-type="bibr" rid="B31">Li et al. (2020)</xref>
</td>
</tr>
<tr>
<td align="left">
<italic>Tev</italic>RPA-Rv</td>
<td align="left">GTAGCTGTCTCCTGGGGCCGAGGTGTCATAG</td>
<td align="left">
<xref ref-type="bibr" rid="B31">Li et al. (2020)</xref>
</td>
</tr>
<tr>
<td align="left">FAM-Q Probe</td>
<td align="left">[6-FAM]TTTTT[BHQ-1]</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">RoTat1.2sgRNA</td>
<td align="left">GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAG<break/>GUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACUGUGGG<break/>CAAAGCCGACGGCA</td>
<td align="left">This study</td>
</tr>
<tr>
<td rowspan="2" align="left">PCR</td>
<td align="left">RoTat1.2 Fw</td>
<td align="left">GCGGGGTGTTTAAAGCAATA</td>
<td align="left">
<xref ref-type="bibr" rid="B12">Class et al. (2004)</xref>
</td>
</tr>
<tr>
<td align="left">RoTat1.2 Rv</td>
<td align="left">ATTAGTGCTGCGTGTGTTCG</td>
<td align="left">
<xref ref-type="bibr" rid="B12">Class et al. (2004)</xref>
</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-2">
<title>
<italic>Tev</italic>CRISPR-Cas12b <italic>cis</italic>-cleavage reactions</title>
<p>The recombinant <italic>Alicyclobacillus acidiphilus</italic> Cas12b (<italic>Aap</italic>Cas12b) protein, selected for the development of the <italic>Tev</italic>RPA-CRISPR tests, was purchased from SignalChem Diagnostics, Canada. The selected suitable sgRNA for this protein includes the <italic>Alicyclobacillus acidoterrestris</italic> Cas12b (<italic>Aac</italic>Cas12b) scaffold sgRNA (<xref ref-type="sec" rid="s12">Supplementary Table S1</xref>), which given the absence of a published native <italic>Aap</italic>Cas12b sgRNA, results in a more robust and specific nuclease activity by the <italic>Aap</italic>Cas12b protein compared to other sgRNA scaffolds (<xref ref-type="bibr" rid="B24">Joung et al., 2020</xref>). All sgRNAs used in this study (<xref ref-type="table" rid="T2">Table 2</xref>; <xref ref-type="sec" rid="s12">Supplementary Table S1</xref>) were synthesized by Integrated DNA Technologies, United States.</p>
<p>
<italic>Tev</italic>CRISPR-Cas12b <italic>cis</italic>-cleavage assays were performed as follows: 250 nM <italic>Aap</italic>Cas12b, 500 nM RoTat1.2sgRNA and 30 nM <italic>T. b. evansi</italic> RoTat 1.2 aDNA were combined in 1x ThermoPol Reaction Buffer (New England Biolabs, United States) to a final volume of 15 &#x3bc;L. The reaction mix was transferred to a preset thermocycler and incubated for 1 h at different temperatures (50&#xb0;C, 55&#xb0;C, 60&#xb0;C, 65&#xb0;C, and 70&#xb0;C). After incubation, the reaction was stopped by adding 2.75 &#x3bc;L of a stop solution (16.9 mM EDTA, 84.5 &#x3bc;g/mL RNAse A, and 67.6 mAU/mL proteinase K) and incubating the mix in a preset thermocycler for 10 min at 56&#xb0;C. The reaction products were analyzed by electrophoresis on a 1% agarose gel pre-stained with ethidium bromide (EtBr) in TBE buffer (90 mM Tris, 90 mM borate, 2.5 mM EDTA). Electrophoresis was conducted at 100 V for 30 min.</p>
</sec>
<sec id="s2-3">
<title>
<italic>Tev</italic>CRISPR-Cas12b <italic>trans</italic>-cleavage reactions</title>
<p>
<italic>Tev</italic>CRISPR-Cas12b <italic>trans</italic>-cleavage reactions were performed as follows: 62.5 nM Cas12b (or 62.5 nM, 120 nM, and 250 nM during optimization assays), 250 nM sgRNA (or 125 nM, 250 nM, 500 nM and 1,000 nM during optimization assays) (six different sgRNAs were assessed, see <xref ref-type="table" rid="T2">Table 2</xref>; <xref ref-type="sec" rid="s12">Supplementary Table S1</xref>), 250 nM FAM-Q probe (Integrated DNA Technologies, United States) and 30 nM <italic>T. b. evansi</italic> RoTat 1.2 aDNA (or 5 uL of 100 nM, 10 nM, 1 nM, 100 pM and 10 pM initial concentration, for analytical specificity assessment) were combined in 1x ThermoPol Reaction Buffer (New England Biolabs, United States) to a final volume of 15 &#x3bc;L. The reaction mix was transferred to a preset thermocycler and incubated for 2 h at 50&#xb0;C (or 50&#xb0;C, 55&#xb0;C, 60&#xb0;C, 65&#xb0;C and 70&#xb0;C during optimization assays). The reactions were run using Hard-shell thin wall 96-well PCR Plates (Bio-Rad, United States) on the CFX Connect Real-Time PCR Detection System (Bio-Rad, United States). Fluorescence measurements were read every 30 s at &#x3bb;ex: 493 nm, &#x3bb;em: 517 nm.</p>
</sec>
<sec id="s2-4">
<title>Two-Pot <italic>Tev</italic>RPA-CRISPR test</title>
<p>Two-Pot <italic>Tev</italic>RPA-CRISPR tests include two consecutive reactions, being (i) the specific amplification of the target <italic>T. b. evansi</italic> DNA through RPA, and (ii) the specific detection of the amplicons through the CRISPR-Cas12b <italic>cis</italic>- and <italic>trans</italic>-cleavage activities.</p>
<p>Isothermal RPA amplification was conducted with the TwistAmp Basic kit (TwistDx, Cambridge, United Kingdom) with the protocol suggested by <xref ref-type="bibr" rid="B31">Li et al. (2020)</xref> with minor modifications: 10 &#x3bc;L of input aDNA (at 10 fM, 1 fM, 100 aM, 10 aM and 1 aM initial concentration) or total gDNA (at 20 ng &#x3bc;L<sup>&#x2212;1</sup>, 2 ng &#x3bc;L<sup>&#x2212;1</sup>, 200 pg &#x3bc;L<sup>&#x2212;1</sup>, 20 pg &#x3bc;L<sup>&#x2212;1</sup>, 2 pg &#x3bc;L<sup>&#x2212;1</sup> and 200 fg &#x3bc;L<sup>&#x2212;1</sup> initial concentration) were incubated with 480 nM of each <italic>Tev</italic>RPA primer, 1x rehydration buffer, 14 mM MgOAc and the lyophilized enzyme pellet of the TwistAmp Basic kit, in a final volume of 50 &#x3bc;L. The reaction mix was transferred to a preset thermocycler and incubated for 30 min at 39&#xb0;C. The amplified products were first purified using the GenElute PCR Clean-Up kit (Sigma-Aldrich) and visualized by electrophoresis on a 2% agarose gel pre-stained with ethidium bromide (EtBr) in TBE buffer (90 mM Tris, 90 mM borate, 2.5 mM EDTA). Electrophoresis was conducted at 110 V for 40 min.</p>
<p>CRISPR-Cas12b specific detection was performed as follows: 2.5 &#x3bc;L of the previous reaction mix without purification was incubated with 62.5 nM <italic>Aap</italic>Cas12b, 250 nM RoTat1.2sgRNA, 250 nM FAM-Q probe (Integrated DNA Technologies, United States) and 1x ThermoPol Reaction Buffer (New England Biolabs, United States) in a final volume of 15 &#x3bc;L. The reaction mix was transferred to a preset thermocycler and incubated for 30&#x2013;120 min at 50&#xb0;C. The reactions were run using Hard-shell thin wall 96-well PCR Plates (Bio-Rad, United States) on the CFX Connect Real-Time PCR Detection System (Bio-Rad, United States). Fluorescence measurements were read every 30 s at &#x3bb;ex: 493 nm, &#x3bb;em: 517 nm.</p>
</sec>
<sec id="s2-5">
<title>One-Pot <italic>Tev</italic>RPA-CRISPR test</title>
<p>One-Pot <italic>Tev</italic>RPA-CRISPR tests combine two reactions in one single tube, being (i) the specific amplification of the target <italic>T. b. evansi</italic> DNA through RPA, and (ii) the specific detection of the amplicons through the CRISPR-Cas12b <italic>cis</italic>- and <italic>trans</italic>-cleavage activities.</p>
<p>For this assay, 5 &#x3bc;L of input aDNA (at 1 pM, 100 fM, 10 fM, 1 fM, 100 aM and 10 aM initial concentration) or total gDNA (at 20 ng &#x3bc;L<sup>&#x2212;1</sup>, 2 ng &#x3bc;L<sup>&#x2212;1</sup>, 200 pg &#x3bc;L<sup>&#x2212;1</sup>, 20 pg &#x3bc;L<sup>&#x2212;1</sup> and 2 pg &#x3bc;L<sup>&#x2212;1</sup>) was incubated with 480 nM of each <italic>Tev</italic>RPA primer, 1x rehydration buffer, 14 mM MgOAc, the lyophilized enzyme pellet of the TwistAmp Basic kit, 62.5 nM <italic>Aap</italic>Cas12b, 250 nM RoTat1.2sgRNA and 250 nM FAM-Q probe (Integrated DNA Technologies, United States) in a final volume of 15 &#x3bc;L. The reaction mix was transferred to a preset thermocycler and incubated for 60&#x2013;120 at 39&#xb0;C. The reactions were run using Hard-shell thin wall 96-well PCR Plates (Bio-Rad, United States) on the CFX Connect Real-Time PCR Detection System (Bio-Rad, United States). Fluorescence measurements were read every 30 s at &#x3bb;ex: 493 nm, &#x3bb;em: 517 nm.</p>
</sec>
<sec id="s2-6">
<title>Experimental mice infections</title>
<p>Eight-week-old male C57BL/6 mice (purchased from Janvier, France) were divided into two groups of six individuals. In each group, five mice were inoculated intraperitoneally with 2000 <italic>T. b. evansi</italic> STIB 816 parasites in 200 &#x3bc;L of HBSS buffer (140 mM NaCl, 5 mM KCl, 1 mM CaCl<sub>2</sub>, 0.4 mM MgSO<sub>4</sub> 7H<sub>2</sub>O, 0.5 mM MgCl<sub>2</sub> 6H<sub>2</sub>O, 0.3 mM Na<sub>2</sub>HPO<sub>4</sub> 2H<sub>2</sub>O, 0.4 nM KH<sub>2</sub>PO<sub>4</sub>, 6 mM D-Glucose, 4 mM Sodium bicarbonate; Thermo Fisher Scientific, United States). Of note, bloodstream trypanosome parasites were stored at &#x2212;80&#xb0;C as blood aliquots containing 50% Alsever&#x2019;s solution (Sigma&#x2013;Aldrich) and 10% glycerol (final V/V). One mouse in each group was used as a negative control and was not infected. The mice were tail bled at different times post-infection. The mice in Group 1 were bled at days 1, 3, 5 and 7 post-infection. The animals in Group 2 were bled at days 0, 2, 4, 6, 8 and 10 post-infection. All individuals from Group 2 were treated with Berenil (40 mg per kg), administered intraperitoneally at day 5 post-infection. Blood samples were collected from the tail and mixed with heparinized saline (10-fold at 10 units/mL; Sigma-Aldrich, United States) to prevent coagulation. Then, 2.5 &#x3bc;L of the collected blood was used to follow-up mice parasitemia by diluting the sample 200-fold in HBSS buffer and assessing parasitemia under the VisiScope IT415 PH light microscope (VWR, United States). The rest of the collected blood was used to extract and purify the total gDNA using the DNeasy Blood &#x26; Tissue Kit (Qiagen, Germany) following the manufacturer&#x2019;s guidelines. DNA samples were eluted in DNase/RNase-free water on equal volumes to the initial sample (i.e., no sample concentration). The resulting gDNA was used to evaluate the samples using the <italic>Tev</italic>PCR (used as a gold standard to assess positivity), Two-Pot <italic>Tev</italic>RPA-CRISPR and the One-Pot <italic>Tev</italic>RPA-CRISPR tests. The <italic>Tev</italic>PCR was performed as described in <xref ref-type="bibr" rid="B12">Claes et al. (2004)</xref>. <italic>Tev</italic>RPA-CRISPR Two-Pot and the <italic>Tev</italic>RPA-CRISPR One-Pot tests were performed as described previously in this study on optimized conditions. Fluorescence values from positive and negative samples from the Two-Pot <italic>Tev</italic>RPA-CRISPR and the One-Pot <italic>Tev</italic>RPA-CRISPR tests were evaluated by a Receiver Operating Characteristic (ROC) curve analysis for determining test&#x2019;s positivity thresholds, as well as sensitivity and specificity scores (<xref ref-type="sec" rid="s12">Supplementary Table S2</xref>; <xref ref-type="sec" rid="s12">Supplementary Figure S9</xref>).</p>
</sec>
<sec sec-type="ethics-statement" id="s2-7">
<title>Ethics statement</title>
<p>All experiments, maintenance and care of the mice complied with the European Convention for the Protection of Vertebrate Animals (ECPVA) used for Experimental and Other Scientific Purposes guidelines (CETS No 123) and were approved by the Ethical Committee for Animal Experiments (ECAE) at the Vrije Universiteit Brussel (Permit Number: 17-220-02). Mice were monitored daily. Humane endpoints were used during the study, based on weight loss, whereby animals with &#x3e;25% weight loss were sacrificed using carbon dioxide treatment. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec id="s2-8">
<title>Statistical analysis</title>
<p>The GraphPad Prism 10 software was used for statistical analyses. Analytical sensitivity, and analytical specificity analyses were conducted using three technical replicates. The results presented were chosen as the most representative from two independent experiments. All statistical analyses were conducted using a one-way ANOVA, followed by Dunnett&#x2019;s multiple comparison test. Values are expressed as mean &#xb1; standard deviation (SD) and <italic>p-values</italic> are shown. Specificity and sensitivity were evaluated through Receiver Operating Characteristic (ROC) curve analysis, which included a 95% confidence interval (CI) for both metrics, based on a sample size of n &#x3d; 66.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec id="s3-1">
<title>Development and Optimization of a <italic>Tev</italic>CRISPR-Cas12b assay for versatile and sensitive detection of <italic>T</italic>. <italic>b</italic>. <italic>evansi</italic>
</title>
<p>Development of a <italic>Tev</italic>RPA-CRISPR test requires the pre-amplification of a double-stranded DNA (dsDNA) target by RPA, followed by a highly specific cleavage and detection of the resulting amplicon through the CRISPR-Cas12b machinery (<xref ref-type="fig" rid="F1">Figure 1A</xref>). For this, it is critical to choose a proper target region for the Cas12b-sgRNA complex, which must contain a PAM sequence (5&#x2032;-TTN-3&#x2032;) followed by a protospacer sequence (<xref ref-type="bibr" rid="B51">Teng et al., 2018</xref>). The target sequence was chosen based on: (i) the presence within the <italic>Tev</italic>RPA amplicon, outside the primers or primer binding sites; (ii) the occurrence of a PAM sequence; (iii) the degree of nucleotide sequence identity between different <italic>T. b. evansi</italic> strains from different origins; and (iv) the absence of single nucleotide polymorphisms (SNPs).</p>
<p>First, the specificity of the RoTat 1.2 VSG gene to <italic>T. b. evansi</italic> type A was verified by PCR amplification (<xref ref-type="sec" rid="s12">Supplementary Figure S1</xref>). Then, the <italic>Tev</italic>RPA targeted sequence included within the aDNAs collected from 13 <italic>T. b. evansi</italic> type A parasites was analyzed (<xref ref-type="table" rid="T1">Table 1</xref>). A 99.65% nucleotide sequence identity was observed, including the presence of a unique SNP in two geographically closely related <italic>T. b. evansi</italic> type A strains, being <italic>T. b. evansi</italic> KAZAKHSTAN and <italic>T. b. evansi</italic> STIB 816, from Kazakhstan and P.R. of China, respectively (<xref ref-type="sec" rid="s12">Supplementary Figure S2</xref>). As a result, and in accordance with the above-mentioned criteria, six sgRNAs targeting the <italic>Tev</italic>RPA amplicon were designed (<xref ref-type="sec" rid="s12">Supplementary Table S1</xref>). The efficacy of all sgRNAs was analyzed in conjunction with <italic>Aap</italic>Cas12b for cleaving (through <italic>cis</italic>-cleavage) and detecting (through <italic>trans</italic>-cleavage) <italic>T. b. evansi</italic> aDNA. Among the sgRNAs, sgRNA_6, designated as RoTat1.2sgRNA, exhibited the most rapid and robust fluorescence signals throughout the reaction (<xref ref-type="sec" rid="s12">Supplementary Figure S3</xref>). Consequently, RoTat1.2sgRNA was selected for subsequent development stages of the <italic>Tev</italic>RPA-CRISPR diagnostic test. Next, the optimal <italic>Aap</italic>Cas12b:RoTat1.2sgRNA molar ratio to target <italic>T. b. evansi</italic> aDNA was evaluated, indicating a 4:1 ratio (i.e., 62.5 nM <italic>Aap</italic>Cas12b and 250 nM RoTat1.2sgRNA) as the best combination to reduce assay costs while maximizing the cleavage (<xref ref-type="sec" rid="s12">Supplementary Figure S4</xref>). Previous studies have reported an optimal <italic>Aap</italic>Cas12b temperature range between 31&#xb0;C and 59&#xb0;C for the <italic>cis</italic>-cleavage and up to 50&#xb0;C&#x2013;60&#xb0;C for the <italic>trans</italic>-cleavage (<xref ref-type="bibr" rid="B24">Joung et al., 2020</xref>; <xref ref-type="bibr" rid="B51">Teng et al., 2018</xref>; <xref ref-type="bibr" rid="B21">Huyke et al., 2022</xref>). To corroborate if those results apply to our CRISPR-<italic>Aap</italic>Cas12b- RoTat1.2sgRNA design, a temperature range analysis was performed for both <italic>cis</italic>- and <italic>trans</italic>-cleavage reactions. A nearly total <italic>cis</italic>-cleavage of the target <italic>T. b. evansi</italic> aDNA was observed up to 55&#xb0;C, while at 60&#xba;C&#x2013;70&#xb0;C the cleavage was reduced but still visible (<xref ref-type="fig" rid="F1">Figure 1B</xref>). Nevertheless, the <italic>trans</italic>-cleavage of the fluorescent probes was optimal from 40&#xba;C to 60&#xb0;C, and progressively decreased but measurable when increasing the reaction temperature at 65&#xba;C&#x2013;70&#xb0;C (<xref ref-type="fig" rid="F1">Figure 1C</xref>). As such, 50&#xb0;C was selected as the optimal reaction temperature. Finally, the analytical sensitivity of the <italic>Tev</italic>CRISPR-Cas12b assay was determined at the optimized reaction conditions. To achieve this, the <italic>Tev</italic>CRISPR-Cas12b assays were conducted on 1:10 serially diluted <italic>T. b. evansi</italic> aDNA samples, using a negative control sample in which aDNA was absent. <xref ref-type="fig" rid="F1">Figure 1D</xref> shows that the <italic>Tev</italic>CRISPR-Cas12b assay detects target <italic>T. b. evansi</italic> aDNA up to a pM concentration.</p>
</sec>
<sec id="s3-2">
<title>Integrated <italic>Tev</italic>RPA-CRISPR assay for highly sensitive and specific detection of <italic>T</italic>. <italic>b</italic>. <italic>evansi</italic>
</title>
<p>The <italic>Aap</italic>Cas12b-RoTat1.2sgRNA complex was designed with the aim of adapting this technology to the <italic>Tev</italic>RPA. Hence, first a Two-Pot test was developed, in which the RPA amplification is directly followed by the cleavage of the resulting amplicon through the CRISPR-Cas12b machinery, and the cleavage and detection of a fluorescent probe (<xref ref-type="fig" rid="F2">Figure 2A</xref>). This test was performed following the optimal conditions for both reactions, in two separate tubes, with a total reaction time of 1 h. Using this approach, the analytical sensitivities of both <italic>Tev</italic>RPA and Two-Pot <italic>Tev</italic>RPA-CRISPR tests were evaluated. While <italic>Tev</italic>RPA allows to detect up to 100 aM of the target <italic>T. b. evansi</italic> aDNA, the Two-Pot <italic>Tev</italic>RPA-CRISPR test improved this detection limit by 10-fold, detecting up to 10 aM of <italic>T. b. evansi</italic> aDNA after 30 min of reaction (<xref ref-type="fig" rid="F2">Figures 2B, C, F</xref>), or by 100-fold, detecting up to 1 aM of <italic>T. b. evansi</italic> aDNA after 60&#x2013;120 min of reaction (<xref ref-type="sec" rid="s12">Supplementary Figure S5</xref>). When using <italic>T. b. evansi</italic> gDNA instead, the <italic>Tev</italic>RPA allowed to detect up to 200 pg of the target gDNA, whereas the Two-Pot <italic>Tev</italic>RPA-CRISPR test improved this detection limit by 10-fold, detecting up to 20 pg of <italic>T. b. evansi</italic> gDNA after 30 min of reaction (<xref ref-type="fig" rid="F2">Figures 2D, E, H</xref>), or by 100-fold, detecting up to 2 pg of <italic>T. b. evansi</italic> gDNA after 60&#x2013;120 min of reaction (<xref ref-type="sec" rid="s12">Supplementary Figure S6</xref>). Although the CRISPR-Cas12b technology enhances sensitivity, its primary advantage lies in ensuring test specificity by serving as a &#x201c;second verification&#x201d; of amplicon accuracy following the initial amplification step (<xref ref-type="bibr" rid="B24">Joung et al., 2020</xref>). To probe the test&#x2019;s analytical specificity, the Two-Pot <italic>Tev</italic>RPA-CRISPR was performed on different <italic>Trypanosoma</italic> spp. gDNA samples (listed in <xref ref-type="table" rid="T1">Table 1</xref>) including those that can be found coexisting in the same territories as <italic>T. b. evansi</italic>. As expected, the <italic>Tev</italic>RPA-CRISPR test resulted in a positive fluorescence signal only when <italic>T. b. evansi</italic> type A gDNA was present (<xref ref-type="fig" rid="F2">Figures 2G, I</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Development and Optimization of the Two-Pot <italic>Tev</italic>RPA-CRISPR test. <bold>(A)</bold> The Two-Pot <italic>Tev</italic>RPA-CRISPR assay is performed in two reactions, being <italic>Tev</italic>RPA for 30 min at 39&#xb0;C, and <italic>Tev</italic>CRISPR-Cas12b for 30 min at 50&#xb0;C. First, <italic>T. b. evansi</italic> aDNA or gDNA is amplified by the <italic>Tev</italic>RPA, and the resulting amplicons are recognized and <italic>cis</italic>-cleaved by the CRISPR-<italic>Aap</italic>Cas12b complex. This leads to the non-specific <italic>trans</italic>-cleavage of the FAM-Q probes, resulting in a measurable fluorescence signal of the released FAM reporters. <bold>(B, D)</bold> Analytical sensitivity assessment of the Two-Pot <italic>Tev</italic>RPA-CRISPR test to aDNA <bold>(B)</bold> and gDNA <bold>(D)</bold>. Background subtracted fluorescence of 3 technical replicates is plotted as mean &#xb1; standard deviation (SD). A Cut-off (No Template Control (NTC) mean &#x2b;3SD) is indicated by the dashed line. <bold>(C, E)</bold> Kinetics of the <italic>TevC</italic>RISPR-Cas12b <italic>trans</italic>-cleavage from the analytical sensitivity assessment of the Two-Pot <italic>Tev</italic>RPA-CRISPR test to aDNA <bold>(C)</bold> and gDNA <bold>(E)</bold>. Fluorescence was measured over 30 min. Shaded regions represent SD of 3 technical replicates. <bold>(F, H)</bold> Analytical sensitivity assessment of the <italic>Tev</italic>RPA test to aDNA <bold>(F)</bold> and gDNA <bold>(H)</bold>. Lanes 1&#x2013;5, serial 10-fold dilution of aDNA from 10 fM to 1 aM, and of gDNA from 20 ng to 2 pg; lane 6 NTC. Results were visualized on a 2% agarose gel pre-stained with ethidium bromide. <bold>(G, I)</bold> Analytical specificity assessment of the Two-Pot <italic>Tev</italic>RPA-CRISPR test to different <italic>Trypanosoma</italic> spp. <bold>(G)</bold> and <italic>T. b. evansi</italic> strains <bold>(I)</bold>. Background subtracted fluorescence of 3 technical replicates is plotted, where the mean is indicated as a dashed line. All statistical analyses were conducted using a one-way ANOVA, followed by Dunnett&#x2019;s multiple comparison test. Significant differences between groups are denoted with the corresponding p-values listed above.</p>
</caption>
<graphic xlink:href="fmolb-12-1512970-g002.tif"/>
</fig>
<p>Having demonstrated the feasibility and adaptability of CRISPR-Cas12b within the <italic>Tev</italic>RPA Two-Pot system, combining both steps into a single-pot reaction was addressed, with the goal of creating an efficient and reliable diagnostic test for POC use. The One-Pot <italic>Tev</italic>RPA-CRISPR assay integrates RPA amplification with CRISPR-Cas12b-mediated cleavage and detection within a single reaction mixture, enabling the detection of <italic>T. b. evansi</italic> type A gDNA within 1 h. The amplification rate and efficiency of these RPA-CRISPR assays are significantly affected by primer concentration and magnesium acetate (MgOAc) levels. Therefore, the optimized concentration for both reagents was determined, being 14 mM MgOAc and 480 mM <italic>Tev</italic>RPA primers, respectively (<xref ref-type="sec" rid="s12">Supplementary Figure S7</xref>). Finally, the analytical sensitivities of the One-Pot <italic>Tev</italic>RPA-CRISPR test were evaluated, detecting up to 100&#x2013;10 aM of <italic>T. b. evansi</italic> aDNA (<xref ref-type="fig" rid="F3">Figures 3B, C</xref>; <xref ref-type="sec" rid="s12">Supplementary Figure S8</xref>), and 20 pg of <italic>T. b. evansi</italic> gDNA (<xref ref-type="fig" rid="F3">Figures 3D, E</xref>; <xref ref-type="sec" rid="s12">Supplementary Figure S8</xref>).</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Development and Optimization of the One-Pot <italic>Tev</italic>RPA-CRISPR test. <bold>(A)</bold> The One-Pot <italic>Tev</italic>RPA-CRISPR assay is performed in one reaction for 60 min at 39&#xb0;C. At the same time the amplicons from the <italic>Tev</italic>RPA are being synthesized, these are recognized and <italic>cis</italic>-cleaved by the CRISPR-<italic>Aap</italic>Cas12b complex. This leads to the non-specific <italic>trans</italic>-cleavage of the FAM-Q probes, resulting in a measurable fluorescence signal of the released FAM reporters. <bold>(B, D)</bold> Analytical sensitivity assessment of the One-Pot <italic>Tev</italic>RPA-CRISPR test to aDNA <bold>(B)</bold> and gDNA <bold>(D)</bold>. Background subtracted fluorescence of 3 technical replicates is plotted as mean &#xb1; standard deviation (SD). A Cut-off (No Template Control (NTC) mean&#x2b;3SD) is indicated by the dashed line. <bold>(C, E)</bold> Kinetics of the analytical sensitivity assessment of the One-Pot <italic>Tev</italic>RPA-CRISPR test to aDNA <bold>(C)</bold> and gDNA <bold>(E)</bold>. Fluorescence was measured over 30 min. Shaded regions represent SD of 3 technical replicates. All statistical analyses were conducted using a one-way ANOVA, followed by Dunnett&#x2019;s multiple comparison test. Significant differences between groups are denoted with the corresponding p-values listed above.</p>
</caption>
<graphic xlink:href="fmolb-12-1512970-g003.tif"/>
</fig>
</sec>
<sec id="s3-3">
<title>
<italic>Tev</italic>RPA-CRISPR assays detect active <italic>T</italic>. <italic>b</italic>. <italic>evansi</italic> infections and Cure with PCR-Level accuracy in experimental mouse models</title>
<p>After developing the Two-Pot and One-Pot <italic>Tev</italic>RPA-CRISPR designs, test efficacy in diagnosing both active and cured infections of <italic>T. b. evansi</italic> was validated. Ten C57BL/6 mice were infected with <italic>T. b. evansi</italic> STIB 816, divided into two groups. The presence of parasites was assessed by microscopy, <italic>Tev</italic>PCR (<xref ref-type="bibr" rid="B12">Claes et al., 2004</xref>), Two-pot <italic>Tev</italic>RPA-CRISPR, and One-Pot <italic>Tev</italic>RPA-CRISPR at various time points of infection. Group 1 was left untreated, while Group 2 was treated with Berenil 5 days post-infection (<xref ref-type="fig" rid="F4">Figures 4A, B</xref>). Both Two-Pot and One-Pot <italic>Tev</italic>RPA-CRISPR assays accurately detected all infected samples in both untreated and treated groups, matching the performance of the gold standard <italic>Tev</italic>PCR (Kappa value &#x3d; 1) (<xref ref-type="fig" rid="F5">Figures 5A, B</xref>). All infected mice in Group 1 were euthanized by day 8 post-infection, as they started to show signs of infection-associated pathology. In contrast, all mice in Group 2 survived, indicating successful parasite clearance following Berenil treatment. Both Two-Pot and One-Pot <italic>Tev</italic>RPA-CRISPR yielded negative results in post-treatment non-infected samples, as corroborated by <italic>Tev</italic>PCR, validating their effectiveness as &#x201c;test-of-cure&#x201d; assays (<xref ref-type="fig" rid="F5">Figure 5B</xref>). Finally, the preliminary sensitivity and specificity of both <italic>Tev</italic>RPA-CRISPR tests were evaluated, achieving 100% for both metrics (<xref ref-type="sec" rid="s12">Supplementary Table S2</xref>).</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>Assessment of the <italic>Tev</italic>RPA-CRISPR assays to detect both active and cured <italic>T. b. evansi</italic> infections. <bold>(A)</bold> C57BL/6 mice were infected with <italic>T. b. evansi</italic> STIB 816 (n &#x3d; 5) and the presence of parasites was monitored over the course of the infection by microscopy, <italic>Tev</italic>PCR, Two-Pot <italic>Tev</italic>RPA-CRISPR and One-Pot <italic>Tev</italic>RPA-CRISPR. The results are showed as the percentages of mice that scored positive or negative at the above-mentioned techniques. <bold>(B)</bold> C57BL/6 mice infected with <italic>T. b. evansi</italic> STIB 816 (n &#x3d; 5) were treated with Berenil at 5 days post-infection. The presence of parasites was followed by microscopy, <italic>Tev</italic>PCR, Two-Pot <italic>Tev</italic>RPA-CRISPR and One-Pot <italic>Tev</italic>RPA-CRISPR along the experiment. The panels and color codes are identical to those used in panel <bold>(A)</bold>. The <italic>Tev</italic>PCR, Two-Pot <italic>Tev</italic>RPA-CRISPR, and One-Pot <italic>Tev</italic>RPA-CRISPR read-outs are shown in <xref ref-type="fig" rid="F5">Figure 5</xref>. These results were selected as the most representative from two independent experiments.</p>
</caption>
<graphic xlink:href="fmolb-12-1512970-g004.tif"/>
</fig>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>Read-outs from the Assessment of the <italic>Tev</italic>RPA-CRISPR performance on experimental <italic>T. b. evansi</italic> infections. <bold>(A)</bold> <italic>Tev</italic>PCR, Two-Pot <italic>Tev</italic>RPA-CRISPR and One-Pot <italic>Tev</italic>RPA-CRISPR results from the mouse infection of <xref ref-type="fig" rid="F4">Figure 4A</xref>. <bold>(B)</bold> <italic>Tev</italic>PCR, Two-Pot <italic>Tev</italic>RPA-CRISPR, and One-Pot <italic>Tev</italic>RPA-CRISPR results from the mouse infection of <xref ref-type="fig" rid="F4">Figure 4B</xref>. Numbers from 1&#x2013;5 below the plots correspond to each of the individual mice analyzed per group. N and P correspond to the negative control (water only), and the positive control (<italic>T. b. evansi</italic> STIB 816 gDNA). <italic>Tev</italic>PCR results were visualized on a 2% agarose gel pre-stained with ethidium bromide. Fluorescence values from the Two-Pot <italic>Tev</italic>RPA-CRISPR and One-Pot <italic>Tev</italic>RPA-CRISPR results were evaluated by a Receiver Operating Characteristic (ROC) curve analysis to determine the test&#x2019;s positivity thresholds (dashed lines).</p>
</caption>
<graphic xlink:href="fmolb-12-1512970-g005.tif"/>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>In this study, we developed and optimized a <italic>Tev</italic>RPA-CRISPR assay to be used as a highly specific and sensitive alternative for POC/PON diagnosis of <italic>T</italic>. <italic>b</italic>. <italic>evansi</italic> active infections. This assay integrates an RPA for target amplification together with a CRISPR-Cas12b system for amplicon detection. Target amplification is facilitated by a <italic>Tev</italic>RPA, which specifically targets the RoTat 1.2 VSG gene unique to <italic>T</italic>. <italic>b</italic>. <italic>evansi</italic> type A parasites (<xref ref-type="bibr" rid="B55">Verloo et al., 2001</xref>). As demonstrated in this study, the nucleotide sequence of the RoTat 1.2 VSG region is highly conserved across <italic>T. b. evansi</italic> type A strains from various origins, ensuring a broad applicability of the test. Subsequently, the amplified target detection is carried out by the <italic>Tev</italic>CRISPR-Cas12b cleavage assay, which combines the CRISPR-<italic>Aap</italic>Cas12b together with the RoTat1.2sgRNA, forming the CRISPR complex. Our findings reveal that the <italic>Tev</italic>CRISPR-Cas12b cleavage assay can reliably detect picomolar concentrations of the target <italic>T. b. evansi</italic> aDNA, consistent with the reported analytical sensitivities for CRISPR-<italic>Aap</italic>Cas12b systems (<xref ref-type="bibr" rid="B21">Huyke et al., 2022</xref>). Despite being a highly sensitive assay, the pre-amplification of the target DNA is still recommended when directly detecting gDNA samples. Besides its low limit of detection, the CRISPR-<italic>Aap</italic>Cas12b system has been reported to exhibit minimal to no off-target cis-cleavage activity (<xref ref-type="bibr" rid="B51">Teng et al., 2018</xref>; <xref ref-type="bibr" rid="B32">Liu et al., 2017</xref>). This quality makes it highly specific and adaptable to any amplification method when applied as a second-step reaction (i.e., Two-Pot system), serving as a reliable second result verification on inconclusive <italic>T. b. evansi</italic> tests. The CRISPR-<italic>Aap</italic>Cas12b system also proved to be robust and optimally operate in a wide range of reaction temperatures (40&#xb0;C to 60&#xb0;C), as already reported in other studies (<xref ref-type="bibr" rid="B24">Joung et al., 2020</xref>; <xref ref-type="bibr" rid="B51">Teng et al., 2018</xref>; <xref ref-type="bibr" rid="B21">Huyke et al., 2022</xref>; <xref ref-type="bibr" rid="B39">Nguyen et al., 2022</xref>). This quality makes it compatible and highly adaptable to most isothermal nucleic acid amplification reactions if integrated into a single-step reaction (i.e., One-Pot system) (<xref ref-type="bibr" rid="B48">Sereno et al., 2022</xref>).</p>
<p>The combined test approach we explored in this study utilizes our previously established <italic>Tev</italic>RPA assay, which exhibits high specificity for <italic>T. b. evansi</italic> type A and integrates it with the <italic>Tev</italic>CRISPR-Cas12b cleavage assay. While many researchers choose to adapt RPA to other Cas proteins, like Cas13 or Cas12a, it has been proposed that when combined with RPA, Cas12b, and specifically <italic>Aap</italic>Cas12b yields a better performance (<xref ref-type="bibr" rid="B3">Aman et al., 2021</xref>). Our data shows that the Two-Pot <italic>Tev</italic>RPA-CRISPR assay substantially enhances analytical sensitivity by a factor of up to 100 compared to the traditional <italic>Tev</italic>RPA method, while also exhibiting robust analytical specificity with no cross-reactivity to other <italic>Trypanosoma</italic> species (<xref ref-type="table" rid="T3">Table 3</xref>). This assay provides an optimal solution for detecting <italic>T. b. evansi</italic> type A parasites in both laboratory and field settings. Although <italic>Tev</italic>RPA offers a rapid alternative to the gold-standard <italic>Tev</italic>PCR in laboratory settings, it is prone to non-specific amplification leading to false positive results. The Two-Pot <italic>Tev</italic>RPA-CRISPR assay overcomes this limitation, providing a more reliable and precise diagnostic tool. In field settings, the Two-Pot <italic>Tev</italic>RPA-CRISPR facilitates the initial fast and user-friendly screening with <italic>Tev</italic>RPA, while follow-up laboratory-based confirmation and detailed analysis with the <italic>Tev</italic>CRISPR-Cas12b assay ensures an accurate and reliable result.</p>
<table-wrap id="T3" position="float">
<label>TABLE 3</label>
<caption>
<p>Intrinsic properties of Two-Pot <italic>Tev</italic>RPA-CRISPR and One-Pot <italic>Tev</italic>RPA-CRISPR. Specificity and sensitivity were assessed using Receiver Operating Characteristic (ROC) curve analysis (see <xref ref-type="sec" rid="s12">Supplementary Figure S9</xref>). The results include a 95% confidence interval for both metrics, calculated from a sample size of n &#x3d; 66.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="center"/>
<th align="center">
<italic>Analytical Specificity</italic>
</th>
<th align="center">
<italic>Analytical Sensitivity</italic>
</th>
<th align="center">
<italic>Specificity</italic>
</th>
<th align="center">
<italic>Sensitivity</italic>
</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="center">
<italic>Tev</italic>CRISPR-RPA Two-Pot</td>
<td align="center">
<italic>T. evansi</italic> type A</td>
<td align="center">10-1 aM aDNA 20-2 pg gDNA</td>
<td align="center">100 % (95% CI: 91.24&#x2013;100%)</td>
<td align="center">100 % (95% CI: 87.13&#x2013;100%)</td>
</tr>
<tr>
<td align="center">
<italic>Tev</italic>CRISPR-RPA One-Pot</td>
<td align="center">
<italic>T. evansi</italic> type A</td>
<td align="center">100-10 aM aDNA 20 pg gDNA</td>
<td align="center">100 % (95% CI: 91.24&#x2013;100%)</td>
<td align="center">100 % (95% CI: 87.13&#x2013;100%)</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>Integrating the <italic>Tev</italic>RPA and <italic>Tev</italic>CRISPR-Cas12b assays into a single reaction simplifies the workflow while preserving high analytical sensitivity and specificity. The One-Pot <italic>Tev</italic>RPA-CRISPR assay achieved analytical sensitivities comparable to the Two-Pot <italic>Tev</italic>RPA-CRISPR assay, while maintaining a specific detection of <italic>T. b. evansi</italic> type A parasites (<xref ref-type="table" rid="T3">Table 3</xref>). The One-Pot <italic>Tev</italic>RPA-CRISPR assay, while well-suited for laboratory settings, was designed to meet the need for a user-friendly yet sensitive and specific test suitable for POC/PON diagnosis in field settings. In fact, the One-Pot <italic>Tev</italic>RPA-CRISPR can be carried out using a body heater or portable water bath, and the results can be observed using cost-effective blue-light transilluminators (<xref ref-type="sec" rid="s12">Supplementary Figure S10</xref>), powered by batteries or connected to a mobile phone, as well as through standard lateral-flow devices, which require no additional equipment (<xref ref-type="bibr" rid="B36">Myhrvold et al., 2018</xref>; <xref ref-type="bibr" rid="B15">Deng et al., 2023</xref>). Accordingly, this assay offers a compelling alternative to standard screening tools, like CATT/<italic>T. b. evansi</italic> or ELISA/<italic>T. b. evansi</italic>.</p>
<p>Diagnostic accuracy evaluation of the newly developed Two-Pot and One-Pot <italic>Tev</italic>RPA-CRISPR assays was done in a setting that compared results of both active and cured <italic>T. b. evansi</italic> infections, using an experimental mouse model. Both assays showed full concordance with the gold standard <italic>Tev</italic>PCR, achieving 100% sensitivity and specificity. This performance confirms the potential for effectively monitoring treatment efficacy and parasite clearance, establishing both <italic>Tev</italic>RPA-CRISPR assays as valuable tools for managing <italic>T. b. evansi</italic> infections.</p>
<p>In conclusion, our findings demonstrate that the newly developed <italic>Tev</italic>RPA-CRISPR assays offer a robust and reliable proof-of-concept, with significant potential as viable alternatives to current screening tools for both laboratory and field settings. Future efforts now must focus on extensive field trials and possibly further optimization, to ensure assay performance and applicability in a POC setting.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="sec" rid="s12">Supplementary Material</xref>.</p>
</sec>
<sec sec-type="ethics-statement" id="s6">
<title>Ethics statement</title>
<p>All experiments, maintenance and care of the mice complied with the European Convention for the Protection of Vertebrate Animals (ECPVA) used for Experimental and Other Scientific Purposes guidelines (CETS No. 123) and were approved by the Ethical Committee for Animal Experiments (ECAE) at the Vrije Universiteit Brussel (Permit Number: 17-220-02). Mice were monitored daily. Humane endpoints were used during the study, based on weight loss, whereby animals with &#x3e;25% weight loss were sacrificed using carbon dioxide treatment. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec sec-type="author-contributions" id="s7">
<title>Author contributions</title>
<p>A&#xc1;-R: Visualization, Writing&#x2013;original draft, Writing&#x2013;review and editing, Conceptualization, Data curation, Formal Analysis, Funding acquisition, Methodology, Project administration. ZL: Conceptualization, Writing&#x2013;original draft, Writing&#x2013;review and editing, Data curation, Formal Analysis, Methodology. B-KJ: Writing&#x2013;original draft, Writing&#x2013;review and editing, Methodology. BS: Writing&#x2013;original draft, Writing&#x2013;review and editing, Data curation, Formal Analysis, Methodology, Supervision. PG: Writing&#x2013;original draft, Writing&#x2013;review and editing, Funding acquisition, Supervision. SM: Writing&#x2013;original draft, Writing&#x2013;review and editing, Conceptualization, Data curation, Formal Analysis, Funding acquisition, Methodology, Project administration, Supervision.</p>
</sec>
<sec sec-type="funding-information" id="s8">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research, authorship, and/or publication of this article. This work was supported by a SB PhD fellowship of the Research Foundation &#x2013; Flanders (FWO), project number 1S91225N.</p>
</sec>
<ack>
<p>The authors thank Carine Truyens and Pascale Deblandre (Laboratoire de Parasitologie, Facult&#xe9; de M&#xe9;decine &#x2013; ULB) for the <italic>T. cruzi</italic> gDNA sample, and Joris Vankerschaver (Department of Applied mathematics, computer science and statistics, Faculty of Sciences &#x2013; Ghent University Global Campus, South Korea) for his contribution to the statistical analysis. We would like to thank Ella Omasta, Marie-Therese Detobel, Ellen Vaneetvelde, Mait&#xe9; Schuurmans, and Nadia Abou for technical and administrative assistance. BS was supported by the Strategic Research Program (SRP3 and SRP47, VUB).</p>
</ack>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s10">
<title>Generative AI statement</title>
<p>The authors declare that no Generative AI was used in the creation of this manuscript.</p>
</sec>
<sec sec-type="disclaimer" id="s11">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s12">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fmolb.2025.1512970/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fmolb.2025.1512970/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet1.pdf" id="SM1" mimetype="application/pdf" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ali</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Aman</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Mahas</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Rao</surname>
<given-names>G. S.</given-names>
</name>
<name>
<surname>Tehseen</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Marsic</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>iSCAN: an RT-LAMP-coupled CRISPR-Cas12 module for rapid, sensitive detection of SARS-CoV-2</article-title>. <source>Virus Res.</source> <volume>288</volume>, <fpage>198129</fpage>. <pub-id pub-id-type="doi">10.1016/j.virusres.2020.198129</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alvarez-Rodriguez</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>B. K.</given-names>
</name>
<name>
<surname>Radwanska</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Magez</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Recent progress in diagnosis and treatment of Human African Trypanosomiasis has made the elimination of this disease a realistic target by 2030</article-title>. <source>Front. Med. (Lausanne)</source> <volume>9</volume>, <fpage>1037094</fpage>. <pub-id pub-id-type="doi">10.3389/fmed.2022.1037094</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Aman</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Marsic</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Sivakrishna Rao</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Mahas</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Ali</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Alsanea</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>iSCAN-V2: a one-pot RT-RPA-CRISPR/Cas12b assay for point-of-care SARS-CoV-2 detection</article-title>. <source>Front. Bioeng. Biotechnol.</source> <volume>9</volume>, <fpage>800104</fpage>. <pub-id pub-id-type="doi">10.3389/fbioe.2021.800104</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Aregawi</surname>
<given-names>W. G.</given-names>
</name>
<name>
<surname>Agga</surname>
<given-names>G. E.</given-names>
</name>
<name>
<surname>Abdi</surname>
<given-names>R. D.</given-names>
</name>
<name>
<surname>Buscher</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Systematic review and meta-analysis on the global distribution, host range, and prevalence of Trypanosoma evansi</article-title>. <source>Parasit. Vectors</source> <volume>12</volume> (<issue>1</issue>), <fpage>67</fpage>. <pub-id pub-id-type="doi">10.1186/s13071-019-3311-4</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Austen</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Barbosa</surname>
<given-names>A. D.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Diversity and epidemiology of bat trypanosomes: a one Health perspective</article-title>. <source>Pathogens</source> <volume>10</volume> (<issue>9</issue>), <fpage>1148</fpage>. <pub-id pub-id-type="doi">10.3390/pathogens10091148</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Behour</surname>
<given-names>T. S.</given-names>
</name>
<name>
<surname>Abd El Fattah</surname>
<given-names>E. M.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Genotyping of Trypanosoma brucei evansi in Egyptian camels: detection of a different non-RoTat 1.2 Trypanosoma brucei evansi in Egyptian camels</article-title>. <source>Trop. Anim. Health Prod.</source> <volume>55</volume> (<issue>4</issue>), <fpage>279</fpage>. <pub-id pub-id-type="doi">10.1007/s11250-023-03673-6</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Behour</surname>
<given-names>T. S.</given-names>
</name>
<name>
<surname>Aboelhadid</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Mousa</surname>
<given-names>W. M.</given-names>
</name>
<name>
<surname>Amin</surname>
<given-names>A. S.</given-names>
</name>
<name>
<surname>El-Ashram</surname>
<given-names>S. A.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Molecular diagnosis of acute and chronic infection of Trypanosoma evansi in experimental male and female mice</article-title>. <source>Onderstepoort J. Vet. Res.</source> <volume>86</volume> (<issue>1</issue>), <fpage>e1</fpage>&#x2013;<lpage>e10</lpage>. <pub-id pub-id-type="doi">10.4102/ojvr.v86i1.1638</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Birhanu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Gebrehiwot</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Goddeeris</surname>
<given-names>B. M.</given-names>
</name>
<name>
<surname>Buscher</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Van Reet</surname>
<given-names>N.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>New trypanosoma evansi type B isolates from Ethiopian dromedary camels</article-title>. <source>PLoS Negl. Trop. Dis.</source> <volume>10</volume> (<issue>4</issue>), <fpage>e0004556</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pntd.0004556</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boushaki</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Adel</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Dia</surname>
<given-names>M. L.</given-names>
</name>
<name>
<surname>Buscher</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Madani</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Brihoum</surname>
<given-names>B. A.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Epidemiological investigations on Trypanosoma evansi infection in dromedary camels in the South of Algeria</article-title>. <source>Heliyon</source> <volume>5</volume> (<issue>7</issue>), <fpage>e02086</fpage>. <pub-id pub-id-type="doi">10.1016/j.heliyon.2019.e02086</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brun</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Hecker</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Lun</surname>
<given-names>Z. R.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>Trypanosoma evansi and T. equiperdum: distribution, biology, treatment and phylogenetic relationship (a review)</article-title>. <source>Vet. Parasitol.</source> <volume>79</volume> (<issue>2</issue>), <fpage>95</fpage>&#x2013;<lpage>107</lpage>. <pub-id pub-id-type="doi">10.1016/s0304-4017(98)00146-0</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>J. S.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Harrington</surname>
<given-names>L. B.</given-names>
</name>
<name>
<surname>Da Costa</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Palefsky</surname>
<given-names>J. M.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity</article-title>. <source>Science</source> <volume>360</volume> (<issue>6387</issue>), <fpage>436</fpage>&#x2013;<lpage>439</lpage>. <pub-id pub-id-type="doi">10.1126/science.aar6245</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Claes</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Radwanska</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Urakawa</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Majiwa</surname>
<given-names>P. A.</given-names>
</name>
<name>
<surname>Goddeeris</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Buscher</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Variable Surface Glycoprotein RoTat 1.2 PCR as a specific diagnostic tool for the detection of Trypanosoma evansi infections</article-title>. <source>Kinetoplastid Biol. Dis.</source> <volume>3</volume> (<issue>1</issue>), <fpage>3</fpage>. <pub-id pub-id-type="doi">10.1186/1475-9292-3-3</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cunningham</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Hennelly</surname>
<given-names>C. M.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>J. T.</given-names>
</name>
<name>
<surname>Ubalee</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Boyce</surname>
<given-names>R. M.</given-names>
</name>
<name>
<surname>Mulogo</surname>
<given-names>E. M.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>A novel CRISPR-based malaria diagnostic capable of Plasmodium detection, species differentiation, and drug-resistance genotyping</article-title>. <source>EBioMedicine</source> <volume>68</volume>, <fpage>103415</fpage>. <pub-id pub-id-type="doi">10.1016/j.ebiom.2021.103415</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Davila</surname>
<given-names>A. M.</given-names>
</name>
<name>
<surname>Herrera</surname>
<given-names>H. M.</given-names>
</name>
<name>
<surname>Schlebinger</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Souza</surname>
<given-names>S. S.</given-names>
</name>
<name>
<surname>Traub-Cseko</surname>
<given-names>Y. M.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Using PCR for unraveling the cryptic epizootiology of livestock trypanosomosis in the Pantanal, Brazil</article-title>. <source>Vet. Parasitol.</source> <volume>117</volume> (<issue>1-2</issue>), <fpage>1</fpage>&#x2013;<lpage>13</lpage>. <pub-id pub-id-type="doi">10.1016/j.vetpar.2003.08.002</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Deng</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Stejskal</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Opit</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Z.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>An advanced approach for rapid visual identification of Liposcelis bostrychophila (Psocoptera: liposcelididae) based on CRISPR/Cas12a combined with RPA</article-title>. <source>J. Econ. Entomol.</source> <volume>116</volume> (<issue>5</issue>), <fpage>1911</fpage>&#x2013;<lpage>1921</lpage>. <pub-id pub-id-type="doi">10.1093/jee/toad139</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>East-Seletsky</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>O&#x27;Connell</surname>
<given-names>M. R.</given-names>
</name>
<name>
<surname>Knight</surname>
<given-names>S. C.</given-names>
</name>
<name>
<surname>Burstein</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Cate</surname>
<given-names>J. H.</given-names>
</name>
<name>
<surname>Tjian</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection</article-title>. <source>Nature</source> <volume>538</volume> (<issue>7624</issue>), <fpage>270</fpage>&#x2013;<lpage>273</lpage>. <pub-id pub-id-type="doi">10.1038/nature19802</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fikru</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Andualem</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Getachew</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Menten</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Hasker</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Merga</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Trypanosome infection in dromedary camels in Eastern Ethiopia: prevalence, relative performance of diagnostic tools and host related risk factors</article-title>. <source>Vet. Parasitol.</source> <volume>211</volume> (<issue>3-4</issue>), <fpage>175</fpage>&#x2013;<lpage>181</lpage>. <pub-id pub-id-type="doi">10.1016/j.vetpar.2015.04.008</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gootenberg</surname>
<given-names>J. S.</given-names>
</name>
<name>
<surname>Abudayyeh</surname>
<given-names>O. O.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>J. W.</given-names>
</name>
<name>
<surname>Essletzbichler</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Dy</surname>
<given-names>A. J.</given-names>
</name>
<name>
<surname>Joung</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>Nucleic acid detection with CRISPR-Cas13a/C2c2</article-title>. <source>Science</source> <volume>356</volume> (<issue>6336</issue>), <fpage>438</fpage>&#x2013;<lpage>442</lpage>. <pub-id pub-id-type="doi">10.1126/science.aam9321</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gutierrez</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Desquesnes</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Touratier</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Buscher</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Trypanosoma evansi: recent outbreaks in Europe</article-title>. <source>Vet. Parasitol.</source> <volume>174</volume> (<issue>1-2</issue>), <fpage>26</fpage>&#x2013;<lpage>29</lpage>. <pub-id pub-id-type="doi">10.1016/j.vetpar.2010.08.012</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Harris</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Gause</surname>
<given-names>W. C.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>To B or not to B: B cells and the Th2-type immune response to helminths</article-title>. <source>Trends Immunol.</source> <volume>32</volume> (<issue>2</issue>), <fpage>80</fpage>&#x2013;<lpage>88</lpage>. <pub-id pub-id-type="doi">10.1016/j.it.2010.11.005</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huyke</surname>
<given-names>D. A.</given-names>
</name>
<name>
<surname>Ramachandran</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Bashkirov</surname>
<given-names>V. I.</given-names>
</name>
<name>
<surname>Kotseroglou</surname>
<given-names>E. K.</given-names>
</name>
<name>
<surname>Kotseroglou</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Santiago</surname>
<given-names>J. G.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Enzyme Kinetics and detector sensitivity determine limits of detection of amplification-free CRISPR-Cas12 and CRISPR-Cas13 diagnostics</article-title>. <source>Anal. Chem.</source> <volume>94</volume> (<issue>27</issue>), <fpage>9826</fpage>&#x2013;<lpage>9834</lpage>. <pub-id pub-id-type="doi">10.1021/acs.analchem.2c01670</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jinek</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Chylinski</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Fonfara</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Hauer</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Doudna</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Charpentier</surname>
<given-names>E.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity</article-title>. <source>Science</source> <volume>337</volume> (<issue>6096</issue>), <fpage>816</fpage>&#x2013;<lpage>821</lpage>. <pub-id pub-id-type="doi">10.1126/science.1225829</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Joshi</surname>
<given-names>P. P.</given-names>
</name>
<name>
<surname>Shegokar</surname>
<given-names>V. R.</given-names>
</name>
<name>
<surname>Powar</surname>
<given-names>R. M.</given-names>
</name>
<name>
<surname>Herder</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Katti</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Salkar</surname>
<given-names>H. R.</given-names>
</name>
<etal/>
</person-group> (<year>2005</year>). <article-title>Human trypanosomiasis caused by Trypanosoma evansi in India: the first case report</article-title>. <source>Am. J. Trop. Med. Hyg.</source> <volume>73</volume> (<issue>3</issue>), <fpage>491</fpage>&#x2013;<lpage>495</lpage>. <pub-id pub-id-type="doi">10.4269/ajtmh.2005.73.491</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Joung</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Ladha</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Saito</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>N. G.</given-names>
</name>
<name>
<surname>Woolley</surname>
<given-names>A. E.</given-names>
</name>
<name>
<surname>Segel</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Detection of SARS-CoV-2 with SHERLOCK one-pot testing</article-title>. <source>N. Engl. J. Med.</source> <volume>383</volume> (<issue>15</issue>), <fpage>1492</fpage>&#x2013;<lpage>1494</lpage>. <pub-id pub-id-type="doi">10.1056/NEJMc2026172</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kasozi</surname>
<given-names>K. I.</given-names>
</name>
<name>
<surname>Zirintunda</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Ssempijja</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Buyinza</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Alzahrani</surname>
<given-names>K. J.</given-names>
</name>
<name>
<surname>Matama</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Epidemiology of trypanosomiasis in wildlife-implications for humans at the wildlife interface in Africa</article-title>. <source>Front. Vet. Sci.</source> <volume>8</volume>, <fpage>621699</fpage>. <pub-id pub-id-type="doi">10.3389/fvets.2021.621699</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Alvarez-Rodriguez</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Radwanska</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Magez</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Recent progress in the detection of Surra, a neglected disease caused by trypanosoma evansi with a one Health impact in large parts of the tropic and sub-tropic World</article-title>. <source>Microorganisms</source> <volume>12</volume> (<issue>1</issue>), <fpage>44</fpage>. <pub-id pub-id-type="doi">10.3390/microorganisms12010044</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname>
<given-names>R. A.</given-names>
</name>
<name>
<surname>Puig</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Nguyen</surname>
<given-names>P. Q.</given-names>
</name>
<name>
<surname>Angenent-Mari</surname>
<given-names>N. M.</given-names>
</name>
<name>
<surname>Donghia</surname>
<given-names>N. M.</given-names>
</name>
<name>
<surname>McGee</surname>
<given-names>J. P.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Ultrasensitive CRISPR-based diagnostic for field-applicable detection of Plasmodium species in symptomatic and asymptomatic malaria</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>117</volume> (<issue>41</issue>), <fpage>25722</fpage>&#x2013;<lpage>25731</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.2010196117</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lejon</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Claes</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Verloo</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Maina</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Urakawa</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Majiwa</surname>
<given-names>P. A.</given-names>
</name>
<etal/>
</person-group> (<year>2005</year>). <article-title>Recombinant RoTat 1.2 variable surface glycoprotein as antigen for diagnosis of Trypanosoma evansi in dromedary camels</article-title>. <source>Int. J. Parasitol.</source> <volume>35</volume> (<issue>4</issue>), <fpage>455</fpage>&#x2013;<lpage>460</lpage>. <pub-id pub-id-type="doi">10.1016/j.ijpara.2004.12.015</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>G.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>HOLMESv2: a CRISPR-Cas12b-assisted platform for nucleic acid detection and DNA methylation quantitation</article-title>. <source>ACS Synth. Biol.</source> <volume>8</volume> (<issue>10</issue>), <fpage>2228</fpage>&#x2013;<lpage>2237</lpage>. <pub-id pub-id-type="doi">10.1021/acssynbio.9b00209</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>S. Y.</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>Q. X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X. Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z. L.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>CRISPR-Cas12a-assisted nucleic acid detection</article-title>. <source>Cell Discov.</source> <volume>4</volume>, <fpage>20</fpage>. <pub-id pub-id-type="doi">10.1038/s41421-018-0028-z</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Pinto Torres</surname>
<given-names>J. E.</given-names>
</name>
<name>
<surname>Goossens</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Stijlemans</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Sterckx</surname>
<given-names>Y. G.</given-names>
</name>
<name>
<surname>Magez</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Development of a recombinase polymerase amplification lateral flow assay for the detection of active Trypanosoma evansi infections</article-title>. <source>PLoS Negl. Trop. Dis.</source> <volume>14</volume> (<issue>2</issue>), <fpage>e0008044</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pntd.0008044</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yin</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2017</year>). <article-title>C2c1-sgRNA complex structure reveals RNA-guided DNA cleavage mechanism</article-title>. <source>Mol. Cell</source> <volume>65</volume> (<issue>2</issue>), <fpage>310</fpage>&#x2013;<lpage>322</lpage>. <pub-id pub-id-type="doi">10.1016/j.molcel.2016.11.040</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lun</surname>
<given-names>Z. R.</given-names>
</name>
<name>
<surname>Desser</surname>
<given-names>S. S.</given-names>
</name>
</person-group> (<year>1995</year>). <article-title>Is the broad range of hosts and geographical distribution of Trypanosoma evansi attributable to the loss of maxicircle kinetoplast DNA?</article-title> <source>Parasitol. Today</source> <volume>11</volume> (<issue>4</issue>), <fpage>131</fpage>&#x2013;<lpage>133</lpage>. <pub-id pub-id-type="doi">10.1016/0169-4758(95)80129-4</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Masiga</surname>
<given-names>D. K.</given-names>
</name>
<name>
<surname>Smyth</surname>
<given-names>A. J.</given-names>
</name>
<name>
<surname>Hayes</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Bromidge</surname>
<given-names>T. J.</given-names>
</name>
<name>
<surname>Gibson</surname>
<given-names>W. C.</given-names>
</name>
</person-group> (<year>1992</year>). <article-title>Sensitive detection of trypanosomes in tsetse flies by DNA amplification</article-title>. <source>Int. J. Parasitol.</source> <volume>22</volume> (<issue>7</issue>), <fpage>909</fpage>&#x2013;<lpage>918</lpage>. <pub-id pub-id-type="doi">10.1016/0020-7519(92)90047-o</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mojahed</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Mohammadkhani</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Mohamadkhani</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Climate crises and developing vector-borne diseases: a narrative review</article-title>. <source>Iran. J. Public Health</source> <volume>51</volume> (<issue>12</issue>), <fpage>2664</fpage>&#x2013;<lpage>2673</lpage>. <pub-id pub-id-type="doi">10.18502/ijph.v51i12.11457</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Myhrvold</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Freije</surname>
<given-names>C. A.</given-names>
</name>
<name>
<surname>Gootenberg</surname>
<given-names>J. S.</given-names>
</name>
<name>
<surname>Abudayyeh</surname>
<given-names>O. O.</given-names>
</name>
<name>
<surname>Metsky</surname>
<given-names>H. C.</given-names>
</name>
<name>
<surname>Durbin</surname>
<given-names>A. F.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Field-deployable viral diagnostics using CRISPR-Cas13</article-title>. <source>Science</source> <volume>360</volume> (<issue>6387</issue>), <fpage>444</fpage>&#x2013;<lpage>448</lpage>. <pub-id pub-id-type="doi">10.1126/science.aas8836</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ngaira</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Njagi</surname>
<given-names>E. N.</given-names>
</name>
<name>
<surname>Ngeranwa</surname>
<given-names>J. J.</given-names>
</name>
<name>
<surname>Olembo</surname>
<given-names>N. K.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>PCR amplification of RoTat 1.2 VSG gene in Trypanosoma evansi isolates in Kenya</article-title>. <source>Vet. Parasitol.</source> <volume>120</volume> (<issue>1-2</issue>), <fpage>23</fpage>&#x2013;<lpage>33</lpage>. <pub-id pub-id-type="doi">10.1016/j.vetpar.2003.12.007</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ngaira</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Olembo</surname>
<given-names>N. K.</given-names>
</name>
<name>
<surname>Njagi</surname>
<given-names>E. N.</given-names>
</name>
<name>
<surname>Ngeranwa</surname>
<given-names>J. J.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>The detection of non-RoTat 1.2 Trypanosoma evansi</article-title>. <source>Exp. Parasitol.</source> <volume>110</volume> (<issue>1</issue>), <fpage>30</fpage>&#x2013;<lpage>38</lpage>. <pub-id pub-id-type="doi">10.1016/j.exppara.2005.01.001</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nguyen</surname>
<given-names>L. T.</given-names>
</name>
<name>
<surname>Macaluso</surname>
<given-names>N. C.</given-names>
</name>
<name>
<surname>Pizzano</surname>
<given-names>B. L. M.</given-names>
</name>
<name>
<surname>Cash</surname>
<given-names>M. N.</given-names>
</name>
<name>
<surname>Spacek</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Karasek</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>A thermostable Cas12b from Brevibacillus leverages one-pot discrimination of SARS-CoV-2 variants of concern</article-title>. <source>EBioMedicine</source> <volume>77</volume>, <fpage>103926</fpage>. <pub-id pub-id-type="doi">10.1016/j.ebiom.2022.103926</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Njiru</surname>
<given-names>Z. K.</given-names>
</name>
<name>
<surname>Constantine</surname>
<given-names>C. C.</given-names>
</name>
<name>
<surname>Masiga</surname>
<given-names>D. K.</given-names>
</name>
<name>
<surname>Reid</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Thompson</surname>
<given-names>R. C.</given-names>
</name>
<name>
<surname>Gibson</surname>
<given-names>W. C.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Characterization of Trypanosoma evansi type B</article-title>. <source>Infect. Genet. Evol.</source> <volume>6</volume> (<issue>4</issue>), <fpage>292</fpage>&#x2013;<lpage>300</lpage>. <pub-id pub-id-type="doi">10.1016/j.meegid.2005.08.002</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Njiru</surname>
<given-names>Z. K.</given-names>
</name>
<name>
<surname>Ouma</surname>
<given-names>J. O.</given-names>
</name>
<name>
<surname>Enyaru</surname>
<given-names>J. C.</given-names>
</name>
<name>
<surname>Dargantes</surname>
<given-names>A. P.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Loop-mediated Isothermal Amplification (LAMP) test for detection of Trypanosoma evansi strain B</article-title>. <source>Exp. Parasitol.</source> <volume>125</volume> (<issue>3</issue>), <fpage>196</fpage>&#x2013;<lpage>201</lpage>. <pub-id pub-id-type="doi">10.1016/j.exppara.2010.01.017</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pathak</surname>
<given-names>K. M.</given-names>
</name>
<name>
<surname>Singh</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Meirvenne</surname>
<given-names>N. V.</given-names>
</name>
<name>
<surname>Kapoor</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>Evaluation of various diagnostic techniques for Trypanosoma evansi infections in naturally infected camels</article-title>. <source>Vet. Parasitol.</source> <volume>69</volume> (<issue>1-2</issue>), <fpage>49</fpage>&#x2013;<lpage>54</lpage>. <pub-id pub-id-type="doi">10.1016/s0304-4017(96)01091-6</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pays</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Radwanska</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Magez</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>The pathogenesis of african trypanosomiasis</article-title>. <source>Annu. Rev. Pathol.</source> <volume>18</volume>, <fpage>19</fpage>&#x2013;<lpage>45</lpage>. <pub-id pub-id-type="doi">10.1146/annurev-pathmechdis-031621-025153</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Powar</surname>
<given-names>R. M.</given-names>
</name>
<name>
<surname>Shegokar</surname>
<given-names>V. R.</given-names>
</name>
<name>
<surname>Joshi</surname>
<given-names>P. P.</given-names>
</name>
<name>
<surname>Dani</surname>
<given-names>V. S.</given-names>
</name>
<name>
<surname>Tankhiwale</surname>
<given-names>N. S.</given-names>
</name>
<name>
<surname>Truc</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2006</year>). <article-title>A rare case of human trypanosomiasis caused by Trypanosoma evansi</article-title>. <source>Indian J. Med. Microbiol.</source> <volume>24</volume> (<issue>1</issue>), <fpage>72</fpage>&#x2013;<lpage>74</lpage>. <pub-id pub-id-type="doi">10.4103/0255-0857.19904</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Radwanska</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Guirnalda</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>De Trez</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Ryffel</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Black</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Magez</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Trypanosomiasis-induced B cell apoptosis results in loss of protective anti-parasite antibody responses and abolishment of vaccine-induced memory responses</article-title>. <source>PLoS Pathog.</source> <volume>4</volume> (<issue>5</issue>), <fpage>e1000078</fpage>. <pub-id pub-id-type="doi">10.1371/journal.ppat.1000078</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Reyna-Bello</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Garcia</surname>
<given-names>F. A.</given-names>
</name>
<name>
<surname>Rivera</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Sanso</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Aso</surname>
<given-names>P. M.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>Enzyme-linked immunosorbent assay (ELISA) for detection of anti-Trypanosoma evansi equine antibodies</article-title>. <source>Vet. Parasitol.</source> <volume>80</volume> (<issue>2</issue>), <fpage>149</fpage>&#x2013;<lpage>157</lpage>. <pub-id pub-id-type="doi">10.1016/s0304-4017(98)00199-x</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Salim</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Bakheit</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Kamau</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Nakamura</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Sugimoto</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Molecular epidemiology of camel trypanosomiasis based on ITS1 rDNA and RoTat 1.2 VSG gene in the Sudan</article-title>. <source>Parasit. Vectors</source> <volume>4</volume>, <fpage>31</fpage>. <pub-id pub-id-type="doi">10.1186/1756-3305-4-31</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sereno</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Oury</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Geiger</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Vela</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Karmaoui</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Desquesnes</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Isothermal nucleic acid amplification to detect infection caused by parasites of the trypanosomatidae family: a literature review and opinion on the laboratory to field applicability</article-title>. <source>Int. J. Mol. Sci.</source> <volume>23</volume> (<issue>14</issue>), <fpage>7543</fpage>. <pub-id pub-id-type="doi">10.3390/ijms23147543</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sima</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Dujeancourt-Henry</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Perlaza</surname>
<given-names>B. L.</given-names>
</name>
<name>
<surname>Ungeheuer</surname>
<given-names>M. N.</given-names>
</name>
<name>
<surname>Rotureau</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Glover</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>SHERLOCK4HAT: a CRISPR-based tool kit for diagnosis of Human African Trypanosomiasis</article-title>. <source>EBioMedicine</source> <volume>85</volume>, <fpage>104308</fpage>. <pub-id pub-id-type="doi">10.1016/j.ebiom.2022.104308</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tehseen</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Jahan</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Qamar</surname>
<given-names>M. F.</given-names>
</name>
<name>
<surname>Desquesnes</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Shahzad</surname>
<given-names>M. I.</given-names>
</name>
<name>
<surname>Deborggraeve</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Parasitological, serological and molecular survey of Trypanosoma evansi infection in dromedary camels from Cholistan Desert, Pakistan</article-title>. <source>Parasit. Vectors</source> <volume>8</volume>, <fpage>415</fpage>. <pub-id pub-id-type="doi">10.1186/s13071-015-1002-3</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Teng</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Cui</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>Q.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>Repurposing CRISPR-Cas12b for mammalian genome engineering</article-title>. <source>Cell Discov.</source> <volume>4</volume>, <fpage>63</fpage>. <pub-id pub-id-type="doi">10.1038/s41421-018-0069-3</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Teng</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Cui</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X. G.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>Q.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity</article-title>. <source>Genome Biol.</source> <volume>20</volume> (<issue>1</issue>), <fpage>132</fpage>. <pub-id pub-id-type="doi">10.1186/s13059-019-1742-z</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tong</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Kong</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Goossens</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Radwanska</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Lou</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>DNA detection of Trypanosoma evansi: diagnostic validity of a new assay based on loop-mediated isothermal amplification (LAMP)</article-title>. <source>Vet. Parasitol.</source> <volume>250</volume>, <fpage>1</fpage>&#x2013;<lpage>6</lpage>. <pub-id pub-id-type="doi">10.1016/j.vetpar.2017.12.006</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Van Vinh Chau</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Buu Chau</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Desquesnes</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Herder</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Phu Huong Lan</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Campbell</surname>
<given-names>J. I.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>A clinical and epidemiological investigation of the first reported human infection with the zoonotic parasite trypanosoma evansi in southeast Asia</article-title>. <source>Clin. Infect. Dis.</source> <volume>62</volume> (<issue>8</issue>), <fpage>1002</fpage>&#x2013;<lpage>1008</lpage>. <pub-id pub-id-type="doi">10.1093/cid/ciw052</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Verloo</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Magnus</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Buscher</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>General expression of RoTat 1.2 variable antigen type in Trypanosoma evansi isolates from different origin</article-title>. <source>Vet. Parasitol.</source> <volume>97</volume> (<issue>3</issue>), <fpage>183</fpage>&#x2013;<lpage>189</lpage>. <pub-id pub-id-type="doi">10.1016/s0304-4017(01)00412-5</pub-id>
</citation>
</ref>
<ref id="B56">
<citation citation-type="book">
<collab>WOAH</collab> (<year>2021</year>). &#x201c;<article-title>Surra in all species (trypanosoma evansi infection)</article-title>,&#x201d; in <source>OIE terrestrial manual</source> (<publisher-loc>Paris</publisher-loc>: <publisher-name>WOAH</publisher-name>) <volume>1-3</volume>, <fpage>1833</fpage>. <comment>Available at: <ext-link ext-link-type="uri" xlink:href="https://www.woah.org/fileadmin/Home/fr/Health_standards/tahm/3.01.21_SURRA_TRYPANO.pdf">https://www.woah.org/fileadmin/Home/fr/Health_standards/tahm/3.01.21_SURRA_TRYPANO.pdf</ext-link>
</comment>.</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zou</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Mason</surname>
<given-names>M. G.</given-names>
</name>
<name>
<surname>Botella</surname>
<given-names>J. R.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Evaluation and improvement of isothermal amplification methods for point-of-need plant disease diagnostics</article-title>. <source>PLoS One</source> <volume>15</volume> (<issue>6</issue>), <fpage>e0235216</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0235216</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>