Sephadex G-75, acetylcholine chloride, Amberlite XAD-4, egg yolk phospholipids (3-sn-phosphatidylcholine from egg yolk), cocktail of protease inhibitors and Triton X-100 were purchased from Merck. [Acetyl-³H] acetylcholine iodide was from Perkin–Elmer. HEK293, HepG2 and HeLa cell lines were kindly provided by Dr. Massimo Tommasino (IARC/CIRC WHO, Lyon France); A549, HCT-15, MCF-7 cell lines were kindly provided by Dr. Daniela Gaglio (CNR- IBFM, Milan). Tissue culture media and foetal bovine serum were from Life Technologies. Goat anti-Rabbit IgG (H + L) Secondary Antibody, HRP was from Invitrogen. Anti-SLC22A4 antibody was from ABCAM. Anti-alpha tubulin antibody, mouse monoclonal and Goat Anti-Mouse IgG Antibody, HRP conjugate were from Merck. All the other reagents were of analytical grade.

From each cell line, the transporter was solubilized by treating a cell pellet, from 10 cm² plates up to 90% confluence with 100 μL 3% TX-100 in 20 mM Tris/HCl pH 7.5, 2.5 mM Sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na₃VO₄ and 1 μg/mL leupeptin, as previously described (Pochini et al., 2015). After incubation on ice for 30 min the lysate was centrifuged at 12,000 g for 15 min at 4°C. The supernatant (containing cell membrane extract) was quantified using Lowry Folin assay and used for the reconstitution. The mixture for reconstitution contained: 20–40 μL of the cell supernatant (200 μg proteins), 80 μL of 10% TritonX-100, 120 μL of 10% egg yolk phospholipids in the form of sonicated liposomes prepared as described previously (Pochini et al., 2011), 16 mM ATP and 5 mM Tris/HCl (pH 7.5) in a final volume of 700 μL. After vortex-mixing, this mixture was incubated with 0.5 g of Amberlite XAD-4 under rotatory stirring (1,300 rev/min) at 23°C for 45 min.

HEK293 and HeLa cell lines were maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% (v/v) Fetal Bovine Serum (FBS), 1 mM glutamine, 1 mM sodium pyruvate and Pen/strep as antibiotics. HCT-15 cell line was maintained in RPMI (with glucose) supplemented with 10% (v/v) Fetal Bovine Serum (FBS), 2 mM glutamine, and Pen/strep as antibiotics. A549, HepG2 and MCF-7 cell lines were maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% (v/v) Fetal Bovine Serum (FBS), 4 mM glutamine, 1 mM sodium pyruvate and Pen/strep as antibiotics. Cells were grown on 10 cm² plates at 37°C in a humidified incubator and a 5% CO₂ atmosphere.

A549 cells were seeded in a 6-well plate 24 h prior transfection and cultured using standard conditions until they reached 80% confluence. On the day of transfection, Lipofectamine RNAiMAX reagent (from Ambion by Life Technologies) was used according to manufacturer’s instructions. In brief, desired amount of siRNA scramble or OCTN1-targeting (Mission esiRNA from Merck Life Science) were diluted with Opti-MEM medium (from Gibco by Life Technologies); in parallel, lipofectamine was diluted with the same medium. Then, diluted siRNA was added to diluted Lipofectamine in a 1:1 ratio. The mixture was incubated for 5 min at room temperature. After the incubation, siRNA-lipid complexes were added to seeded A549 cells. After 72 h of transfection incubated at 37°C in a 5% CO₂ incubator, cells were used in downstream applications.

Total cellular RNA was extracted from A549 pellet, deriving from a confluent 75 cm² flask, using the pureLink RNA mini kit (Invitrogen). Then, RevertAid First Strand cDNA Synthesis Kit (Invitrogen) was used to synthesize cDNA with random hexa primers starting from 1 µg of total RNA. Reverse transcriptase PCR (RT-PCR) analyses were carried out using the following primers: FW 5′CCTGCCCAGGCGTTATATCAT 3′ and Rev 3′CTGCTGAGCTCTACCCAACC5’ (for OCTN1), FW 5′TTTTGTGAGAGCCGTGACTG3′ and Rev 3′CGGTTGCTCATCAGGTAGGT (for ChAT), FW 5′CTGGGAGTGGGTGGAGGC3′ and Rev 3′ TCAACTGGTCTCAAGTCAGTG 5’ (for Actin).

Uptake and efflux assays in proteoliposomes were performed as previously described (Pochini et al., 2012b). In brief, 550 μL of proteoliposomes were subjected to size-exclusion chromatography onto a Sephadex G-75 column (0.7 cm diameter × 15 cm height) pre-equilibrated with 5 mM Tris/HCl (pH 7.5). Then, samples of 100 μL each of the collected proteoliposomes (600 μL) were used for transport measurements. In the case of uptake assays, transport was started by adding 0.1 mM [³H]ACh to proteoliposomes and stopped according to the stop inhibitor method. In the case of efflux measurements, aliquots of proteoliposomes were incubated with 0.1 mM external [³H]ACh. After 90 min, corresponding to the optimal intraliposomal [³H]ACh accumulation the proteoliposomes were passed again through a Sephadex G-75 column and the time course of [³H]ACh efflux was then measured as described for the uptake procedure. Finally, the radioactivity taken up (or remained inside in the case of efflux) was counted after passing each 100 μL sample through a Sephadex G-75 column (0.6 cm diameter × 8 cm height) to separate the external from the internal radioactivity. The experimental values were analysed using a first order rate equation or a single exponential decay equation, in the case of uptake or efflux, respectively. The Grafit (version 5.0.13) software was used for calculations.

Protein amount was measured using the ChemiDoc imaging system equipped with Quantity One software (Bio-Rad Laboratories). Immunoblotting analysis was performed on cell extracts obtained as described in Section 2.2 using an antiserum dilution of 1:1000 for all the used primary antibodies prepared in 3% BSA and incubated overnight under shaking at 4°C. Then, 1:5000 secondary antibody (anti-rabbit) was prepared in 1% BSA and incubated 1 h at room temperature under shaking. The reaction was detected by Electro Chemi Luminescence (ECL) assay using the ChemiDoc imaging system equipped with Image Lab software (Bio-Rad Laboratories).

First order rate equation: A_t = A_∞ (1- e^-kt) used for uptake assay, where At and A∞ represent the nanomoles of substrate taken up at time t and at infinite time, respectively. Initial transport rate is evaluated as the product of the first-order rate constant, k, and the nanomoles of substrate taken up at the equilibrium.

Single exponential decay equation: y = A₀ e^-kt used for efflux assay where y and A are the internal radioactivity (cpm) at time t and time zero, respectively. The rate constant k is derived from the decrease in the radioactivity inside the liposomes at various times until equilibrium.

Results are expressed as means ± SD and the number of replicates is indicated in figure legends. Comparisons between two groups were performed with the two-tailed Student’s unpaired t-test for p < 0.05 (*) and p <0.01 (**) as specified in figure legends. For multiple comparisons, ANOVA one way test was employed for *p < 0.05, **p < 0.01, ***p < 0.005 as specified in figure legends.

The expression of OCTN1 has been investigated in the non-small cell lung cancer cell line A549 in comparison with other cell lines (Figures 1A, B), prototypes of aggressive cancers, most of which are also known to rely on non-neuronal ACh signalling (Parnell et al., 2012; Friedman et al., 2019; Aronowitz et al., 2022; Zhang et al., 2020); HEK293 was employed as control due to the relatively low level of OCTN1 expression (Tamai et al., 1997; Drenberg et al., 2017; Tamai et al., 2000). A protein band appeared in all cell extracts with different intensities (Figure 1A). The quantitative analysis, using Alpha-tubulin as a loading control, revealed that A549 expressed OCTN1 at a significantly higher level compared to the other cell lines (Figures 1A, B). The expression of OCTN1 mRNA was confirmed in A549 by RT-PCR, as well (Figure 1C). To confirm the existence of the NNCS in lung cancer the Choline Acetyltransferase was identified by RT-PCR (Supplementary Figure 1).

As a reliable proof of OCTN1-mediated ACh transport, the time course of [³H]ACh transport was measured into proteoliposomes reconstituted with the different cancer cell extracts, as previously described (Pochini et al., 2015; Pochini et al., 2016). In agreement with the Western blot, A549 showed a higher transport activity followed by HeLa, HCT-15, MCF-7, HepG2 and HEK-293 (Figure 2A). To prove the specificity of the OCTN1-mediated ACh transport, proteoliposomes reconstituted with the A549 cell extract, containing the cell membrane proteins, were incubated with the anti-OCTN1 antibody; the uptake of [³H]ACh decreased by 83% (Figure 2B). As a control, the uptake of [³H]ACh was measured after incubation with an anti-His antibody that was previously shown to inhibit the recombinant human OCTN1 harbouring a 6 His tag (Pochini et al., 2015). The anti-His did not influence the activity of the A549 transporter confirming that the measured transport was specifically attributable to the native OCTN1 expressed by A549 (Figure 2B). This data also indicates that most, if not all, ACh transport capacity of A549 is performed by OCTN1. A little residual contribution to the transport of Ach may be due to other transporters known to mediate Ach transport, such as OCTs. However, in agreement with our data, expression of OCTN1 in lung is reported to be higher (Kummer and Krasteva-Christ, 2014; Sakamoto et al., 2013) than OCTs and, in spite of some contradictory data reported for OCTs, the expression of OCTN1 in lung is unequivocally described (Endter et al., 2009; Courcot et al., 2012; Salomon et al., 2012). To further confirm that the transport of [³H]ACh was mediated by OCTN1, A549 cell extract derived by transfection with OCTN1-targeting siRNA was used for preparing proteoliposomes; a significant difference was observed in the uptake of [³H]ACh with respect to A549 cell extract derived from cells transfected with siRNA scramble (Figures 2C, D).

Previous studies demonstrated that ATP present in the intracellular (Tamai et al., 1997) or the intraliposomal (Pochini et al., 2012a; Pochini et al., 2011) compartment strongly stimulates the OCTN1-mediated transport; whereas, sodium present in the extracellular (Pochini et al., 2015) or in the extraliposomal (Pochini et al., 2012b) compartment strongly inhibits the uptake. As shown in Figure 3A, [³H]ACh uptake in proteoliposomes strongly decreased in the absence of internal ATP or the presence of external sodium. The pH dependence was also investigated; in agreement with previous data obtained in intact cells or proteoliposomes (Pochini et al., 2011; Tamai et al., 1997), transport activity increased by increasing pH from pH 7.0 to pH 8.0, even though with low significance (Figure 3B).

Another specific feature of OCTN1 is its inhibition by choline, TEA, hemicholinium, an inhibitor of the high-affinity uptake system for choline, ipratropium, an ACh receptor antagonist and at a lower extent, by some carnitine analogues and by polyamines that were reported as substrates (Pochini et al., 2015; Pochini et al., 2022). The [³H]ACh uptake measured in proteoliposomes reconstituted with the A549 cell extract was significantly inhibited by hemicholinium, γ-butyrobetaine, choline, acetylcarnitine, ipratropium, TEA and spermidine whereas neostigmine had no effect (Figure 3C). The behaviour towards these compounds is similar to that previously described employing the recombinant OCTN1 or the protein extracted from HeLa or mesothelial cells (Pochini et al., 2015; Pochini et al., 2016). The effect of chemical agents that react with sulfhydryl groups (SH reagents) such as 2-aminoethyl methanethiosulfonate (MTSEA) or HgCl₂ and the Lys reagent pyridoxal phosphate (PLP) was tested on the uptake (Figure 3D). Among these, HgCl₂ was found to strongly inhibit OCTN1 according to previous findings on the recombinant OCTN1 (Pochini et al., 2011).

As stated in the introduction, the efflux of ACh should be the physiological transport mode of OCTN1 to allow the export of ACh from cells. Therefore, efflux experiments were performed in the presence of external sodium (Figure 4A). Interestingly, [³H]ACh efflux was not inhibited by sodium, according to the OCTN1-mediated transport. The effect of internal potassium was also investigated in the absence or the presence of external sodium (Figure 4B). The efflux increased under conditions mimicking the physiological environment, that is with internal potassium and external sodium. To further confirm the OCTN1-mediated [³H]ACh efflux, transport has been measured from proteoliposomes reconstituted in the presence of the OCTN1-specific antibody (Figure 4C).