Fresh samples of A. orientale were collected from Jian′ou County, Fujian Province, China (27°18′18′′ N, 118°8′21′′ E, in 2022) and separated into four different parts: leaf, flower, rhizome and root (Figure 1). All collected samples were kept on ice and transported to the laboratory for further processing.

Fungal endophytes were isolated from the different plant parts within 24 h of harvest. Surface sterilization of the plant samples was performed according to previously described methods (Rehman et al., 2022; Shen et al., 2023). Briefly, separated plant parts (rhizomes, flowers, roots and leaves) were rinsed repeatedly with running water to remove surface soil particles and adhered debris. Sections were then sliced into smaller sections and moved to a clean bench for surface sterilization as follows: samples were rinsed in sterile water for 30 s, then soaked in 75% ethanol for 2 min, followed by a 5 min exposure to 3% NaClO, and 3X rinses with sterile water and then drained on sterile filter paper. Samples were then cut into 2 mm³ sections using a sterile knife. A portion of the disinfected samples were immersed in liquid nitrogen for 20 min and then stored at −80 °C for future use (high-throughput sequencing). The remaining portions were used for isolation of endophytic fungi as follows: sections of cut tissue pieces were placed on (i) potato dextrose agar (PDA) media, (ii) Rose Bengal agar (RBA), and (iii) corn meal malt extract agar (CMM) supplemented with 50 mg/L chloramphenicol to inhibit the growth of bacteria. The plates were cultured at 28 °C for 7–10 days. Any fungal colonies apparent were then subculture by transferring the hyphal tips to fresh culture dishes until colonies appeared pure. The pure isolated strains were stored in 15% glycerol (v/v) at −20 °C (Chowdhary and Sharma, 2020).

A total of 19 strains were purified from four different parts of A. orientale, comprising 6 strains from rhizomes, 5 from roots, 5 from leaves, and 3 from flowers, designated as RH1-6, RT1-5, LF1-5, and FL1-3, respectively. Fungal isolates were subsequently identified by morphology and DNA loci sequencing. Fungal genomic DNA isolation was purified using Fungal DNA Kit (Omega Bio-tek, Inc.) according to the manufacturer’s instructions. Primers pair used for amplification of target genes were listed in Supplementary Table S1 and included ITS, LSU, IGS, TEF, CAM, RPB1, RPB2, TUB2, ACT, CMD, GAPDH, HIS, TEF1-α, and BenA loci. PCR products from genomic loci amplification were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Sequences were aligned with the NCBI GenBank database using BLAST to identify those with high similarity. Clustal X 1.83 software was used to carry out multiple sequence alignments. Phylogenetic analysis was conducted using MEGA X via the Neighbor-Joining (NJ) method with 1,000 bootstraps.

After surface disinfection, plant section samples frozen in liquid nitrogen and stored at -80 °C were sent to Gene De novo Biotechnology Co., Ltd. (Guangzhou, China) for ITS amplicon high-throughput sequencing analysis using the primers ITS1_F_KYO2 (TAGAGGAAGTAAAAGTCGTAA) and ITS86R (TTCAAAGATTCGATGATTCAC). Three biological replicates were included for each of the experimental groups.

A. orientale seeds were rinsed thoroughly with tap water to remove surface soil particles and soaked in water for 3 h before undergoing surface sterilization as follows: seeds were rinsed in sterile water for 30 s, then soaked in 75% ethanol for 2 min, followed by a 15 min exposure to 3% NaClO. Seeds were then rinsed three times with sterile water and then dried on sterile filter paper. The sterilized seeds were placed in tissue culture bottles containing Murashige and Skoog (MS) media for germination, and incubated in an illuminating incubator protected from light at 28 °C for 7 d. After germination, the seedlings were subjected to a 14 h light/10 h dark photoperiod at 28 °C and an illumination intensity of 6,000 Lux. After one week of light exposure, seedlings were transferred for continued growth, with three seedlings/bottle under the same lighting conditions. Cultivation was continued for an additional three weeks. Co-culture of plant with fungal inocula was performed by placing a 5 mm diameter fungal agar plug from a growing plate 3 cm from the root tip of the seedling. Each seedling was inoculated with one fungal agar block. Control (uninoculated) PDA plugs were used as negative controls treatments. After three weeks of co-culture, plant root length, height, lateral root number, fresh weight, and number of leaves were recorded immediately after harvest, whereas total dry weight was measured from samples after 8 h oven drying at 50 °C to constant weight.

The main roots of A. orientale in different groups were collected after three weeks of co-culture. The roots intended for scanning electron microscopy (SEM) were fixed in 2% glutaraldehyde at 4 °C for 24 h, followed by three washes with 0.1 M phosphate buffer. Subsequently, the samples were fixed in 1% osmium tetroxide in 0.1 M phosphate buffer at room temperature in the dark for 2 h. Post-fixation, the root tissues were dehydrated in a series of ethanol gradients (30, 50, 70, 80, 90, 95, and 100%) for 15 min each. Following dehydration, the roots were dissected with a sterile surgical blade, dried overnight in a desiccator, coated with a gold–palladium sputter, and then observed and imaged using SEM with the internal structure facing upwards.

A. orientale plants were grown with or without endophytic fungal strain RT1 (identified as Pseudothielavia terricola) for 21 days as described above. Total RNA was extracted from the whole plant (~ 0.5 g) using the Omega Plant RNA Kit (Omega Bio-tek, Inc.) according to the manufacturer’s instructions. Samples were analyzed by 1% agarose gel electrophoresis to evaluate RNA integrity, and RNA purity and concentration were measured using a NanoDrop Spectrophotometer. Library construction and transcriptome sequencing were completed by Gene Denovo Biotechnology Co., Ltd. (Guangzhou, China). Differentially expressed genes (DEGs) were analyzed using the DESeq2 software with the screening criteria set as |log2foldchange| ≥ 1 and p < 0.05. GO (Gene Ontology; http://geneontology.org) and KEGG (Kyoto Encyclopedia of Genes and Genome; http://www.genome.jp/kegg) enrichment analysis were used for further analysis of the DEGs. The Blast2GO (version 2.5.0) was used to obtain the GO annotations of unigenes. Sequences in KEGG databases were searched using Blastx.

Real-time quantitative PCR (RT-qPCR) was used to evaluate the expression levels of five DEGs involved in plant growth promotion and triterpenoid accumulation. Expression of the UBC9 gene was employed as the reference. The primer pairs used for PCR amplification of target genes are listed in Supplementary Table S2. The relative gene expressions were calculated using the 2^-ΔΔCt method. RT-qPCR analyses were performed using three biological replicates with technical duplicates.

The contents of triterpenoids, including alisol B, alisol B-23 acetate, and alisol C-23 acetate, were quantified via UPLC-MS. To determine triterpenoid content, 0.5 g of plant dried powder from the treatment and control groups was dissolved in 25 mL of acetonitrile and subjected to ultrasonic extraction for 30 min. Prior to UPLC-MS analysis, the solution was filtered using a 0.22 μm microporous membrane filter. A calibration curve was established using standards purchased from Chengdu Must Biotechnology Co., Ltd., which were processed under identical conditions to the samples. Three replicates were prepared for each group.

Total genomic DNA of the fungus strain RT1 (Pseudothielavia terricola) was extracted using QIAGEN Genomic-tip 20/G kit and analyzed by 0.5% agarose gel electrophoresis to evaluate the integrity of DNA. The purity and concentration of DNA were measured with the NanoDrop 2,100. Whole genome sequencing was carried out by Biomarker technologies Co., Ltd. (Beijing, China) on a PacBio Sequel II platform with one SMART cell, which generated long-read data.

Results were shown as mean ± SD based on three independent tests. ANOVA (analysis of variance) was used to compare differences between experimental groups, followed by the Student Newman–Keuls test (SNK). Statistical significance was determined by p < 0.05.

The endophytic fungal diversity of four different parts of A. orientale, including rhizomes (RH), flowers (FL), roots (RT), and leaves (LF), was determined by high-throughput sequencing. A total of 489,043 raw reads were obtained. Following assembly and chimeric filtering, 484,139 effective tags were retained, resulting in a high data validity rate of 94% (Table 1). The average sequence length was 333 bp. The ASV rarefaction curves are shown in Figure 2A. The saturation observed in the four sample groups confirmed that the sequencing data depth could fully reflect the richness and diversity present in the current samples.

A total of 629 ASVs were identified across four parts of the A. orientale, with 177, 71, 218, and 163 ASVs found in the FL, LF, RH and RT, respectively (Figure 2B). Among these, 21 ASVs were shared among all four groups, while the FL, LF, RH and RT groups had 25, 33, 66, and 100 unique ASVs, respectively. Alpha-diversity analysis of different parts of A. orientale indicated that fungal communities richness and diversity was highest in A. orientale rhizome samples, followed by flowers and roots, with the lowest diversity found in the leaves (Table 2). However, beta-diversity analysis showed that groups RH and FL were separate from the RT and LF samples, indicating a high similarity of the endophytic fungal communities between the groups of RH and FL. The endophytic fungal communities in the roots and leaves exhibit significant differences from the former two groups (Figure 2C).

Based on the annotation of ASVs and the analysis of relative abundance, a total of 8 phyla, 24 classes, 48 orders, 86 families, and 111 genera of endophytic fungi were identified in the four different parts of A. orientale. As expected, Ascomycota and Basidiomycota were the dominant phyla in all four groups, with relative abundances ranging from 55.18 to 81.26% and from 7.97 to 41.53%, respectively (Figure 2D). For screening key differential genera, the top 10 genera in terms of abundance in the four groups were selected (Figure 2E). The dominant genera in the FL group were Cladosporium (47.67%), Malassezia (9.16%) and Moesziomyces (5.38%), with Cladosporium being the most abundant genus. Plectosphaerella (54.12%), Rhizopus (20.27%) and Chaetomium (10.27%) were the dominant genera in leaves. The dominant genera in the RH group were Penicillium (20.58%), Cladosporium (12.93%) and Plectosphaerella (6.91%). The dominant genera in the RT group were Cladosporium (26.99%), Aspergillus (17.97%), Alternaria (12.44%) and Moesziomyces (10.20%). These results indicated that the fungal community composition in different parts of the A. orientale varied greatly at the genus level.

A total of 19 endophytic fungi were isolated from the four different parts of A. orientale by culturing sterile sections on PDA as detailed in the Methods section. These included 6, 5, 5 and 3 strains from the rhizomes (RH1-6), roots (RT1-5), leaves (LF1-5), and flowers (FL1-3), respectively. All strains were initially identified according to their morphological characterizations (Figure 3) combined with molecular sequence analyses of ITS/LSU genes. Moreover, in conjunction with the relevant fungal genera, the genes were further analyzed for species classification (Supplementary Table S3). The closest identified matches are listed in Table 3. The nucleotide sequences of 19 endophytic fungi exhibited a similarity of over 98% to the most closely related sequences in the nucleotide database. The phylogenetic tree of endophytic fungi can be found in Supplementary Figure S1. All 19 endophytic fungi isolates belonged to the phylum Ascomycota and were distributed across 3 classes, 5 orders, 8 families, and 9 genera. The most common isolated fungi were Penicillium sp. (6 isolates, all corresponding to P. oxalicum), followed by Nigrospora sp. (3 isolates, two corresponding to N. sphaerica, and one N. oryzae), and Fusarium sp. (3 isolates, all F. proliferatum).

Fungal isolates were initially screened qualitatively, and then quantitatively for traits associated with plant growth promotion and/or enhancement of secondary metabolite production, as detailed in the Methods section. The results revealed seven IAA-producing strains, five strains capable of promoting phosphate solubilization, five strains positive for siderophore production, and six strains exhibiting antioxidant (catalase) activity (Figure 4; Table 4). Fungal isolates FL1 (Nigrospora sphaerica) and RT1 (Psedothielavia terricola) exhibited the highest IAA production at 6.40 mg/L and 6.61 mg/L, respectively. The strain LF2 (Penicillium oxalicum) demonstrated the highest siderophore producing and phosphate-solubilizing abilities, with SU activity at 61.74% and phosphorolytic activity at 9.97 mmol/L. The fungus LF4 (Aspergillus sp.) displayed catalase (antioxidative) activity at 64.31 μmol/mL (Table 4). Based on these results, the latter four strains (FL1, RT1, LF2, and LF4) were selected for co-cultivation with seedlings of A. orientale to observe their effects on plant growth and triterpenoid accumulation.

The effects of isolates Nigrospora sphaerica (FL1), Psedothielavia terricola (RT1), Penicillium oxalicum (LF2), and Aspergillus sp. (LF4) on growth and/or triterpenoid accumulation in A. orientale were examined in co-cultivation experiments as detailed in the Methods section. After 3 weeks of co-cultivation, plants inoculated with RT1 demonstrated increased height and longer roots compared to control (CK) treatments; similar findings were observed in plants that were inoculated with FL1. However, inoculation treatments with LF2 and LF4 inhibited the growth of A. orientale as compared to the control (Figures 5A,B). Based on these results, isolate RT1 was used for further investigation.

Further in-depth assessment of the effects of P. terricola on A. orientale revealed enhanced growth and increased root architecture effects. Compared to the control plants, those inoculated with RT1 showed 103 and 121% increases in root length and plant height, respectively. Moreover, a 3–3.5 fold increase in fresh weight and dry weight was observed, coupled to a significant (p < 0.01) increase in chlorophyll content (Figures 5C,D). However, no significant difference was found in the number of leaves and the number of lateral roots between RT1-treated and control plants. Mycelial colonization of plant roots was monitored by scanning electron microscopy (SEM). The results confirmed proliferation of RT1 hyphae within A. orientale roots (Figure 5E).

Alisol B-23 acetate, alisol C-23 acetate and alisol B are three main triterpenoid compounds found in A. orientale and are essential for its pharmacological efficacy. In plants co-cultured with RT1, the contents of alisol B-23 acetate, alisol C-23 acetate and alisol B were 5.50, 5.20, and 4.42 times higher than those of control treatments, respectively (Figure 5F).

To elucidate the effects of RT1 on A. orientale global gene expression, transcriptome sequencing was performed to examine changes in gene expression. A total of ten samples were prepared, consisting of five samples (plants) inoculated with RT1 and five control (CK) samples. A total of 514,552,178 clean reads were obtained, with a total nucleotide count of 7.74 Gb, and a GC content of 53.42%. Following de novo assembly, 79,874 unigenes were generated, with a total length of 98.18 Mb, an average length of 1,288 bp, and an N50 length of 2,171 bp. Among the total set of unigenes, 35,325 unigenes (44.23%) ranged from 200 to 500 bp, 16,885 (21.14%) ranged from 500 to 1,000 bp, and 27,664 (34.64%) exceeded 1,000 bp in length (Supplementary Figure S2).

Principal component analyses showed a clear distinction in global gene expression between RT1- treated and control plants. Replicates, especially those from RT1-treated plants, demonstrated tight clustering (Figure 6A). The analysis identified 10,809 up-regulated differentially expressed genes (DEGs) and 2,521 down-regulated DEGs, as shown in the volcano plots in Figure 6B.

GO and KEGG enrichment analyses were performed to analyze the DEGs, as detailed in the Methods section. The top 20 enriched GO terms following RT1 treatment including “organic cyclic compound metabolic process,” “cellular aromatic compound metabolic process,” and “heterocycle metabolic process,” were all involved in metabolite programming (Figure 6C). Similarly, KEGG enrichment analysis revealed pathways associated with growth promotion during fungal co-culture, including “biosynthesis of secondary metabolites,” “indole alkaloid biosynthesis,” and “terpenoid backbone biosynthesis” (Figure 6D).

KEGG pathway annotation revealed that 3,268 DEGs were enriched in 140 relevant pathways in the RT1 group compared to the control group (Table 5). These included “terpenoid backbone biosynthesis,” “indole alkaloid biosynthesis,” “sesquiterpenoid and triterpenoid biosynthesis,” “phenylalanine, tyrosine and tryptophan biosynthesis,” “photosynthesis,” and “oxidative phosphorylation.” Within the “terpenoid backbone biosynthesis” and “sesquiterpenoid and triterpenoid biosynthesis” pathways, several key genes were significantly upregulated in the RT1 group, including 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), mevalonate diphosphate decarboxylase (MVD), farnesyl diphosphate synthase (FPPS), 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR), 1-deoxy-D-xylulose-5-phosphate synthase (DXS), farnesyl-diphosphate farnesyltransferase (FDFT1), and squalene monooxygenase (SQLE). With respect to the “indole alkaloid biosynthesis” and “phenylalanine, tyrosine and tryptophan biosynthesis” pathways, the RT1-treated group showed significant upregulation of the gene expression levels of aromatic-L-amino-acid/L-tryptophan decarboxylase (TDC2), indole-3-glycerol phosphate synthase (TRPC), phosphoribosylanthranilate isomerase (TRP1), and tryptophan synthase (TRP). In the “oxidative phosphorylation” pathway, the expression levels of cytochrome c oxidase subunit 1 (COX1), cytochrome c oxidase subunit 10 (COX10) cytochrome c oxidase assembly protein subunit 11 (COX11), cytochrome c oxidase subunit 5b (COX5B), NADH dehydrogenase (ubiquinone) Fe-S protein 1 (NDUFS1), and cytochrome c (CYC) genes were significantly upregulated in RT1-treated group. Furthermore, in the “photosynthesis” pathway, genes related to photosynthesis (e.g., photosystem I subunit IV (PSAE), light-harvesting complex II chlorophyll a/b binding protein 1 (LHCB1), and light-harvesting complex II chlorophyll a/b binding protein 6 (LHCB6) were upregulated in the RT1 group).

To validate the transcriptomics data, RT-qPCR was conducted on select genes. Five DEGs (HMGR, DXR, TDC2, MVD, and FPPS) associated with growth promotion and triterpenoid accumulation were selected for expression verification, showing high correlation with the RNA-seq data (Figure 7).

To investigate the molecular mechanisms underlying the endophytic interaction between P. terricola (RT1) and A. orientale, the genome of the fungus was analyzed. The general genome features of P. terricola (RT1) are shown in Table 6 and Supplementary Figure S3. The P. terricola (RT1) genome was found to comprise 34.5 Mb with a GC content of 57.19%, and could be assembled into 25 contigs (N50 size: 4.98 Mb), with contig 1 being the longest (Figure 8A). Genome assembly quality was supported by the BUSCO analysis, showing 95.86% completeness. A summary of the key characteristics is provided in Table 6, including 10,054 protein-coding genes with an average length of 1,736 bp, 403 tRNAs, 85 rRNAs (5S, 18S, 5S, and 28S), and 38 other non-coding RNAs.

The 10,054 predicted genes were blasted against GO, Nr, Swissprot, TrEMBL, KEGG, KOG, and Pfam databases, with 6,623 predicted genes receiving a GO assignment (Figure 8B). The three categories of annotations (cellular component, molecular function, and biological process) contained 17,667, 7,590, and 14,920 GO terms. A total of 3,656 genes were classified within the metabolic process category. The KEGG pathway analysis revealed a total of 3,163 genes that were annotated within four metabolic pathways, specifically genetic information processing (846), cellular processes (254), environmental information processing (30), and metabolism (1185) (Figure 8C). In the process of metabolism, a total of 114 genes were primarily involved in amino acid biosynthesis.

Additionally, a set of genes encoding for enzymes involved in terpenoid backbone biosynthesis was identified. The KEGG analysis indicated that genes involved in triterpenoids biosynthesis were annotated within the “terpenoid backbone biosynthesis” (ko00900) and “sesquiterpenoid and triterpenoid biosynthesis” (ko00909) pathways. These pathways included the enzymes acetyl-CoA C-acetyltransferase (ACAT), hydroxymethylglutaryl-CoA synthase (HMGCS), hydroxymethylglutaryl-CoA reductase (NADPH) (HMGCR), mevalonate kinase (MVK), diphosphomevalonate decarboxylase (MVD), squalene epoxidase (SQLE), and farnesyl-diphosphate farnesyltransferase (FDFT1) (Supplementary Figures S4, S5). A summary of potential key genes involved in triterpenoid synthesis was displayed (Figure 9). Ko00400 is the major biosynthesis pathway for tryptophan, which is precursor of indole-3-acetic acid (IAA). Moreover, genes involved in tryptophan biosynthesis, including trpA, trpD and trp1, were detected in the P. terricola genome (Table 7).