The est2 gene, was identified from the genome sequence of Pseudomonas sp. A6-5, obtained from Antarctic soil on King George Island (62°11′17.5”S, 58°55′23.4”W). The identity of the Pseudomonas strain was verified through 16S rRNA gene sequencing and phylogenetic analysis. The est2 gene was selected for further study due to its high similarity to esterase genes in the alpha-beta hydrolase superfamily and its potential cold-adaptive properties.

The est2 gene sequence was analyzed using ORF Finder (NCBI)¹ to identify the open reading frame (ORF). Signal peptides were predicted with SignalP-6.0² (Teufel et al., 2022), and the protein structure was modeled using AlphaFold2 (Jumper et al., 2021). Homologous protein sequences were retrieved from the NCBI database using BLAST for subsequent alignment.³ Conserved domains, including the GXSXG motif and catalytic triad, were identified through sequence alignment with Clustal X (Jeanmougin et al., 1998) and visualized using ESPript 3.0.⁴ Reference sequences from GenBank and UniProt were used for phylogenetic analysis. The phylogenetic analysis included 2–3 representative sequences per esterase family, selected from the classification frameworks established in (Wang et al., 2020) and (Kovacic et al., 2018), and the phylogenetic tree was constructed using the maximum likelihood method in IQ-TREE (Trifinopoulos et al., 2016) with 1,000 bootstrap replicates and visualized using iTOL v6⁵ (Letunic and Bork, 2024). The GenBank accession number of the est2 gene was OR552631.

The est2 gene was cloned into the pMAL-c2x vector containing an MBP-tag The MBP tag was used because it enhances the solubility of the recombinant protein (~40 kDa) and facilitates subsequent purification. Primers were designed based on the est2 sequence and the vector’s MCS, incorporating EcoRI and HindIII restriction sites: 5′- CAACCTCGGGA TCGAGGGAAGGATG ACCCCTTCTCCCGACCGCT-3′ and 5′- ACGACGGCCAGTGCCAAGCTT TTACTGACCCG AAGCGGGCGAT-3′ (restriction sites underlined). The est2 gene was amplified by PCR using Pseudomonas sp. A6-5 genomic DNA as the template. The target DNA fragment was excised and purified using a Gel Extraction Kit (Omega bio-tek, Guangzhou, China). The pMAL-c2x vector was linearized by double digestion with EcoRI and HindIII restriction enzymes (Thermo Fisher Scientific, Waltham, MA, USA) and the linearized vector was purified.

The purified est2 fragment and linearized vector were ligated using the NovoRec^® Plus PCR One-Step Direct Cloning Kit (Novoprotein, Shanghai, China) at 50°C for 15 min. The recombinant plasmid was transformed into Escherichia coli BL21 (DE3) for protein expression.

The recombinant E. coli BL21 (DE3) strain was inoculated at 1% (v/v) into 100 mL of LB medium supplemented with ampicillin (100 μg/mL) and cultured at 37°C with agitation at 180 rpm until the OD₆₀₀ reached the range of 0.6–0.8. The culture was chilled on ice, and protein expression was induced by the addition of isopropyl-β-d-thiogalactopyranoside (IPTG) to a final concentration of 0.1 mM, followed by incubation at 17°C with shaking at 120 rpm for 48 h.

After induction, the cells were harvested by centrifugation at 12,000 rpm for 3 min at 4°C. The cell pellet was suspended in CB buffer (20 mM Tris–HCl, 0.2 M NaCl, 1 mM EDTA, pH 7.5) and lysed by sonication. The lysate was centrifuged at 12,000 rpm for 20 min at 4°C, and the supernatant containing the crude enzyme was collected.

The MBP-tagged fusion protein was purified by amylose resin affinity chromatography (New England Biolabs, Beijing, China). The resin was pre-equilibrated with CB buffer, and the crude enzyme extract was filtered through a 0.22 μm membrane before loading onto the column. Non-specifically bound proteins were removed by washing with 10 column volumes of CB buffer, and the target protein was eluted using EB buffer (10 mM maltose, 20 mM Tris–HCl, 0.2 M NaCl, 1 mM EDTA, pH 7.5). Fractions exhibiting high purity, as determined by SDS-PAGE, were pooled and dialyzed overnight at 4°C against 50 mM Tris–HCl (pH 8.0).

To remove the MBP tag, the purified fusion protein was incubated with Factor Xa protease (2% w/w) at 23°C for 6 h in 50 mM Tris–HCl (pH 8.0). The reaction mixture was subsequently subjected to a second round of amylose resin chromatography to separate the cleaved MBP tag and residual protease. The final purified protein was analyzed by SDS-PAGE to confirm purity and integrity. N-termini sequencing was performed by a commercial company (Biotech-Pack, China).

The protein concentration of the purified, recombinant Est2 enzyme was determined using the Bradford assay with bovine serum albumin as the standard (Kielkopf et al., 2020). Esterase activity was measured spectrophotometrically as the release of p-nitrophenol (pNP) from the hydrolysis of pNP esters (Liu X. et al., 2021). Initial experiments utilized pNP esters of varying acyl chain lengths, including acetate (C2), butyrate (C4), hexanoate (C6), octanoate (C8), decanoate (C10), dodecanoate (C12), and palmitate (C16), prepared in isopropanol. Subsequent experiments utilized the C8 substrate (i.e., standard reaction conditions) to characterize Est2 activity, because it yielded maximal enzymatic activity. The standard reaction mixture contained 20 μL of 10 mM p-nitrophenyl octanoate (C8), 20 μL of enzyme solution (25.2 μg protein), and 0.96 mL of Tris–HCl buffer (50 mM, pH 8.0) to achieve a final volume of 1 mL. The reaction was carried out in a water bath at 30°C for 10 min and terminated by adding 100 μL of 10% SDS. The release of p-nitrophenol was quantified by measuring the absorbance at 405 nm. A blank control was prepared by replacing the enzyme solution with an equal volume of buffer. All experiments were performed in triplicate, with the highest activity under optimal conditions was defined as 100% for relative activity calculations.

Temperature and pH optima were determined using the standard assay conditions (C8; 0.2 mM). For temperature studies, reactions were assessed at intervals of 10°C within a range of 0 to 90°C. To evaluate the optimal pH, Britton-Robinson buffer was used to adjust the pH of the reaction system at 30°C, covering a pH range of 4.0 to 11.0 with intervals of 1.0 or 0.5. To investigate the thermal stability of the enzyme, Est2 esterase was incubated at 20°C, 30°C and 40°C for 120 min, and the residual activity was measured every 15 min.

Hydrolysis of triacylglycerol substrates was determined using tributyrin, tricaprylin, and trilaurin as substrates following a titration assay as described (Li et al., 2020). Triacylglycerol emulsions were prepared at a final concentration of 10 mM in 2.5 mM Tris–HCl (pH 7.0), 100 mM NaCl, and 1% (w/v) gum arabic, with pH adjusted to 7.00 using 5 mM NaOH. The reaction mixture consisted of 20 μL triacylglycerol emulsion and 0.5 mL enzyme solution, while a blank control replaced the enzyme with an equal volume of buffer. After incubation at 30°C for 30 min, reactions were terminated by adding 5 mL ethanol. The released fatty acids were quantified by measuring the volume of 5 mM NaOH required to neutralize the reaction mixture. Relative activity was determined by assigning 100% to the substrate eliciting the highest NaOH consumption, with activities toward other substrates normalized proportionally. The data are the mean values of three independent experiments performed in triplicate. Error bars show the standard deviation (SD).

The effects of metal ions (Li⁺, K⁺, Mg²⁺, Ca²⁺, Mn²⁺, Fe²⁺, Co²⁺, Ni²⁺, Cu²⁺, Zn²⁺, and Ba²⁺) on the activity of Est2 were investigated using the standard reaction mixture containing either 1 mM and 10 mM each of the respective ions.

The stability of Est2 in the presence of organic solvents, including methanol, formaldehyde solution, ethanol, acetonitrile, acetone, isopropyl alcohol, and dimethyl sulfoxide (DMSO), was evaluated at solvent concentrations of 20 and 40% (v/v). The enzymatic activity was measured under standardized conditions.

The structures of both EstC and Est2 were predicted using AlphaFold2 (Jumper et al., 2021). Hydrophobic surfaces were generated and displayed using the Molecular Lipophilicity Potential tool in ChimeraX (Pettersen et al., 2021). The percentages of proline, asparagine, lysine, and methionine were determined using the ExPASy database (Gasteiger et al., 2005). Polar and non-polar accessible surface areas were calculated with the online software VADAR (Willard et al., 2003). Pocket volume measurements were performed by analyzing the predicted structures with CASTpFold (Ye et al., 2024). Amino acid residues and catalytic loops were visualized using PyMOL⁶.

The est2 gene was comprised of an open reading frame (ORF) of 1,017 base pairs. The gene encoded a polypeptide of 338 amino acids with no signal peptide. The later suggests a probable intracellular localization. The predicted three-dimensional structure of Est2 exhibited a canonical α/β hydrolase fold, aligning with its functional classification as an esterase (Figure 1).

Protein BLAST analysis identified the top 100 amino acid sequences with the highest similarity as uncharacterized α/β hydrolases annotated from Pseudomonas genomes. Among these, seven sequences displaying varying degrees of identity to Est2 were selected for detailed multiple sequence alignment. This alignment revealed conserved structural motifs characteristic of esterases, including the GXSXG motif and the catalytic triad formed by Ser¹⁴¹, Asp²⁷⁵, and His³⁰³ (Figure 2). These critical catalytic residues are highly conserved across esterase families.

Phylogenetic analysis demonstrated that Est2 clustered to a distinct clade, separate from previously characterized esterase families, establishing it as the founding member of a novel esterase family, designated as family XXII (Figure 3). This classification is supported by high bootstrap values, confirming the evolutionary divergence of Est2 from other esterase families.

The est2 gene was successfully expressed in Escherichia coli BL21 (DE3) as an MBP-tagged fusion protein, which improved solubility and facilitated protein purification. Following induction with IPTG, the recombinant protein was purified using amylose resin affinity chromatography, yielding a protein of high purity as confirmed by SDS-PAGE (Figure 4A). The MBP tag was subsequently removed by Factor Xa protease treatment, and the final purified Est2 protein exhibited a molecular weight of approximately 37 kDa, consistent with theoretical predictions (Figure 4B). SDS-PAGE analysis demonstrated the successful purification of Est2, with no significant contamination from host proteins or residual MBP tag.

Est2 exhibited the highest catalytic activity toward p-nitrophenyl octanoate (C8), with significantly lower activity observed for longer-chain substrates such as p-nitrophenyl dodecanoate (C12) and p-nitrophenyl palmitate (C16) (Figure 5A). This substrate preference confirms Est2 as an esterase rather than a lipase, as it preferentially hydrolyzes medium-chain esters.

The optimal temperature for Est2 activity was determined to be 30°C, with significant activity observed between 10°C and 30°C. Remarkably, Est2 retained approximately 20% of its activity at 0°C, highlighting its cold-adapted nature (Figure 5B). The enzyme exhibited maximal activity over a pH range of 7–9, while retaining measurable activity across a broad pH range pH 6–10 (Figure 5C).

Treatment of Est2 at various temperatures for relatively prolonged periods also revealed its cold-adaptive nature. Approximately 40% of Est2 activity was retained following 2-h incubation at 20°C. In contrast, enzymatic activity decreased rapidly when incubated at 30°C and 40°C, with significant inactivation observed within just 15 min (Figure 5D). These results indicated that Est2 is more stable at lower temperatures.

Est2 exhibited detectable hydrolytic activity toward triacylglycerol substrates, with maximal activity observed for tricaprylin, followed by tributyrin, while no activity was detected for trilaurin (Figure 6A). The chemical structures of these substrates (Figure 6B) highlight the chain-length dependence of Est2’s activity, demonstrating its preference for medium-chain triglycerides (C4-C8) over the long-chain trilaurin (C12). This substrate selectivity profile aligns with the canonical functional definition of esterases, which typically hydrolyze acyl chains shorter than C10, as further supported by the complete absence of activity toward the C12 substrate in Figure 6A. The combined evidence from catalytic activity and structural analysis unequivocally supports classifying Est2 as a cold-adapted esterase rather than a lipase.

The influence of metal ions on the enzymatic activity of Est2 was investigated (Figure 7A) by comparing potential inhibitory effects of alkali metals versus transitions metals. Alkali metals, such as K⁺ and Li⁺, had little effect on Est2 activity at concentrations of 1 and 10 mM; while, the alkali earth metals, such as Mg²⁺, Ca²⁺, and Ba²⁺, were only weakly effective. These results suggest ionic interactions are not likely a major driving force governing enzyme stability. In contrast, significant inhibition was observed with transition metals (Mn²⁺, Co²⁺, Ni²⁺, Cu²⁺, and Zn²⁺). Notably, pronounced inhibitory effects were seen using 1 mM concentrations of Cu²⁺, Zn²⁺, and Co²⁺, suggesting these metal ions may act as potential inhibitors of Est2.

The ability of Est2 to function in the presence of various polar solvents was evaluated (Figure 7B). The enzyme demonstrated the highest tolerance to aprotic solvent DMSO, retaining approximately 45% of its activity at 20% (v/v) concentration. Overall, however, Est2 appeared sensitive to inhibition by other polar solvents; with only modest activity remaining at 20 and 40% (v/v) methanol.

The comparative structural analysis revealed distinct cold-adaptation features in Est2 when compared to the thermophilic EstC. Est2 displayed an altered amino acid composition characterized by increased proportions of destabilizing residues such as asparagine, lysine and methionine, along with reduced proline content (Table 1). The catalytic loop containing the essential histidine residue was notably longer in Est2, comprising 18 amino acids compared to just 13 in EstC (Figure 8B). Structural measurements showed Est2 possesses a substantially larger catalytic cavity measuring 308.5 ų, more than double the volume of EstC’s 124.9 ų cavity, and features additional substrate-access tunnels (Figure 8C).

A particularly significant finding was the differential distribution of glycine residues between the two enzymes. While the two enzymes contained a similar number of glycine residues, Est2 uniquely had five glycine residues positioned near its catalytic pocket, a structural feature absent in EstC that likely enhances flexibility at low temperatures. Surface analysis further demonstrated Est2’s greater molecular accessibility, with its total solvent-accessible surface area (15,461.6 Ų) being significantly larger than EstC’s (12,850.9 Ų). Notably, Est2’s non-polar accessible surface area (9,404.5 Ų) also exceeded that of EstC (7,634.9 Ų) (Table 1), consistent with its higher content of exposed hydrophobic residues (Figure 8A). These structural modifications, including the strategic glycine positioning, expanded hydrophobic surfaces and optimized cavity architecture, collectively represent specialized evolutionary adaptations that enable Est2 to maintain catalytic efficiency in cold environments.