<?xml version="1.0" encoding="utf-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Microbiol.</journal-id>
<journal-title>Frontiers in Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">1664-302X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fmicb.2025.1641525</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Development and application of a RAA-CRISPR/Cas12a-based detection system for the pseudorabies virus <italic>gE</italic> gene</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Song</surname>
<given-names>Chunlian</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn0002"><sup>&#x2020;</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/2951959/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Wei</surname>
<given-names>Jiajia</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="author-notes" rid="fn0002"><sup>&#x2020;</sup></xref>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<uri xlink:href="https://loop.frontiersin.org/people/3189428/overview"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Du</surname>
<given-names>Song</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Sun</surname>
<given-names>Yalong</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Guan</surname>
<given-names>Chen</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Jianqin</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wei</surname>
<given-names>Qianfei</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Xue</given-names>
</name>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Shen</surname>
<given-names>Hong</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/2718538/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Shu</surname>
<given-names>Xianghua</given-names>
</name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>&#x002A;</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/2605649/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
</contrib>
</contrib-group>
<aff id="aff1"><sup>1</sup><institution>College of Veterinary Medicine of Yunnan Agricultural University</institution>, <addr-line>Kunming</addr-line>, <country>China</country></aff>
<aff id="aff2"><sup>2</sup><institution>College of Animal Science and Technology of Yunnan Agricultural University</institution>, <addr-line>Kunming</addr-line>, <country>China</country></aff>
<author-notes>
<fn fn-type="edited-by" id="fn0003">
<p>Edited by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1988492/overview">Duraipandiyan Veeramuthu</ext-link>, Loyola College, India</p>
</fn>
<fn fn-type="edited-by" id="fn0004">
<p>Reviewed by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2043029/overview">Fei Tu</ext-link>, Chinese Academy of Agriculture Sciences, China</p>
<p><ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2753625/overview">Theivanayagam Maharajan</ext-link>, Rajagiri College of Social Sciences, India</p>
<p><ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/3156909/overview">Huihua Zheng</ext-link>, Zhejiang Agriculture and Forestry University, China</p>
</fn>
<corresp id="c001">&#x002A;Correspondence: Xianghua Shu, <email>ynndsxh@edu.com</email></corresp>
<fn fn-type="equal" id="fn0002"><p><sup>&#x2020;</sup>These authors have contributed equally to this work and share first authorship</p></fn>
</author-notes>
<pub-date pub-type="epub">
<day>16</day>
<month>09</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1641525</elocation-id>
<history>
<date date-type="received">
<day>05</day>
<month>06</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>22</day>
<month>08</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#x00A9; 2025 Song, Wei, Du, Sun, Guan, Li, Wei, Zhang, Shen and Shu.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Song, Wei, Du, Sun, Guan, Li, Wei, Zhang, Shen and Shu</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>The development of field-deployable diagnostic tools for pseudorabies virus (PRV) surveillance remains challenging due to the technical limitations of conventional detection methods, particularly their reliance on sophisticated equipment and inadequate sensitivity for <italic>gE</italic> gene identification in resource-limited settings. To address these critical needs, we established a novel nucleic acid detection platform that synergistically integrates recombinase-aided amplification (RAA) with CRISPR-Cas12a technology. Through systematic optimization of four CRISPR RNAs (crRNAs) and corresponding primer sets targeting conserved regions of the PRV <italic>gE</italic> gene, validated by fluorescence quantification and electrophoretic analysis, we developed a rapid detection system capable of achieving 10 copies/&#x03BC;L sensitivity within 45&#x202F;min under isothermal conditions (37 &#x00B0;C). Clinical validation demonstrated complete diagnostic concordance with standard PCR methods, successfully identifying all 11 positive specimens from 30 clinical samples. The platform&#x2019;s technical innovation lies in its sequential reaction activation mechanism that enables single-tube operation, effectively eliminating aerosol contamination risks while maintaining reaction efficiency. Detection outcomes can be interpreted through dual modalities&#x2014;real-time fluorescence monitoring for quantitative analysis and lateral flow strips for visual readouts significantly enhancing field applicability. Notably, this system exhibits a 1,000-fold sensitivity improvement compared to conventional PCR, establishing itself as a robust solution for point-of-care PRV monitoring with particular utility in veterinary settings lacking advanced laboratory infrastructure.</p>
</abstract>
<kwd-group>
<kwd>pseudorabies virus</kwd>
<kwd>CRISPR-Cas12a</kwd>
<kwd>recombinant-aided amplification</kwd>
<kwd>veterinary diagnostics</kwd>
<kwd>point-of-care diagnostics</kwd>
<kwd>molecular diagnostics</kwd>
</kwd-group>
<contract-num rid="cn1">202304BI090011</contract-num>
<contract-sponsor id="cn1">Yunnan Province Rural Revitalization Science and Technology Special Project &#x201C;Yunnan Province Weixin County Circular Agriculture Science and Technology Task Force&#x201D;</contract-sponsor>
<counts>
<fig-count count="7"/>
<table-count count="1"/>
<equation-count count="1"/>
<ref-count count="21"/>
<page-count count="11"/>
<word-count count="6025"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Microbiotechnology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="sec1">
<label>1</label>
<title>Introduction</title>
<p>Pseudorabies virus (PRV) is an alphaherpesvirus closely related to herpes simplex virus type 1 (HSV-1) (<xref ref-type="bibr" rid="ref5">Fischer et al., 2000</xref>). First documented in bovine cases in the United States in 1813 (<xref ref-type="bibr" rid="ref8">Hanson, 1954</xref>), its etiological agent was conclusively identified by Hungarian scientist Alad&#x00E1;r Aujeszky in 1902 through experimental inoculations in rabbits, which developed acute neurological symptoms and died within 72&#x202F;h (<xref ref-type="bibr" rid="ref11">Kohler and Kohler, 2003</xref>). The virus exhibits broad host tropism, infecting swine, ruminants, carnivores, rodents, and avian species, with ruminants developing rabies-like neurological symptoms that initially led to its designation as &#x201C;pseudorabies&#x201D; (<xref ref-type="bibr" rid="ref2">Andries et al., 1978</xref>). Classified by the World Organisation for Animal Health (WOAH) as a notifiable Class B multispecies disease, PRV poses significant economic threats to global livestock production due to its high transmissibility across domestic and wild animal populations.</p>
<p>In China, the intensification of swine production systems coupled with increased international livestock trade since the 21st has exacerbated PRV epidemiological complexity. Suboptimal biosecurity measures and inconsistent vaccination protocols have contributed to recurrent outbreaks, resulting in substantial economic losses within the livestock sector. While molecular detection platforms&#x2014;including conventional PCR, real-time PCR (RT-PCR), nanoparticle-assisted PCR (nanoPCR), recombinase-aided amplification (RAA), and loop-mediated isothermal amplification (LAMP) (<xref ref-type="bibr" rid="ref20">Zanella et al., 2012</xref>; <xref ref-type="bibr" rid="ref15">Ma et al., 2013</xref>; <xref ref-type="bibr" rid="ref18">Tu et al., 2022</xref>; <xref ref-type="bibr" rid="ref21">Zhang et al., 2010</xref>), have improved diagnostic capabilities, their dependence on specialized equipment and controlled laboratory environments severely limits deployment in resource-limited settings, particularly in rural or remote areas. RAA technology can also perform visual detection at 37 &#x00B0;C&#x2013;42 &#x00B0;C. Therefore, it is suitable for promotion and use in rural or remote areas.</p>
<p>The CRISPR was first identified in <italic>Escherichia coli</italic> in 1987 (<xref ref-type="bibr" rid="ref16">Makarova et al., 2015</xref>), representing a unique adaptive immune mechanism evolved by archaea and bacteria during their evolutionary history (<xref ref-type="bibr" rid="ref17">Paul and Montoya, 2020</xref>). In 2016, the CRISPR-Cas system was first employed for the purpose of nucleic acid detection in molecular diagnostics. A research team (<xref ref-type="bibr" rid="ref4">East-Seletsky et al., 2016</xref>) discovered that the Cas13 protein exhibits nonspecific collateral RNA cleavage activity. In the same year, another study (<xref ref-type="bibr" rid="ref1">Abudayyeh et al., 2016</xref>) demonstrated that this nonspecific cleavage property of Cas13 could be harnessed for nucleic acid detection. Subsequent work (<xref ref-type="bibr" rid="ref7">Gootenberg et al., 2017</xref>) further developed a CRISPR/Cas13-based diagnostic technology. The CRISPR-Cas revolution has since expanded into molecular diagnostics, displacing PCR in numerous applications. Cas12a, a Class 2 Type V effector protein in the CRISPR system, has been shown to recognise thymine-rich target DNA sequences guided by CRISPR RNA (crRNA) by binding to the protospacer adjacent motif (PAM) TTTN (<xref ref-type="bibr" rid="ref17">Paul and Montoya, 2020</xref>). Upon cleavage of the target double-stranded DNA at specific sites, its trans-cleavage activity is activated, thereby enabling efficient degradation of single-stranded DNA within the system (<xref ref-type="bibr" rid="ref9">He et al., 2024</xref>).</p>
<p>RAA is an isothermal rapid amplification method that enables efficient target DNA replication at room temperature via the synergistic action of recombinase, single-strand binding protein, and DNA polymerase (<xref ref-type="bibr" rid="ref10">Juma et al., 2023</xref>). Compared with traditional PCR/RT-PCR requiring repeated thermal cycling (resulting in prolonged amplification) (<xref ref-type="bibr" rid="ref6">Gleerup et al., 2025</xref>), and LAMP isothermal amplification with limitations like complex primer design and strict 65 &#x00B0;C reaction requirements (<xref ref-type="bibr" rid="ref21">Zhang et al., 2010</xref>), RAA demonstrates significant advantages. Notably, although RPA shares similar principles and operates under isothermal conditions, it suffers from higher reagent costs and narrower optimal temperature ranges. When the Cas12a-crRNA complex binds target DNA by the Cas12a-crRNA ribonucleoprotein complex, the collateral cleavage activity of Cas12a is activated, leading to nonspecific degradation of reporter DNA molecules in the reaction system. Detection results can be visualized through multiple readout modalities, including fluorescence detection under UV/blue light excitation and colorimetric interpretation via lateral flow strips (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p>
<fig position="float" id="fig1">
<label>Figure 1</label>
<caption>
<p>Schematic of RAA-CRISPR/Cas12a detection platform for PRV <italic>gE</italic> gene.</p>
</caption>
<graphic xlink:href="fmicb-16-1641525-g001.tif" mimetype="image" mime-subtype="tiff">
<alt-text content-type="machine-generated">Flowchart illustrating a biochemical process involving CRISPR/Cas12a. It begins with a virus leading to DNA extraction in a test tube at 37&#x00B0;C. Reactions progress through steps, involving CRISPR/Cas12a and reporters, resulting in visual outputs on test strips labeled NC and PC. Symbols for various components like DNA, enzymes, and labels such as PRV, PRV DNA, RAA, FAM, BHQ, and Biotin are included. Two eye diagrams depict detection or analysis areas.</alt-text>
</graphic>
</fig>
<p>In this study, we developed a nucleic acid detection method targeting the <italic>gE</italic> gene by integrating RAA with the CRISPR/Cas12a platform. This approach demonstrates simplicity, rapidity, high sensitivity, and specificity, providing a novel solution for early-stage and field-deployable detection of pseudorabies virus.</p>
</sec>
<sec sec-type="materials|methods" id="sec2">
<label>2</label>
<title>Materials and methods</title>
<sec id="sec3">
<label>2.1</label>
<title>Viruses and sample</title>
<p>PRV, PEDV and TGEV were donated by the Key Laboratory of Tropical Subtropical Animal Viral Diseases (KLATSAVD). PRRSV, PCV2, CSFV and PPV positive samples (confirmed positive by laboratory testing and sequencing) were retained by our laboratory.</p>
<p>Clinical blood samples (<italic>n</italic>&#x202F;=&#x202F;30) were collected from pigs with suspected PRV infections across 3 farms in Yunnan Province, China, during 2023&#x2013;2024.</p>
</sec>
<sec id="sec4">
<label>2.2</label>
<title>Reagent and primer design and synthesis</title>
<p>The RAA Basic Nucleic Acid Amplification Kit enables rapid isothermal amplification of target DNA at 37 &#x00B0;C, while its companion RAA Basic Nucleic Acid Amplification Kit (Colloidal Gold) facilitates visual detection of amplified products&#x2014;both kits were procured from AmpFuture Biotechnology Co., Ltd. And the CRISPR-Cas12a-specific nucleic acid detection strips (BaoYing TongHui Biotechnology Co., Ltd., Beijing, China) were employed for visual interpretation of nucleic acid detection results following CRISPR-Cas12a system activation. The <italic>gE</italic> sequence of porcine pseudorabies strain (PRV-XD-F3) was compared with the PRV <italic>gE</italic> sequences of GenBank numbered OR161244.1, OR161238.1, OR161226.1, OR161208.1, ON261936.1, and OR161232.1 in NCBI, and the PRV <italic>gE</italic> sequences were designed by using primer5.0 software. The primers and crRNAs were synthesized by General Biological Co.</p>
</sec>
<sec id="sec5">
<label>2.3</label>
<title>Target gene purification</title>
<p>The PRV <italic>gE</italic> gene PCR products were purified using the Universal DNA Purification Kit (Tiangen Biotech) following manufacturer&#x2019;s instructions. Briefly, target bands were excised from 1% agarose gels, dissolved in B2 buffer, and purified through column adsorption. After washing steps, DNA was eluted in 15&#x2013;40&#x202F;&#x03BC;L buffer and stored at &#x2212;20 &#x00B0;C for downstream applications.</p>
</sec>
<sec id="sec6">
<label>2.4</label>
<title>Target gene cloning and transformation</title>
<p>The DNA product obtained was ligated into the pMD18-T vector. The ligation product was transformed into DH5a receptor cells, added to 890&#x202F;mL of SOC medium and incubated for 60&#x202F;min at 37 &#x00B0;C with shaking and cultured on L-agar medium containing X-Gal, IPTG and Amp. After colony growth, white colonies were selected with a small pipette tip and added to LB medium and incubated overnight on a shaker.</p>
</sec>
<sec id="sec7">
<label>2.5</label>
<title>Positive clone validation</title>
<p>The bacterial solution was cultured overnight, DNA was extracted, and the PCR amplification system and procedure (target fragment amplification, recovery, and purification) was used. The PCR products were detected by 1% agarose gel electrophoresis, and the size of the bands was observed to determine whether the transformation was successful or not.</p>
</sec>
<sec id="sec8">
<label>2.6</label>
<title>Recombinant plasmid preparation</title>
<p>Recombinant plasmids were extracted using the Plasmid Extraction Kit following the manufacturer&#x2019;s protocol. Briefly, bacterial cultures were pelleted, lysed with Buffers P1, P2, and P3, and centrifuged to remove debris. The supernatant was purified through an adsorption column, washed, and eluted in 50&#x2013;100&#x202F;&#x03BC;L elution buffer. Plasmid concentration was determined spectrophotometrically, and samples were sent for sequencing (Sangon Biotech (Shanghai) Co., Ltd.).</p>
</sec>
<sec id="sec9">
<label>2.7</label>
<title>Calculation of recombinant plasmid concentration</title>
<p>The concentration of validated recombinant plasmid was determined using a nucleic acid concentration meter. The average molecular weight of each base is 660. The pMD18-T-PRV-<italic>gE</italic> positive plasmid contains 4,500 bases, and the molecular weight of a single plasmid is 660&#x202F;&#x00D7;&#x202F;(pMD18-T vector length&#x202F;+&#x202F;insertion gene length), and the final copy number is calculated according to the following formula (<xref ref-type="bibr" rid="ref12">Kong, 2021</xref>).</p>
<disp-formula id="E1">
<mml:math id="M1">
<mml:mtable columnalign="left" displaystyle="true">
<mml:mtr>
<mml:mtd>
<mml:mi>DNA</mml:mi>
<mml:mspace width="0.25em"/>
<mml:mtext>copy number</mml:mtext>
<mml:mo>/</mml:mo>
<mml:mi mathvariant="italic">&#x03BC;L</mml:mi>
</mml:mtd>
</mml:mtr>
<mml:mtr>
<mml:mtd>
<mml:mo>=</mml:mo>
<mml:mfrac>
<mml:mrow>
<mml:mo stretchy="true">[</mml:mo>
<mml:mn>6.02</mml:mn>
<mml:mo>&#x00D7;</mml:mo>
<mml:mn>1</mml:mn>
<mml:mo>,</mml:mo>
<mml:mn>023</mml:mn>
<mml:mo>&#x00D7;</mml:mo>
<mml:mtext>concentration</mml:mtext>
<mml:mspace width="0.25em"/>
<mml:mo stretchy="true">(</mml:mo>
<mml:mi>ng</mml:mi>
<mml:mo>/</mml:mo>
<mml:mi mathvariant="italic">&#x03BC;L</mml:mi>
<mml:mo stretchy="true">)</mml:mo>
<mml:mo>&#x00D7;</mml:mo>
<mml:msup>
<mml:mn>10</mml:mn>
<mml:mrow>
<mml:mo>&#x2212;</mml:mo>
<mml:mn>9</mml:mn>
</mml:mrow>
</mml:msup>
<mml:mo stretchy="true">]</mml:mo>
</mml:mrow>
<mml:mrow>
<mml:mo stretchy="true">[</mml:mo>
<mml:mo stretchy="true">(</mml:mo>
<mml:mi>pMD</mml:mi>
<mml:mn>18</mml:mn>
<mml:mo>&#x2010;</mml:mo>
<mml:mi mathvariant="normal">T</mml:mi>
<mml:mspace width="0.25em"/>
<mml:mtext>Vector length</mml:mtext>
<mml:mo>+</mml:mo>
<mml:mtext>insertion gene length</mml:mtext>
<mml:mo stretchy="true">)</mml:mo>
<mml:mo>&#x00D7;</mml:mo>
<mml:mn>660</mml:mn>
<mml:mo stretchy="true">]</mml:mo>
</mml:mrow>
</mml:mfrac>
</mml:mtd>
</mml:mtr>
</mml:mtable>
</mml:math>
</disp-formula>
</sec>
<sec id="sec10">
<label>2.8</label>
<title>crRNA and primer design and preparation</title>
<p>Referring to the selection requirements of Cas12a protein PAM and protospacer sequences, ssDNA sequences were analyzed and crRNAs were designed using the CRISPR-DT online website,<xref ref-type="fn" rid="fn0001"><sup>1</sup></xref> i.e., TTTN sequences were identified within the highly conserved <italic>gE</italic> target region of PRV, and 23&#x202F;nt was selected as the 23&#x202F;bp target sequence.</p>
<p>Based on the determination and screening of crRNA recognition sequences, RAA primers were designed in their upstream and downstream regions by applying Primer5.0 software, respectively. Primer lengths were optimized for maximal amplification efficiency under the selected RAA conditions while maintaining target specificity.</p>
<p>The complete primer sequences and characterization are shown in <xref ref-type="table" rid="tab1">Table 1</xref>.</p>
<table-wrap position="float" id="tab1">
<label>Table 1</label>
<caption>
<p>Primer and probe sequences.</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="middle">Name</th>
<th align="center" valign="middle">Sequence (5&#x2032;&#x2013;3&#x2032;)</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" valign="middle">crRNA1</td>
<td align="left" valign="middle">UAAUUUCUACUAAGUGUAGAUCCGCCACGCUGGACUGGUACU</td>
</tr>
<tr>
<td align="left" valign="middle">crRNA2</td>
<td align="left" valign="middle">UAAUUUCUACUAAGUGUAGAUUGCUGGCGCUGGGCUCCUUCGUG</td>
</tr>
<tr>
<td align="left" valign="middle">crRNA3</td>
<td align="left" valign="middle">UAAUUUCUACUAAGUGUAGAUUCCGGAUCGCGGAACCAGACGUC</td>
</tr>
<tr>
<td align="left" valign="middle">crRNA4</td>
<td align="left" valign="middle">UAAUUUCUACUAAGUGUAGAUAGCGGGGCGGGACAUCAACAGGC</td>
</tr>
<tr>
<td align="left" valign="middle">RAA-F1</td>
<td align="left" valign="middle">CGTGTTCTTTGTGGCGGTGGGC</td>
</tr>
<tr>
<td align="left" valign="middle">RAA-R1</td>
<td align="left" valign="middle">CGCGGGTGGTAGATGCAGGGCT</td>
</tr>
<tr>
<td align="left" valign="middle">RAA-F2</td>
<td align="left" valign="middle">GTCGCCGCACCTGAGCGTCCTGCGGGC</td>
</tr>
<tr>
<td align="left" valign="middle">RAA-R3</td>
<td align="left" valign="middle">TACGAGCCCTGCATCTACCACCCGCGCG</td>
</tr>
<tr>
<td align="left" valign="middle">RAA-F3</td>
<td align="left" valign="middle">CCGAGTACGTCACGGTCATCAAGGAG</td>
</tr>
<tr>
<td align="left" valign="middle">RAA-R3</td>
<td align="left" valign="middle">CCGGGAGCACAGCACGCAGAGCCAGA</td>
</tr>
<tr>
<td align="left" valign="middle">RAA-F4</td>
<td align="left" valign="middle">GCCGAGTACGTCACGGTCATCAA</td>
</tr>
<tr>
<td align="left" valign="middle">RAA-R4</td>
<td align="left" valign="middle">GGGAGCACAGCACGCAGAGCCAG</td>
</tr>
<tr>
<td align="left" valign="middle">F-Q</td>
<td align="left" valign="middle">6-FAM-TTATT-BHQ I</td>
</tr>
<tr>
<td align="left" valign="middle">F-B</td>
<td align="left" valign="middle">6-FAM-TTTTTTTATTTTTTT-Biotin</td>
</tr>
<tr>
<td align="left" valign="middle">PCR-R</td>
<td align="left" valign="middle">CATCTGGCTCTGCGTGCTGT</td>
</tr>
<tr>
<td align="left" valign="middle">PCR-F</td>
<td align="left" valign="middle">TTGGGTCCATTCGTCACTTCC</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="sec11">
<label>2.9</label>
<title>CRISPR/Cas12a cutting system</title>
<p>Enzyme-free water was used as a negative control, and 1&#x202F;&#x03BC;L Cas12a Naclease (1&#x202F;&#x03BC;M), 2&#x202F;&#x03BC;L pMD18-T-PRV-<italic>gE</italic>, 1&#x202F;&#x03BC;L crRNA (1&#x202F;&#x03BC;M), 1&#x202F;&#x03BC;L&#x202F;F-Q (10&#x202F;&#x03BC;M), and 2&#x202F;&#x03BC;L of 10&#x202F;&#x00D7;&#x202F;Cas12 reaction Buffer were added to a fluorescence octuple tube, and replenished to 20&#x202F;&#x03BC;L with enzyme-free water. Next, the quantitative PCR was performed in a PCR instrument at 37 &#x00B0;C for 25&#x202F;min, and the fluorescence signals were observed after passing through a UV lamp and a blue light.</p>
</sec>
<sec id="sec12">
<label>2.10</label>
<title>RAA amplification system</title>
<p>The reaction temperature was set at 37 &#x00B0;C to meet the requirements for RAA amplification and to maintain optimal Cas12a cleavage activity. This was verified by a preliminary experiment.</p>
<p>The amplification system was constructed according to the RAA isothermal amplification kit: 25&#x202F;&#x03BC;L of bufferA, 2.5&#x202F;&#x03BC;L of bufferB (MgOAC), 2&#x202F;&#x03BC;L of RAA upstream primer (10&#x202F;&#x03BC;M), 2&#x202F;&#x03BC;L of RAA downstream primer (10&#x202F;&#x03BC;M), 16.5&#x202F;&#x03BC;L of enzyme-free water, and 2&#x202F;&#x03BC;L of target DNA, for a total of 50&#x202F;&#x03BC;L of system. The reaction system was incubated on a metal bath at 37 &#x00B0;C for 20&#x202F;min to complete the amplification of target DNA. After the reaction, an equal volume of nucleic acid extraction reagent (saturated phenol: chloroform: isoamyl alcohol&#x202F;=&#x202F;25:24:1) was added to the RAA amplification product; after mixing, the reaction was centrifuged at 12,000&#x202F;&#x00D7;&#x202F;g for 1&#x202F;min; 7&#x202F;&#x03BC;L of the supernatant was sucked up and detected by 1.5% agar gel electrophoresis to screen for the RAA primers.</p>
</sec>
<sec id="sec13">
<label>2.11</label>
<title>PCR assay</title>
<p>PCR primers were established in our laboratory, the primer sequence: 5&#x2032;-CATCTGGCTCTCTGCGTGCTGT-3&#x2032;, 5&#x2032;-TTGGGTCCATTCGTCACTTCC-3&#x2032;, PCR amplification was performed using the pMD18-T-PRV-<italic>gE</italic> positive plasmid as a template with 10-fold isocratic dilution, PCR amplification system (25&#x202F;&#x03BC;L): 2&#x202F;&#x00D7;&#x202F;Taq PCR Master Mix 12.5&#x202F;&#x03BC;L, 1&#x202F;&#x03BC;L of each specific primer upstream and downstream, 1&#x202F;&#x03BC;L of each reverse transcription product, 9.5&#x202F;&#x03BC;L of sterilized double-distilled water, 1&#x202F;&#x03BC;L of each reverse transcription product. PCR amplification system (25&#x202F;&#x03BC;L): 2&#x202F;&#x00D7;&#x202F;Taq PCR Master Mix 12.5&#x202F;&#x03BC;L, 1&#x202F;&#x03BC;L of each specific primer upstream and downstream, 1&#x202F;&#x03BC;L of each reverse transcription product, and 9.5&#x202F;&#x03BC;L of sterilized double-distilled water to make up the reaction system. The reaction system was supplemented with 9.5&#x202F;&#x03BC;L of sterilized double-distilled water. The reaction system was placed on a fluorescence quantitative PCR instrument and pre-denatured at 98 &#x00B0;C for 10&#x202F;s, followed by 55 &#x00B0;C for 30&#x202F;s, 72 &#x00B0;C for 2&#x202F;min, and then cycling the reaction for 35 times, and then detected by 1.5% agar gel electrophoresis.</p>
</sec>
<sec id="sec14">
<label>2.12</label>
<title>Statistical analysis</title>
<p>Data were analyzed using GraphPad Prism 9.0. Fluorescence intensity differences were assessed via one-way ANOVA with Tukey&#x2019;s post-hoc test. <italic>p&#x202F;&#x003C;</italic> 0.05 was considered significant.</p>
</sec>
</sec>
<sec sec-type="results" id="sec15">
<label>3</label>
<title>Results</title>
<sec id="sec16">
<label>3.1</label>
<title>Standard positive plasmid construction</title>
<p>Using PRV nucleic acid as a template, the constructed recombinant plasmid standard pMD18-T-PRV-<italic>gE</italic> were identified by PCR, 1,868&#x202F;bp had a specific target band appearing, which was consistent with the expected fragment size, and the negative did not show a band (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). The sequencing results were compared with the sequence of <italic>gE</italic> of PRV-XD-F3 strain without base mutation or deletion, which proved the successful construction of pMD18-T-PRV-<italic>gE</italic> recombinant positive plasmid (<xref ref-type="fig" rid="fig2">Figure 2B-C</xref>). The standard positive plasmid was calculated as 4&#x202F;&#x00D7;&#x202F;10<sup>10</sup> copies/&#x03BC;L according to the formula.</p>
<fig position="float" id="fig2">
<label>Figure 2</label>
<caption>
<p>Construction and verification of recombinant pMD18-T-PRV-<italic>gE</italic> plasmid. <bold>(A)</bold> Agarose gel electrophoresis of PCR-amplified PRV <italic>gE</italic> gene fragment. Lane M: DNA marker (sizes indicated in bp). Lane 1: 1,868 bp target amplicon. Lane 2: Negative control. <bold>(B)</bold> Schematic map of constructed pMD18-T-PRV-<italic>gE</italic> plasmid, showing key restriction sites and inserted PRV <italic>gE</italic> fragment orientation. <bold>(C)</bold> Sanger sequencing chromatogram of the cloned insert, demonstrating 100% sequence identity with the PRV <italic>gE</italic> target region.</p>
</caption>
<graphic xlink:href="fmicb-16-1641525-g002.tif" mimetype="image" mime-subtype="tiff">
<alt-text content-type="machine-generated">Gel electrophoresis results (image A) show DNA bands alongside a molecular marker ladder; a 1,868 base pair band is highlighted. Plasmid map (image B) details restriction sites and genetic elements of pMD18-T-PRVgE. Sequence chromatogram (image C) displays base calls, showing peaks for nucleotides A, T, C, and G.</alt-text>
</graphic>
</fig>
</sec>
<sec id="sec17">
<label>3.2</label>
<title>Screening of crRNA and primers</title>
<p>Based on the conserved region of the PRV <italic>gE</italic> gene, multiple sequence alignment was performed using Snap Gene software. Four crRNAs (crRNA1-4) targeting distinct PAM sites were designed via the CRISPR-DT online platform (see text footnote 1). To evaluate the trans-cleavage activity of crRNA-guided Cas12a, CRISPR/Cas12a detection systems containing individual crRNAs were constructed. Under excitation with ultraviolet (365&#x202F;nm) and blue light (470&#x202F;nm), all four crRNAs triggered cleavage of the fluorescent reporter molecule (FAM-TTATT-BHQ1), generating visible fluorescence signals (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). Quantitative analysis of fluorescence intensity from blue light-transmitted images was performed Quantitative analysis of fluorescence signals demonstrated significantly higher trans-cleavage activity for crRNA1 and crRNA2 compared to crRNA3 and crRNA4 (<italic>p</italic>&#x202F;&#x003C;&#x202F;0.05), with no statistically significant difference observed between crRNA1 and crRNA2 (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). For the PAM targets of crRNA1 and crRNA2, two pairs of RAA primers (RAA-F1/R1, F2/R2, F3/R3, F4/R4) were designed. All primer pairs specifically amplified target fragments. Notably, the RAA-F3/R3 primers paired with crRNA2 exhibited significantly higher amplification efficiency compared to other primers, with no detectable non-specific bands (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). Based on these findings, crRNA2 and its corresponding RAA-F3/R3 primer pair were selected for subsequent experiments.</p>
<fig position="float" id="fig3">
<label>Figure 3</label>
<caption>
<p>Optimization of RAA-CRISPR/Cas12a detection system for PRV <italic>gE</italic> gene. <bold>(A)</bold> Fluorescence visualization under UV (365&#x202F;nm, top) and blue light (470&#x202F;nm, bottom) illumination showing distinct signal intensities for different crRNA designs. Positive reactions exhibit bright green fluorescence (FAM reporter cleavage), while negative controls remain dark. <bold>(B)</bold> Quantitative analysis of fluorescence intensity (a.u.) for four crRNA candidates (crRNA1-4). <sup>&#x002A;&#x002A;&#x002A;&#x002A;</sup><italic>p</italic> &#x003C;&#x202F;0.0001 vs. negative control (NC) by Student&#x2019;s <italic>t</italic>-test. Error bars represent SD (<italic>n</italic>&#x202F;=&#x202F;3). <bold>(C)</bold> Agarose gel (1.5%) electrophoresis of RAA amplification products. Lane M: DNA ladder (sizes indicated). Lanes 1&#x2013;5: Amplified products from different primer sets (expected size ~200&#x202F;bp). Arrow indicates target band. <bold>(D)</bold> Fluorescence intensity comparison of different Cas12a:crRNA molar ratios (1:1 to 3:1). Optimal activity observed at 2:1 ratio (<sup>&#x002A;&#x002A;&#x002A;&#x002A;</sup><italic>p</italic> &#x003C;&#x202F;0.0001). <bold>(E)</bold> Tube array test showing fluorescence intensity gradient with varying crRNA (50&#x2013;200&#x202F;nM) and Cas12a (100&#x2013;400&#x202F;nM) concentrations. Brightest signals observed at 200&#x202F;nM crRNA&#x202F;+&#x202F;400&#x202F;nM Cas12a.</p>
</caption>
<graphic xlink:href="fmicb-16-1641525-g003.tif" mimetype="image" mime-subtype="tiff">
<alt-text content-type="machine-generated">Composite image showing various scientific analyses. Panel A: Tubes under natural, UV, and blue light displaying fluorescent markers across crRNA1-4 and controls. Panel B: Bar graph of fluorescence density for crRNA samples, showing significant differences. Panel C: Gel electrophoresis bands indicate different nucleotide sizes. Panel D: Bar graph of fluorescence density for Cas12a samples with significant variations. Panel E: Tubes with fluorescent markers under varying crRNA and Cas12a concentrations, revealing intensity differences.</alt-text>
</graphic>
</fig>
<p>In order to optimise the CRISPR/Cas12a fluorescence assay, a screening procedure was performed for the concentration of Cas12a nuclease and crRNA. The experimental results demonstrated that the CRISPR/Cas12a detection system exhibited optimal target recognition and the strongest fluorescence signal when using 1.0&#x202F;&#x03BC;L of Cas12a protein (1&#x202F;&#x03BC;M) and 2.0&#x202F;&#x03BC;L of crRNA (1&#x202F;&#x03BC;M), corresponding to a crRNA:Cas12a molar ratio of 2:1 (<xref ref-type="fig" rid="fig3">Figure 3D-E</xref>).</p>
</sec>
<sec id="sec18">
<label>3.3</label>
<title>RAA-CRISPR/Cas12a assay system establishment</title>
<p>The RAA-CRISPR/Cas12a detection system was established by optimizing the reaction components based on the manufacturer&#x2019;s protocol.</p>
<p>Fluorescence signals were observed using probe F-Q under UV light (365&#x202F;nm) and blue light (470&#x202F;nm). Positive samples exhibited strong fluorescence, whereas negative controls showed no fluorescence (<xref ref-type="fig" rid="fig4">Figures 4A</xref>,<xref ref-type="fig" rid="fig4">B</xref>). A statistically significant difference was observed between the test system and negative control groups (<sup>&#x002A;<italic>&#x002A;&#x002A;&#x002A;</italic></sup><italic>p</italic>&#x202F;&#x003C;&#x202F;0.0001). For probe F-B, positive samples displayed distinct bands at both the quality control (C) and detection (T) lines, while negative controls (nuclease-free water) showed only the C line (<xref ref-type="fig" rid="fig4">Figure 4C</xref>). These results aligned with the expected outcomes.</p>
<fig position="float" id="fig4">
<label>Figure 4</label>
<caption>
<p>Performance evaluation of the RAA-CRISPR/Cas12a detection system. <bold>(A)</bold> Three-view microplate imaging: NW (natural light), UV (ultraviolet light at 365&#x202F;nm), and BD (bioluminescence detection). PC (positive control) wells exhibit bright yellow fluorescence in BD view (arrow), while NC (negative control) wells remain dark. <bold>(B)</bold> Quantitative fluorescence density analysis (RFU) showing significantly higher signal in PC versus NC (<sup>&#x002A;&#x002A;&#x002A;&#x002A;</sup><italic>p</italic> &#x003C;&#x202F;0.0001). Error bars represent SD (<italic>n</italic>&#x202F;=&#x202F;3 technical replicates). <bold>(C)</bold> Lateral flow strip results: Three PRV-positive samples show both control (C, upper) and test (T, lower) lines (red arrows), while ddH<sub>2</sub>O negative controls display only C lines. Strip images were captured at 10&#x202F;min post-immersion.</p>
</caption>
<graphic xlink:href="fmicb-16-1641525-g004.tif" mimetype="image" mime-subtype="tiff">
<alt-text content-type="machine-generated">Panel A shows images of tubes under normal, UV, and blue light, labeled NW, UV, and BD. The PC tube shows strong fluorescence. Panel B is a bar graph comparing fluorescence density, with PC showing significantly higher values than NC. Panel C displays lateral flow test strips for PRV and ddH2O, indicating test and control lines.</alt-text>
</graphic>
</fig>
</sec>
<sec id="sec19">
<label>3.4</label>
<title>Specificity evaluation</title>
<p>To evaluate the specificity of the method, seven common porcine viral nucleic acids (PRV, PEDV, TGEV, PRRSV, PCV2, CSFV, and PPV) along with nuclease-free water were tested as negative controls. Fluorescence analysis revealed significant signals exclusively in the PRV-positive group (<xref ref-type="fig" rid="fig5">Figures 5A</xref>,<xref ref-type="fig" rid="fig5">B</xref>). Lateral flow strip results showed that only PRV samples generated both control (C) and test (T) lines, while other viral nucleic acids (PEDV, TGEV, PRRSV, PCV2, CSFV, PPV) and the negative control displayed only the C line (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). These findings demonstrate that the RAA-CRISPR/Cas12a system exhibits high specificity without cross-reactivity with the genomic DNA of the other six pathogens tested.</p>
<fig position="float" id="fig5">
<label>Figure 5</label>
<caption>
<p>Specificity evaluation of the RAA-CRISPR/Cas12a detection system for PRV. <bold>(A)</bold> Three-view detection results showing specific recognition of PRV. From left to right: NW (natural light), UV (365&#x202F;nm excitation), and BD (blue light detection with 470&#x202F;nm filter) images. Only PRV samples exhibit bright yellow fluorescence in BD view (arrow), while other porcine viruses (PPV, PRRSV, PCV2, CSFV, PEDV, TGEV) and negative control (NC, ddH<sub>2</sub>O) remain non-fluorescent. <bold>(B)</bold> Quantitative fluorescence intensity analysis (RFU) demonstrating exclusive detection of PRV (<sup>&#x002A;&#x002A;&#x002A;&#x002A;</sup><italic>p</italic>&#x202F;&#x003C;&#x202F;0.0001). Error bars represent SD of triplicate experiments. <bold>(C)</bold> Lateral flow assay results validating specificity: Only PRV-infected samples develop both control (C) and test (T) lines (red arrows), while other pathogens and negative controls show single C lines. Strips were photographed at 10&#x202F;min after sample application.</p>
</caption>
<graphic xlink:href="fmicb-16-1641525-g005.tif" mimetype="image" mime-subtype="tiff">
<alt-text content-type="machine-generated">Image showing three panels labeled A, B, and C. Panel A displays test tubes under normal, UV, and blue-light conditions with labels PRV, PPV, CSFV, PCV2, PRRSV, TGEV, PDEV, and NC. One tube fluoresces under UV. Panel B is a bar graph indicating fluorescence density (RFU) showing a significant increase for PRV compared to others. Panel C displays test strips with test and control lines, showing positive results for PRV.</alt-text>
</graphic>
</fig>
</sec>
<sec id="sec20">
<label>3.5</label>
<title>Sensitivity evaluation</title>
<p>To evaluate the sensitivity of the RAA-CRISPR/Cas12a system for PRV detection, a 10-fold serially diluted standard plasmid (1&#x202F;&#x00D7;&#x202F;10<sup>6</sup> to 1&#x202F;&#x00D7;&#x202F;10<sup>0</sup> copies/&#x03BC;L) was analyzed alongside nuclease-free water as the negative control. Fluorescence signals under blue light illumination were clearly detectable at a template concentration of 10 copies/&#x03BC;L (<xref ref-type="fig" rid="fig6">Figure 6A</xref>). Statistical analysis confirmed significant differences in fluorescence intensity between 10 copies/&#x03BC;L samples and negative controls (<sup>&#x002A;&#x002A;&#x002A;&#x002A;</sup><italic>p</italic>&#x202F;&#x003C;&#x202F;0.001, <xref ref-type="fig" rid="fig6">Figure 6B</xref>), establishing the detection limit of the RAA-CRISPR/Cas12a fluorescence system at 10 copies/&#x03BC;L. Lateral flow strip analysis revealed distinct test line (T) bands for templates ranging from 10<sup>6</sup> to 10<sup>2</sup> copies/&#x03BC;L. Faint but discernible T-line bands were observed at 10 copies/&#x03BC;L, while no bands appeared in negative controls (<xref ref-type="fig" rid="fig6">Figure 6C</xref>). In contrast, conventional PCR exhibited a detection limit of 1&#x202F;&#x00D7;&#x202F;10<sup>4</sup> copies/&#x03BC;L, producing expected 354&#x202F;bp amplicons only above this threshold (<xref ref-type="fig" rid="fig6">Figure 6D</xref>). These data demonstrate that the RAA-CRISPR/Cas12a system achieves 1,000-fold greater sensitivity than conventional PCR, confirming its high analytical performance for PRV detection.</p>
<fig position="float" id="fig6">
<label>Figure 6</label>
<caption>
<p>Sensitivity analysis of the RAA-CRISPR/Cas12a detection system. <bold>(A)</bold> Three-mode detection of serial dilutions (10&#x2076;&#x2013;10<sup>0</sup> copies/&#x03BC;L) showing: NW (natural light), UV (365&#x202F;nm excitation), and BD (bioluminescence detection) views. Fluorescence intensity decreases proportionally with target concentration. CN: negative control. <bold>(B)</bold> Quantitative fluorescence intensity (RFU) demonstrating logarithmic correlation with target concentration. <sup>&#x002A;&#x002A;&#x002A;&#x002A;</sup><italic>p</italic> &#x003C;&#x202F;0.0001 for 10&#x00B9;&#x2013;10&#x2076; vs. NC; ns, not significant (10&#x2070; vs. NC) (<italic>n</italic>&#x202F;=&#x202F;3). <bold>(C)</bold> Lateral flow strips corresponding to concentrations in <bold>(A)</bold>. Visible test lines (T) appear down to 10&#x00B2; copies/&#x03BC;L (faint at 10&#x00B9;). C: control line; ddH&#x2082;O: negative control. <bold>(D)</bold> Agarose gel electrophoresis confirming specific 354 bp amplicons (arrow) across all detectable concentrations. M: DNA ladder (sizes in bp).</p>
</caption>
<graphic xlink:href="fmicb-16-1641525-g006.tif" mimetype="image" mime-subtype="tiff">
<alt-text content-type="machine-generated">Panel A shows images of tubes under normal, UV, and BD lighting, with varying brightness based on dilution factors. Panel B displays a bar graph of fluorescence density in RFU for different dilutions, with significant differences noted. Panel C shows test strips with a test line and control line across various dilutions. Panel D presents a gel electrophoresis result, indicating DNA bands corresponding to different bases, delineated by dilution levels.</alt-text>
</graphic>
</fig>
</sec>
<sec id="sec21">
<label>3.6</label>
<title>Clinical sample validation</title>
<p>A total of 30 blood samples were collected from clinical samples of a breeding farm in Yunnan Province, and nucleic acid extraction was performed, and RAA-CRISPR/Cas12a fluorescence, test strip method and PCR were compared with nucleic acid as the detection template. All three detection methods demonstrated identical positive rates of 36.7% (11/30) across the 30 clinical samples: conventional PCR (<xref ref-type="fig" rid="fig7">Figure 7A</xref>), RAA-CRISPR/Cas12a fluorescence assay (<xref ref-type="fig" rid="fig7">Figure 7B</xref>), and lateral flow strip analysis (<xref ref-type="fig" rid="fig7">Figure 7C</xref>). Comparative validation revealed 100% concordance between both CRISPR-based methods and PCR in sensitivity and specificity metrics. The results showed that the RAA-CRISPR/Cas12a fluorescence method, the test strip method, and all of the RAA-CRISPR/Cas12a fluorescence methods established in this study can be applied to the rapid clinical testing.</p>
<fig position="float" id="fig7">
<label>Figure 7</label>
<caption>
<p>Clinical validation of the RAA-CRISPR/Cas12a detection system using 30 field samples. <bold>(A)</bold> Agarose gel electrophoresis (1.5%) of conventional PCR products. Lane M: DNA ladder (sizes in bp indicated). PRV: positive control (354 bp amplicon, arrow). NC: negative control. Lanes 1&#x2013;30: clinical samples (11/30 positive). <bold>(B)</bold> Fluorescence detection under blue light (470 nm). PRV: strong positive control. NC: negative control. Samples 2, 3, 4, 7, 24, 26 show bright fluorescence (yellow arrows), corresponding to PCR positives. <bold>(C)</bold> Lateral flow strip results. PRV: positive control (C and T lines visible). NC: negative control (C line only). Clinical samples display 100% concordance with PCR.</p>
</caption>
<graphic xlink:href="fmicb-16-1641525-g007.tif" mimetype="image" mime-subtype="tiff">
<alt-text content-type="machine-generated">Three-part image showing molecular biology results. A: Gel electrophoresis image displaying DNA bands in lanes labeled M, PRV, NC, and numbers 1 to 30, with visible bands at specific lanes. B: Fluorescent tubes under UV light, labeled similarly, with certain tubes glowing, indicating positive results. C: Lateral flow strips labeled PRV, NC, and 1 to 30, showing colored lines for visual detection of analytes in select strips.</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="sec22">
<label>4</label>
<title>Discussion</title>
<p>The RAA-CRISPR/Cas12a system developed in this study combines the advantages of rapid isothermal amplification with the high specificity of CRISPR-based detection. Compared to conventional PCR and RT-PCR, which rely on thermal cycling and prolonged amplification times (<xref ref-type="bibr" rid="ref3">Ding et al., 2020</xref>). RAA offers simplified operation, faster results, and compatibility with isothermal conditions, eliminating the need for expensive thermocyclers. While LAMP is another isothermal alternative, its complex primer design, multi-step amplification process, and requirement for 65 &#x00B0;C incubation limit its practicality (<xref ref-type="bibr" rid="ref21">Zhang et al., 2010</xref>). RPA isothermal amplification works in a similar way to RAA, but is more costly and has a smaller optimal temperature range for RPA. The use of optimized Cas12a dosage and probe concentration resulted in reduced reagent costs compared to those of conventional CRISPR detection systems.</p>
<p>In this study, the isothermal amplification technology RAA was effectively combined with the CRISPR/Cas12a system, and multiple crRNA and RAA isothermal amplification primers were designed, in which RAA was amplified in order to obtain a large number of target genes to ensure the sensitivity of the assay. crRNA specifically binds to the target sequences in the RAA amplification product for the cleavage reaction, and this dual-specific base complementary binding makes the assay provide detection of high specificity, maximizing the advantages of each. We established two detection platforms: (1) a fluorescence-based RAA-CRISPR/Cas12a assay using reporter probes, and (2) a lateral flow assay employing biotin-labeled probes for visual interpretation. Both methods demonstrated excellent specificity and sensitivity, achieving a detection limit of 10 copies/&#x03BC;L. While the RAA-CRISPR/Cas12a system has been previously validated for PCV3, ASFV, and PPRSV detection, this study represents its first application for PRV identification.</p>
<p>The RAA-CRISPER/Cas12a fluorescence, test strip detection method established in this study, in the detection process RAA amplification reagents only need to be used to 1/5 of the original RAA amplification system to meet the efficiency of nucleic acid amplification, greatly reducing the cost of the reaction (<xref ref-type="bibr" rid="ref19">Yang et al., 2024</xref>). Specific sequence recognition, crRNA with about 23 short nucleotides was designed to combine with RAA specific amplification to make it double specificity, which greatly increased the accuracy of detection (<xref ref-type="bibr" rid="ref14">Liu et al., 2022</xref>). In order to solve the problem that RAA amplification system and CRISPR/Cas12a system cannot effectively coexist and RAA open cap is prone to aerosol contamination, the innovative CRISPR/Cas12a system was dropped on the inner cap of the PCR tube, while the RAA amplification system was placed on the bottom of the PCR tube, and the RAA amplification reaction was finished, and then the CRISPER/Cas12a shear system was centrifuged to the bottom of the tube. Cas12a protein starts to recognize the target gene and activate the cut reporter. The whole process is carried out in one reaction tube, which simplifies the steps and reduces the possibility of false positives, but there are still some improvements to be made in the future clinical application of this method, such as the CRISPR/Cas12a components tend to slip out of the cap when the cap of the PCR tube is closed (<xref ref-type="bibr" rid="ref13">Ling et al., 2021</xref>). In the future, we will try to develop an isolation system, using liquid paraffin and solid paraffin to realize the solid state at room temperature and liquid state at 37 &#x00B0;C, and isolate the CRISPR/Cas12a system in the inner lid of the PCR tube with the isolation system, and then centrifuge the CRISPR/Cas12a system and the RAA amplification product after RAA amplification at 37 &#x00B0;C, which will greatly facilitate the clinical detection. While our crRNA target site shows high conservation across sequenced PRV strains, future studies should empirically validate detection performance against geographically diverse isolates, particularly those with known <italic>gE</italic> polymorphisms. Although this study&#x2019;s clinical validation showed complete agreement with the PCR assay, subsequent validation using a larger sample size in a different geographic region would help further assess this method&#x2019;s robustness.</p>
</sec>
<sec sec-type="conclusions" id="sec23">
<label>5</label>
<title>Conclusion</title>
<p>This study successfully established on-site rapid nucleic acid detection methods for Pseudorabies virus, both applicable for clinical PRV detection. The RAA-CRISPR/Cas12a fluorescence assay and the RAA-CRISPR/Cas12a lateral flow strip assay demonstrated a detection limit of 10 copies/&#x03BC;L for PRV, exhibiting excellent sensitivity and specificity. These methods hold promising application prospects for rapid and accurate pathogen identification in field or clinical settings.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="sec24">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.</p>
</sec>
<sec sec-type="ethics-statement" id="sec25">
<title>Ethics statement</title>
<p>The animal studies were approved by the International Animal Care and Use Committee of Yunnan Agricultural University (permission code: 202405003; date of approval: January 1, 2022). The studies were conducted in accordance with the local legislation and institutional requirements. Written informed consent was obtained from the owners for the participation of their animals in this study.</p>
</sec>
<sec sec-type="author-contributions" id="sec26">
<title>Author contributions</title>
<p>CS: Conceptualization, Funding acquisition, Writing &#x2013; original draft, Writing &#x2013; review &#x0026; editing. JW: Formal analysis, Investigation, Validation, Writing &#x2013; original draft, Writing &#x2013; review &#x0026; editing. SD: Methodology, Validation, Data curation, Visualization, Writing &#x2013; original draft. YS: Software, Writing &#x2013; review &#x0026; editing, Methodology, Data curation, Validation. CG: Writing &#x2013; review &#x0026; editing, Investigation. JL: Validation, Writing &#x2013; review &#x0026; editing, Methodology, Software. QW: Data curation, Conceptualization, Investigation, Writing &#x2013; review &#x0026; editing. XZ: Methodology, Writing &#x2013; original draft, Investigation, Data curation. HS: Supervision, Validation, Writing &#x2013; review &#x0026; editing. XS: Writing &#x2013; review &#x0026; editing, Conceptualization, Funding acquisition, Methodology.</p>
</sec>
<sec sec-type="funding-information" id="sec27">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research and/or publication of this article. This study was supported by the Yunnan Province Rural Revitalization Science and Technology Special Project &#x201C;Yunnan Province Weixin County Circular Agriculture Science and Technology Task Force&#x201D; (Grant No. 202304BI090011) and the Yunnan Key Laboratory of Veterinary Etiological Biology, College of Veterinary Medicine, Yunnan Agricultural University, Kunming 650201, Yunnan Province, The People&#x2019;s Republic of China.</p>
</sec>
<ack>
<p>We sincerely thank the Yunnan Province Rural Revitalization Science and Technology Special Project &#x201C;Yunnan Province Weixin County Circular Agriculture Science and Technology Task Force&#x201D; for its financial support.</p>
</ack>
<sec sec-type="COI-statement" id="sec28">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="sec29">
<title>Generative AI statement</title>
<p>The authors declare that no Gen AI was used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec sec-type="disclaimer" id="sec30">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<fn-group>
<fn id="fn0001"><p><sup>1</sup><ext-link xlink:href="http://crispor.tefor.net/" ext-link-type="uri">http://crispor.tefor.net/</ext-link></p></fn>
</fn-group>
<ref-list>
<title>References</title>
<ref id="ref1"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Abudayyeh</surname><given-names>O. O.</given-names></name> <name><surname>Gootenberg</surname><given-names>J. S.</given-names></name> <name><surname>Konermann</surname><given-names>S.</given-names></name> <name><surname>Joung</surname><given-names>J.</given-names></name> <name><surname>Slaymaker</surname><given-names>I. M.</given-names></name> <name><surname>Cox</surname><given-names>D. B. T.</given-names></name> <etal/></person-group>. (<year>2016</year>). <article-title>C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector</article-title>. <source>Science</source> <volume>353</volume>:<fpage>aaf5573</fpage>. doi: <pub-id pub-id-type="doi">10.1126/science.aaf5573</pub-id>, PMID: <pub-id pub-id-type="pmid">27256883</pub-id></citation></ref>
<ref id="ref2"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Andries</surname><given-names>K.</given-names></name> <name><surname>Pensaert</surname><given-names>M. B.</given-names></name> <name><surname>Vandeputte</surname><given-names>J.</given-names></name></person-group> (<year>1978</year>). <article-title>Effect of experimental infection with pseudorabies (Aujeszky&#x2019;s disease) virus on pigs with maternal immunity from vaccinated sows</article-title>. <source>Am. J. Vet. Res.</source> <volume>39</volume>, <fpage>1282</fpage>&#x2013;<lpage>1285</lpage>.</citation></ref>
<ref id="ref3"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ding</surname><given-names>G.</given-names></name> <name><surname>Fu</surname><given-names>Y.</given-names></name> <name><surname>Li</surname><given-names>B.</given-names></name> <name><surname>Chen</surname><given-names>J.</given-names></name> <name><surname>Wang</surname><given-names>J.</given-names></name> <name><surname>Yin</surname><given-names>B.</given-names></name> <etal/></person-group>. (<year>2020</year>). <article-title>Development of a multiplex RT-PCR for the detection of major diarrhoeal viruses in pig herds in China</article-title>. <source>Transbound. Emerg. Dis.</source> <volume>67</volume>, <fpage>678</fpage>&#x2013;<lpage>685</lpage>. doi: <pub-id pub-id-type="doi">10.1111/tbed.13385</pub-id>, PMID: <pub-id pub-id-type="pmid">31597013</pub-id></citation></ref>
<ref id="ref4"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>East-Seletsky</surname><given-names>A.</given-names></name> <name><surname>O&#x2019;Connell</surname><given-names>M. R.</given-names></name> <name><surname>Knight</surname><given-names>S. C.</given-names></name> <name><surname>Burstein</surname><given-names>D.</given-names></name> <name><surname>Cate</surname><given-names>J. H.</given-names></name> <name><surname>Tjian</surname><given-names>R.</given-names></name> <etal/></person-group>. (<year>2016</year>). <article-title>Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection</article-title>. <source>Nature</source> <volume>538</volume>, <fpage>270</fpage>&#x2013;<lpage>273</lpage>. doi: <pub-id pub-id-type="doi">10.1038/nature19802</pub-id>, PMID: <pub-id pub-id-type="pmid">27669025</pub-id></citation></ref>
<ref id="ref5"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Fischer</surname><given-names>T.</given-names></name> <name><surname>Buttner</surname><given-names>M.</given-names></name> <name><surname>Rziha</surname><given-names>H. J.</given-names></name></person-group> (<year>2000</year>). <article-title>T helper 1-type cytokine transcription in peripheral blood mononuclear cells of pseudorabies virus (Suid herpesvirus 1)-primed swine indicates efficient immunization</article-title>. <source>Immunology</source> <volume>101</volume>, <fpage>378</fpage>&#x2013;<lpage>387</lpage>. doi: <pub-id pub-id-type="doi">10.1046/j.1365-2567.2000.00124.x</pub-id>, PMID: <pub-id pub-id-type="pmid">11106942</pub-id></citation></ref>
<ref id="ref6"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Gleerup</surname><given-names>D.</given-names></name> <name><surname>Trypsteen</surname><given-names>W.</given-names></name> <name><surname>Fraley</surname><given-names>S. I.</given-names></name> <name><surname>de Spiegelaere</surname><given-names>W.</given-names></name></person-group> (<year>2025</year>). <article-title>Digital PCR in virology: current applications and future perspectives</article-title>. <source>Mol. Diagn. Ther.</source> <volume>29</volume>, <fpage>43</fpage>&#x2013;<lpage>54</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s40291-024-00751-9</pub-id>, PMID: <pub-id pub-id-type="pmid">39487879</pub-id></citation></ref>
<ref id="ref7"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Gootenberg</surname><given-names>J. S.</given-names></name> <name><surname>Abudayyeh</surname><given-names>O. O.</given-names></name> <name><surname>Lee</surname><given-names>J. W.</given-names></name> <name><surname>Essletzbichler</surname><given-names>P.</given-names></name> <name><surname>Dy</surname><given-names>A. J.</given-names></name> <name><surname>Joung</surname><given-names>J.</given-names></name> <etal/></person-group>. (<year>2017</year>). <article-title>Nucleic acid detection with CRISPR-Cas13a/C2c2</article-title>. <source>Science</source> <volume>356</volume>, <fpage>438</fpage>&#x2013;<lpage>442</lpage>. doi: <pub-id pub-id-type="doi">10.1126/science.aam9321</pub-id>, PMID: <pub-id pub-id-type="pmid">28408723</pub-id></citation></ref>
<ref id="ref8"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hanson</surname><given-names>R. P.</given-names></name></person-group> (<year>1954</year>). <article-title>The history of pseudorabies in the United States</article-title>. <source>J. Am. Vet. Med. Assoc.</source> <volume>124</volume>, <fpage>259</fpage>&#x2013;<lpage>261</lpage>.</citation></ref>
<ref id="ref9"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>He</surname><given-names>J.</given-names></name> <name><surname>Hu</surname><given-names>X.</given-names></name> <name><surname>Weng</surname><given-names>X.</given-names></name> <name><surname>Wang</surname><given-names>H.</given-names></name> <name><surname>Yu</surname><given-names>J.</given-names></name> <name><surname>Jiang</surname><given-names>T.</given-names></name> <etal/></person-group>. (<year>2024</year>). <article-title>Efficient, specific and direct detection of double-stranded DNA targets using Cas12f1 nucleases and engineered guide RNAs</article-title>. <source>Biosens. Bioelectron.</source> <volume>260</volume>:<fpage>116428</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.bios.2024.116428</pub-id>, PMID: <pub-id pub-id-type="pmid">38805891</pub-id></citation></ref>
<ref id="ref10"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Juma</surname><given-names>K. M.</given-names></name> <name><surname>Inoue</surname><given-names>E.</given-names></name> <name><surname>Asada</surname><given-names>K.</given-names></name> <name><surname>Fukuda</surname><given-names>W.</given-names></name> <name><surname>Morimoto</surname><given-names>K.</given-names></name> <name><surname>Yamagata</surname><given-names>M.</given-names></name> <etal/></person-group>. (<year>2023</year>). <article-title>Recombinase polymerase amplification using novel thermostable strand-displacing DNA polymerases from <italic>Aeribacillus pallidus</italic> and <italic>Geobacillus zalihae</italic></article-title>. <source>J. Biosci. Bioeng.</source> <volume>135</volume>, <fpage>282</fpage>&#x2013;<lpage>290</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.jbiosc.2023.01.009</pub-id>, PMID: <pub-id pub-id-type="pmid">36806411</pub-id></citation></ref>
<ref id="ref11"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kohler</surname><given-names>M.</given-names></name> <name><surname>Kohler</surname><given-names>W.</given-names></name></person-group> (<year>2003</year>). <article-title>Zentralblatt f&#x00FC;r Bakteriologie&#x2014;100 years ago Alad&#x00E1;r aujeszky detects a &#x2018;new&#x2019; disease&#x2014;or: it was the cow and not the sow</article-title>. <source>Int. J. Med. Microbiol.</source> <volume>292</volume>, <fpage>423</fpage>&#x2013;<lpage>427</lpage>. doi: <pub-id pub-id-type="doi">10.1078/1438-4221-00233</pub-id></citation></ref>
<ref id="ref12"><citation citation-type="book"><person-group person-group-type="author"><name><surname>Kong</surname><given-names>K. K.</given-names></name></person-group> (<year>2021</year>). &#x201C;<article-title>Development and evaluation of rapid and low-cost detection system for apple groove virus based on Crispr-Cas12a technology</article-title>&#x201D; in <source>Master thesis</source> (<publisher-loc>Zhengzhou</publisher-loc>: <publisher-name>Henan Agricultural University</publisher-name>).</citation></ref>
<ref id="ref13"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ling</surname><given-names>X.</given-names></name> <name><surname>Chang</surname><given-names>L.</given-names></name> <name><surname>Chen</surname><given-names>H.</given-names></name> <name><surname>Gao</surname><given-names>X.</given-names></name> <name><surname>Yin</surname><given-names>J.</given-names></name> <name><surname>Zuo</surname><given-names>Y.</given-names></name> <etal/></person-group>. (<year>2021</year>). <article-title>Improving the efficiency of CRISPR-Cas12a-based genome editing with site-specific covalent Cas12a-crRNA conjugates</article-title>. <source>Mol. Cell</source> <volume>81</volume>, <fpage>4747</fpage>&#x2013;<lpage>4756.e7</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.molcel.2021.09.021</pub-id>, PMID: <pub-id pub-id-type="pmid">34648747</pub-id></citation></ref>
<ref id="ref14"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname><given-names>Y.</given-names></name> <name><surname>Pinto</surname><given-names>F.</given-names></name> <name><surname>Wan</surname><given-names>X.</given-names></name> <name><surname>Yang</surname><given-names>Z.</given-names></name> <name><surname>Peng</surname><given-names>S.</given-names></name> <name><surname>Li</surname><given-names>M.</given-names></name> <etal/></person-group>. (<year>2022</year>). <article-title>Reprogrammed tracrRNAs enable repurposing of RNAs as crRNAs and sequence-specific RNA biosensors</article-title>. <source>Nat. Commun.</source> <volume>13</volume>:<fpage>1937</fpage>. doi: <pub-id pub-id-type="doi">10.1038/s41467-022-29604-x</pub-id>, PMID: <pub-id pub-id-type="pmid">35410423</pub-id></citation></ref>
<ref id="ref15"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ma</surname><given-names>X.</given-names></name> <name><surname>Cui</surname><given-names>Y.</given-names></name> <name><surname>Qiu</surname><given-names>Z.</given-names></name> <name><surname>Zhang</surname><given-names>B.</given-names></name> <name><surname>Cui</surname><given-names>S.</given-names></name></person-group> (<year>2013</year>). <article-title>A nanoparticle-assisted PCR assay to improve the sensitivity for rapid detection and differentiation of wild-type pseudorabies virus and gene-deleted vaccine strains</article-title>. <source>J. Virol. Methods</source> <volume>193</volume>, <fpage>374</fpage>&#x2013;<lpage>378</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.jviromet.2013.07.018</pub-id>, PMID: <pub-id pub-id-type="pmid">23872268</pub-id></citation></ref>
<ref id="ref16"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Makarova</surname><given-names>K. S.</given-names></name> <name><surname>Wolf</surname><given-names>Y. I.</given-names></name> <name><surname>Alkhnbashi</surname><given-names>O. S.</given-names></name> <name><surname>Costa</surname><given-names>F.</given-names></name> <name><surname>Shah</surname><given-names>S. A.</given-names></name> <name><surname>Saunders</surname><given-names>S. J.</given-names></name> <etal/></person-group>. (<year>2015</year>). <article-title>An updated evolutionary classification of CRISPR-Cas systems</article-title>. <source>Nat. Rev. Microbiol.</source> <volume>13</volume>, <fpage>722</fpage>&#x2013;<lpage>736</lpage>. doi: <pub-id pub-id-type="doi">10.1038/nrmicro3569</pub-id>, PMID: <pub-id pub-id-type="pmid">26411297</pub-id></citation></ref>
<ref id="ref17"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Paul</surname><given-names>B.</given-names></name> <name><surname>Montoya</surname><given-names>G.</given-names></name></person-group> (<year>2020</year>). <article-title>CRISPR-Cas12a: functional overview and applications</article-title>. <source>Biom. J.</source> <volume>43</volume>, <fpage>8</fpage>&#x2013;<lpage>17</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.bj.2019.10.005</pub-id>, PMID: <pub-id pub-id-type="pmid">32200959</pub-id></citation></ref>
<ref id="ref18"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Tu</surname><given-names>F.</given-names></name> <name><surname>Zhang</surname><given-names>Y.</given-names></name> <name><surname>Xu</surname><given-names>S.</given-names></name> <name><surname>Yang</surname><given-names>X.</given-names></name> <name><surname>Zhou</surname><given-names>L.</given-names></name> <name><surname>Ge</surname><given-names>X.</given-names></name> <etal/></person-group>. (<year>2022</year>). <article-title>Detection of pseudorabies virus with a real-time recombinase-aided amplification assay</article-title>. <source>Transbound. Emerg. Dis.</source> <volume>69</volume>, <fpage>2266</fpage>&#x2013;<lpage>2274</lpage>. doi: <pub-id pub-id-type="doi">10.1111/tbed.14241</pub-id>, PMID: <pub-id pub-id-type="pmid">34273259</pub-id></citation></ref>
<ref id="ref19"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Yang</surname><given-names>Y.</given-names></name> <name><surname>Kong</surname><given-names>X.</given-names></name> <name><surname>Yang</surname><given-names>J.</given-names></name> <name><surname>Xue</surname><given-names>J.</given-names></name> <name><surname>Niu</surname><given-names>B.</given-names></name> <name><surname>Chen</surname><given-names>Q.</given-names></name></person-group> (<year>2024</year>). <article-title>Rapid nucleic acid detection of <italic>Listeria monocytogenes</italic> based on RAA-CRISPR Cas12a system</article-title>. <source>Int. J. Mol. Sci.</source> <volume>25</volume>:<fpage>3477</fpage>. doi: <pub-id pub-id-type="doi">10.3390/ijms25063477</pub-id>, PMID: <pub-id pub-id-type="pmid">38542449</pub-id></citation></ref>
<ref id="ref20"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zanella</surname><given-names>E. L.</given-names></name> <name><surname>Miller</surname><given-names>L. C.</given-names></name> <name><surname>Lager</surname><given-names>K. M.</given-names></name> <name><surname>Bigelow</surname><given-names>T. T.</given-names></name></person-group> (<year>2012</year>). <article-title>Evaluation of a real-time polymerase chain reaction assay for Pseudorabies virus surveillance purposes</article-title>. <source>J. Vet. Diagn. Invest.</source> <volume>24</volume>, <fpage>739</fpage>&#x2013;<lpage>745</lpage>. doi: <pub-id pub-id-type="doi">10.1177/1040638712447279</pub-id>, PMID: <pub-id pub-id-type="pmid">22621947</pub-id></citation></ref>
<ref id="ref21"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>C.</given-names></name> <name><surname>Cui</surname><given-names>S.</given-names></name> <name><surname>Zhu</surname><given-names>C.</given-names></name></person-group> (<year>2010</year>). <article-title>Loop-mediated isothermal amplification for rapid detection and differentiation of wild-type pseudorabies and gene-deleted virus vaccines</article-title>. <source>J. Virol. Methods</source> <volume>169</volume>, <fpage>239</fpage>&#x2013;<lpage>243</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.jviromet.2010.07.034</pub-id>, PMID: <pub-id pub-id-type="pmid">20691214</pub-id></citation></ref>
</ref-list>
</back>
</article>