The experimental material consisted of tomato plants (Solanum lycopersicum L., cv. Tianfei 9) grown in a climate-controlled growth room at 25 ± 1°C, 65 ± 5% relative humidity, and a 16:8 h light:dark photoperiod. Tomato samples from 15-day-old seedlings of uniform growth and development were collected for conducting Aspergillus niger infection.

The evolving lineages of A. niger in the experimental evolution assay were derived from the Shanxi Provincial Engineering Research Center for Microbial Application Technology, Shanxi, China, which we refer to here as the experimental strain A. niger 129B. The strain was cultivated on potato dextrose agar (PDA) at 28°C. Escherichia coli DH5α, grown in LB medium at 37°C, was used for plasmid propagation, while Agrobacterium tumefaciens AGL1, maintained on LB medium at 28°C, was used for plasmid transformation. Reagents for plasmid construction and real-time qPCR were obtained from Takara (China) to identify the experimental strain A. niger 129B. Spores of A. niger 129B were collected from PDA cultures incubated at 28°C for 7 days and subsequently cultured in corn steep liquor at a concentration of 1 × 10⁻⁶ CFU/mL. This spore suspension was used for A. niger infection of tomato roots.

For the tomato root experiments, 15-day-old tomato seedlings (one seedling per pot) were transferred to containers containing natural soil. Immediately after transplantation, the base of the tomato root was infected with 25 mL of fungal suspension or with 25 mL of aseptic water as a control. Subsequently, the fungi suspension-treated seedlings were continuously irrigated with 25 mL of the solution every other day until the 45th day, while the control seedlings, which did not receive A. niger 129B treatment, were irrigated with 25 mL of water until the 45th day. The tomato plants were cultivated in a growth chamber with a controlled temperature (26 ± 1°C) and a photoperiod of 16 h of light and 8 h of darkness. For each treatment, three independent experiments were carried out. Samples from the fungal treatment were used for morphological traits and molecular analyses.

The aboveground growth condition of the tomato between the control and A. niger 129B was photographed on days 0, 7, 14, 21, 28, and 35, respectively. The plants with uniform growth were selected from each treatment on the 35th day of A. niger incubation to measure their height and stem thickness using a ruler.

We measured root morphological traits after carefully washing the roots with DI water and removing any adhering moisture. The determination of root architecture parameters followed the methodology of Gao et al. (2023). Tomato seedling roots with uniform growth were scanned using an Epson Perfection V850 Pro scanner (Epson, Tokyo, Japan). The resulting scanned images were analyzed using specialized root analysis software (WinRHIZO 2016, Regent Instruments Corporation, Shanghai, China). Root growth-related parameters, including total root length, total root surface area, average root diameter, and root volume, were determined for each treatment on the 15th, 30th, and 45th days of A. niger incubation. Three biological replicates were measured for each treatment.

The tomato leaf growth conditions between the control and A. niger 129B were photographed on days 0, 7, 14, 21, 28, and 35, respectively. Chlorophylls of the 35th day post-treatment (35 dpt) leaf of tomato were extracted with 80% acetone. Chlorophyll content in leaves was determined at 663 nm via a spectrophotometer (Evolution 300, Thermo Fisher Scientific, United States) using the BioTek Synergy H4 Hybrid Multi-Mode Microplate Reader. Each treatment had three biological replications.

Tomato plants at the fourth leaf stage, 14 dpt with A. niger 129B, were washed with deionized (DI) water, and root tissues were fully immersed in experimental solution (0.1 mM CaCl2, 0.3 mM 2-(N-morpholino) ethanesulfonic acid, pH = 6) for 30 min of equilibration. Then, H⁺ fluxes at the tomato root apex were recorded using the non-invasive microtest technique (NMT, 100S-SIM-XY, Xuyue Sci & Tech Co., Ltd., Beijing, China) according to the previously reported method (Wang et al., 2022). Continuous transient H⁺ efflux was monitored at the meristematic region (500 μm from the root tip) and recorded for 5 min. Each measurement was conducted using five biological replicates. Data analysis was conducted using imFluxes V2.2 software.

Fungal infection samples and control samples treated with aseptic water at 30 dpt were stored at −20°C until further transcriptome analysis. Transcript assay total RNA extraction using the TransZol Up Plant RNA Kit (Beijing Transgenbiotech Co., Ltd., Beijing, China) for Illumina^® was performed according to previous research (Wu et al., 2023). The mRNA product was purified from 3 μg of RNA using poly-T-oligo-attached magnetic beads. Subsequently, the purified mRNA fragments were fragmented into small pieces using a proprietary fragmentation buffer at elevated temperatures. First-strand cDNA was synthesized through reverse transcription using random oligonucleotide primers SuperScript II, followed by second-strand cDNA synthesis using DNA Polymerase I and RNase H. TailingMix and RNA Index Adapters added for terminal repair incubation were selectively enriched using Illumina PCR Primer Cocktail in a 15-cycle PCR reaction. PCR amplification products of cDNA fragments were purified using the AMPure XP system and dissolved in EB solution. The sequencing library generated from the PCR product was denatured by heating. Finally, looping through the splint oligo sequence facilitated the formation of single-stranded circular DNA (ssCir DNA), completing the final library. The transcriptomic analysis of gene functional annotations was performed as described previously (Wu et al., 2023), including Gene Ontology (GO), eggNOG, Kyoto Encyclopedia of Genes and Genomes (KEGG) databases, GO enrichment analysis, KEGG pathway enrichment analysis of differentially expressed genes, and KEGG Orthology (KO) analysis of unigenes. All the above measurements were performed with five replications.

Tomato seedlings, 30 days post-transplantation (dpt), were used for the metabolomics assay. The experimental group was infected with 25 mL of fungal suspension, while the control seedlings, which did not receive A. niger 129B treatment, were irrigated with 25 mL of aseptic water. All samples were stored at −80°C until further metabolomics analysis. Eighty milligrams of the thawed samples were obtained to add a pre-cooled methanol/acetonitrile/aqueous solution (2:2:1, v/v), and then quickly frozen with liquid nitrogen to grind into a fine powder. Subsequently, the powder was added to 1,000 μL of a methanol/acetonitrile/H2O mixture (2:2:1, v/v/v), and the mixture was centrifuged to collect the supernatant for metabolomics analysis. The significance of differences in metabolomes was analyzed using the partial least squares discriminant analysis (PLS-DA) methodology and a t-test, as well as fold change (FC) analysis (Wu et al., 2024). Differentially expressed metabolites were determined using principal component analysis (PCA). Differentially expressed metabolites (DEMs) were determined with the parameters of variable importance of projection (VIP) in the PLS-DA model ≥1 and fold-change ≥1.5 or ≤0.67. The Kyoto Encyclopedia of Genes and Genomes (KEGG) databases were used to annotate the differential metabolites and identify associated metabolic pathways. Five biological replications were measured for each treatment.

The expression levels of eight differentially expressed genes were selected to validate the reliability of the RNA-seq data using quantitative real-time PCR (qRT-PCR) technology (CFX96 Real-Time System, Bio-Rad, California, United States). The reaction system of the Real-Time PCR System, using SYBR Green as the fluorescent dye, was employed according to the manufacturer’s protocol. The PCR amplification system for each sample had a total volume of 25 μL, consisting of 1 μL of cDNA, 1 μL of gene-specific primers, 10.25 μL of RNase-free water, 0.25 μL of Rox Dye (50×), and 12.5 μL of 2 × PerfectStart Green qPCR SuperMix (TransGen Biotech, China). The PCR reaction system comprised an initial denaturation step at 95°C for 5 min, followed by 40 cycles of 10 s at 95°C, 15 s at 55°C, and 20 s at 72°C. The validation of RNA-seq data consisted of three biological replicates with three technical replicates. Solanum lycopersicum. SL3.0.51.genomme.fa (S1) was the internal control gene.

The tomato plant at 45 dpt with A. niger 129B was available for analysis of gene expression in root, stem, and leaf. Total RNA extraction from each sample of tomato root, stem, and leaf utilizing the TransZol Up Plant RNA Kit (Beijing Transgenbiotech Co., Ltd., Beijing, China) was performed according to the manufacturer’s instructions. Quantitative reverse transcription PCR (qRT-PCR) was performed using the PerfectStart Uni RT & qPCR Kit (Beijing Transgenbiotech Co., Ltd., Beijing, China) on a Stratagene Mx3000P Real-Time PCR system (Stratagene, CA, United States) in accordance with the manufacturer’s protocols. The primers are as follows: PP2C72-F: TAAGGAACTGTGATGGTAGAG, PP2C72-R: GCAAGAACAAGCAGATGAC; SAUR32-F: GCATCCCAAAGGGGTGTCTT, SAUR32-R: GGTTATGATGTCCGGTGGCA; S1Actin-F: GGAATGGGACAGAAGGAT, S1Actin-R: CAGTCAGGAGAACAGGGT. The PCR amplification system for each sample had a total volume of 20 μL, consisting of 1 μL of cDNA, 0.8 μL of gene-specific primers, 7.8 μL of RNase-free water, 0.4 μL Universal Passive Reference Dye (50×), and 10 μL of 2 × PerfectStart Green qPCR SuperMix (TransGen Biotech, China). The PCR reaction protocol included an initial denaturation step at 95°C for 5 min, followed by 40 cycles of 10 s at 95°C, 15 s at 55°C, and 20 s at 72°C. S1 was utilized as the internal reference control. The relative expression levels of genes SAUR32 and PP2C72 were calculated using the 2^−ΔΔCT method. Each sample was represented by three biological replicates with three technical replicates.

The experimental tobacco (Nicotiana benthamiana) used in this research was cultivated in a greenhouse at 24°C and 37% relative humidity, with a 16-h light/8-h dark photoperiod. Moreover, 15-day-old tomato seedlings were used to obtain the cDNA sequences of the genes SUAR32 and PP2C72 for vector construction. The coding regions of SAUR32 and PP2C72 were inserted into the NcoI/SpeI sites of pCAMBIA1302. The subcellular localization of SUAR32 and PP2C72 fused to the GFP fluorescent reporter was performed in N. benthamiana leaf protoplasts in accordance with the protocol described previously (Wang et al., 2011). Briefly, protoplast cells from the third and fourth leaves, counting from the top of each tobacco plant, were isolated and transformed via the PEG-mediated protoplast transfection method (Wang et al., 2011). Full-length cDNA was fused with GFP in PGBKT7-SAUR32 and PGADT7-PP2C72, which were individually transiently transformed into the protoplasts of N. benthamiana leaves. After incubation for two nights, GFP fluorescence images were captured using a fluorescence confocal microscope (Dragonfly CR-DFLY-505; Suzhou Anqin Air Technology Corporation, Suzhou, China).

Yeast two-hybrid (Y2H) assays were performed in accordance with the manufacturer’s protocol. The complete coding sequences of the SAUR32 and PP2C72 genes were amplified from the Tianfei 9 variety using 15-day-old tomato seedlings and primers as described above. The coding regions of SAUR32 and PP2C72 were inserted between the NdeI/BamHI sites of pGADT7 and between the NdeI/BamHI sites of pGBKT7. The resulting PCR fragments were sequenced to validate their reliability and then integrated into pGBKT7 or pGADT7 vectors using double-restriction enzyme digestion with NdeI/BamHI. The resulting recombinant bait and prey plasmids were co-transformed into the yeast Y2H strain and selected on SD-Leu-Trp media at 30°C for 3 days. Subsequently, a selective single colony was inoculated into liquid SD-Leu-Trp medium and incubated overnight at 30°C. Eventually, the overnight cultures were serially diluted into three concentrations and spotted on SD-Leu-Trp and SD-Leu-Trp-His media, followed by incubation at 30°C for 3 days.

The coding regions of SAUR32 and PP2C72 from 15-day-old tomato seedlings were used for the vector construct. Bimolecular fluorescence complementation analysis was conducted as previously described (Kudla and Bock, 2016). Briefly, the coding regions of SAUR32 and PP2C72 were inserted between the NdeI/BamHI sites of pGADT7 and pGBKT7, respectively. pSPYCE(M)-SAUR32, pSPYNE173-PP2C72, pSPYCE(M), and pSPYNE173 were introduced into Agrobacterium tumefaciens strain GV3101 and co-transformed into approximately 5-week-old N. benthamiana leaves via agroinfiltration. GFP fluorescence signals were detected and imaged 3 days post-infiltration using a fluorescence confocal microscope (Dragonfly CR-DFLY-505; Suzhou Anqin Air Technology Corporation, Suzhou, China).

All experimental data were analyzed using a minimum of three independent biological replicates with SPSS (IBM SPSS Statistics 25). A one-way ANOVA with Tukey’s post hoc test was applied to compare the means between the controls and treatments, with a p-value of < 0.05.

To determine the influence of A. niger 129B infection on tomato plant growth across different day treatments, we measured morphological characteristics related to plant growth, including plant height, stem diameter, total root length, root surface area, mean root diameter, root volume, relative chlorophyll content, and both aboveground and underground growth conditions. A. niger 129B infection significantly promoted tomato plant growth by increasing plant height, stem diameter and aboveground growth (Figure 1A). These effects were statistically significant at 35th day post-treatment (35 dpt) compared to the water-treated control. Specifically, stimulation with A. niger 129B resulted in an 11.64% increase in plant height (52.75 cm) and a 45.40% increase in stem diameter (9.48 mm) at 35 dpt compared to control values of 47.25 cm and 6.52 mm, respectively (Figures 1B,C). Irrigation with A. niger 129B also led to notable aboveground leaf growth and increased relative chlorophyll content. At 35 dpt, A. niger 129B treatment significantly improved tomato leaf parameters, showing a 25.47% increase in relative chlorophyll content (46.3) compared to the control (36.9) (Figure 2). In terms of underground growth, A. niger 129B inoculation enhanced root tissue growth compared to control plants at 15th, 30th, and 45th days post-treatment (dpt). At 45th dpt, total root length increased by 16.38, 39.26, and 24.83%; root surface area by 9.61, 15.45, and 13.00%, respectively, mean root diameter by 21.42, 18.40, and 19.66%; and root volume by 11.43, 13.74, and 12.60%, respectively, compared to the control treatment. However, at 15th dpt, A. niger 129B did not show statistically significant differences compared to the control (Figure 3).

The H⁺ flux recordings showed a highly significant efflux after A. niger 129B infection at 14 dpt (Figure 4). The H⁺ efflux reached 14 pmol·cm⁻² s⁻¹ in tomato roots treated with A. niger 129B, while control roots showed minimal H⁺ efflux at 0.4 pmol·cm⁻² s⁻¹ (Figure 4A). The pH value at the root surface of A. niger 129B-infected plants decreased by 0.2 compared to the control (Figure 4B). This increased H⁺ efflux was driven by H⁺-ATPases in the plasma membrane, which contributed to enhanced tomato growth after A. niger 129B infection.

Transcriptome analysis techniques have been developed in the tomato plant in response to A. niger 129B infection in our research. The expression levels of 13 differentially expressed genes (DEGs) were randomLy validated to assess the reliability of the real-time qPCR experiment, and 8 of these genes passed the differential abundance criteria in both RNA-seq and qPCR analysis (Table 1 and Figure 5). The expression of tomato genes identified in control groups and A. niger treatment was used to identify the DEGs based on |log2(Fold Change) | ≥1.5. A total of 467 significant DEGs were detected in transcriptomic analysis. Three hundred and two DEGs of them showed different degrees of upregulation, while 165 of them performed downregulation in the A. niger 129B treatment compared with the control (Figure 6). Small auxin up RNA (SAUR)-mediated cell elongation and protein phosphatase class 2C (PP2C), involved in regulating plant growth, showed significant downregulation (Figure 5). The combined transcriptomic and metabolomic analysis indicated that SAUR32 interacts with the PP2C72, which regulates the plant signal transduction under A. niger 129B infection (Figure 7A). Moreover, A. niger 129B induced the plant to produce IAA, with a maximum yield of 203.64 ng/μL after 14 days of incubation, compared to the control, which yielded 157.05 ng/μL (Figure 7B).

The A. niger 129B treatment for tissue expression analysis of SAUR32 and PP2C72 revealed its presence at 15th dpt. The SAUR32 and PP2C72 gene transcript levels were identified utilizing a qRT-PCR experiment (Figure 8A). The results showed that the expression of the SAUR32 and PP2C72 genes in all test tissues affected by A. niger 129B infection was affected. When subjected to A. niger 129B treatment, the transcript levels in tomato roots, stems, and leaves exhibited downregulation, with the lowest value observed after 14 days of A. niger 129B infection (Figure 8B).

To investigate the subcellular localization of SAUR32 and PP2C72, transient expression of SAUR32-GFP, PP2C72-GFP, SAUR32-GRFP, and PP2C72-RFP fusion proteins was performed by injecting the constructs into N. benthamiana leaves for 2 days. The construct containing the 35S promoter was used as a blank control. Fluorescent signals from the SAUR32-GFP, PP2C72-GFP, SAUR32-RFP, and PP2C72-RFP fusion proteins were observed in the transformed protoplasts and were detected in both the nucleus and cell membrane (Figure 9). These findings strongly suggest that SAUR32 and PP2C72 were localized in the nucleus and cell membrane.

Here, we verified the interaction between SAUR32 and PP2C72 using yeast two-hybrid (Y2H) analysis. In our research, we observed that PP2C72-pGADT7 and pGBKT7-SAUR32 cotransformed yeast AH109 were grown in medium at 30°Cfor 3 days. Research findings indicate that the cotransformed positive yeast turned blue on the selective medium (SD-Trp-Leu-His-Ade) containing x-α-gal. The PP2C72-pGADT7 fusion with pGBKT7-SAUR32 in AH109 exhibited growth under specific conditions (Figure 10). These results indicated that SAUR32 interacted with PP2C72.

To elucidate the SAUR32 and PP2C72 interaction in vivo, the study was performed using bimolecular fluorescence complementation (BiFC) assays by infiltration of pSPYCE(M)-SAUR32, pSPYNE173-PP2C72, or pSPYCE(M), pSPYNE173 into N. benthamiana leaf samples. Nuclear green fluorescence detected signals from N. benthamiana leaves that were, respectively, introduced with pSPYCE(M)-SAUR32 and pSPYNE173-PP2C72 constructs via the Agrobacterium (GV3101) infiltration method, while no fluorescence signal was present in live plants injected with pSPYCE(M) and pSPYNE173 (Figure 11). The BiFC assays confirmed that SAUR32 interacts with PP2C72.