Thermoactinospora rubra YIM 77501^T (=DSM 45614^T= CCTCC AA 2011014^T) was cultured on modified ISP 2 medium at 50°C (Zhou et al., 2012) for DNA extraction. Escherichia coli DH5α was utilized for gene cloning and expression. Recombinant E. coli was cultured in Luria-Bertani (LB) medium containing 50 μg/mL kanamycin at 37°C.

Genomic DNA from T. rubra YIM 77501^T was extracted using the DNA Purification kit (Sangon Biotech, China) according to the manufacturer's instructions. Primers were designed based on the sequence in the database: 77501-Uox-F (CATCATCATCATCATCATGAAATGTCAGTCATCCTTGGCCCGAA) and 77501-Uox-R (GTGCTCGAGTGCGGCCGCAAGCTCCCAGGCGAAGGCCGCGTCG). The uricase gene (truox, NCBI accession NO.: WP_084956803) was amplified using TransStarFastPfu Fly DNA Polymerase (TransGen Biotech, China). PCR conditions included initial denaturation at 98°C for 3 min, followed by 30 cycles at 98°C for 20 s, 55°C for 30 s, and 72°C for 1 min, and a final extension at 72°C for 5 min for the final extension. PCR products were analyzed on a 1.2% agarose gel, and inserted into the pSHY211 plasmid (Yin et al., 2023) using the pEASY-Uni Seamless Cloning and Assembly Kit (TransGen Biotech, China) to construct pSHY211-truox.

Uricase activity was assayed in a 1.0 mL reaction system containing a working solution of uric acid (0.04 mol/L), EDTA (1 mmol/L), boric acid (50 mmol/L), and Triton X-100 (0.001%) at pH 8.5. The reaction was terminated by adding 20% KOH. Enzyme activity was quantified by monitoring the decrease in absorbance at 290 nm after 30 min incubation at 35°C and pH 7.6. One unit of enzyme activity was defined as the amount of enzyme required to convert 1 μmol of uric acid to allantoin per minute under these conditions.

The thermostability of TrUox was evaluated by incubating the enzyme at different temperatures (4, 35, 37, 50°C) and measuring residual activity at 2-day intervals over a 18-day period, with the initial time point (0-day) serving as the untreated control. pH stability was evaluated in buffers ranging from pH 4.0 to 10.0 at 4°C for 12 and 24 h, with the 0-h time point serving as the untreated control. Metal ion and chemical reagent tolerance were tested with 1 mmol/L of different metal ions and 1% chemical reagents, with reactions without additives as control. The Km and Vmax values of urate oxidase were calculated using the Lineweaver-Burk method, based on the reduction of uric acid absorbance at 290 nm over a 10-min period.

Guidelines from ACR and EULAR, along with others like ASCR (American Society of Clinical Rheumatologists), 3Es (Evidence, Expertise, Exchange), JSGNM (Japanese Society of Gout and Nucleic Acid Metabolism), and DCGP (Dutch College of General Practitioners) define normal blood uric acid levels as below 6 mg/dL (360 μmol/L; Ruoff and Edwards, 2016). Furthermore, most studies indicate that males have higher uric acid levels than females, particularly before menopause. Hence, the normal range for men is 3.4–7.0 mg/dL (~202–416 μmol/L), while for women it is 2.4–6.0 mg/dL (~143–357 μmol/L). Consequently, this study adopted 360–420 μmol/L as the standard normal uric acid range (Singh and Gaffo, 2020). The enzyme solution was reacted with a 600 μmol/L uric acid stock solution in saline buffer at 37°C pH 7.4. Uric acid content was measured at regular intervals until the OD₂₉₀ value stabilized, matching the baseline (0 μmol/L of uric acid), at which point the reaction was terminated. For the degradation experiment of TrUox in saline solution, the minimum enzyme dose was added to anticoagulated blood samples from six hyperuricemic volunteers, whose blood uric acid levels were 715, 731, 618, 487, 717, and 757 μM, respectively. For each anticoagulated blood sample collected from the hyperuricemic volunteers, triplicate technical replicates were performed by independently processing three aliquots (300 μL each) derived from the same 1 mL specimen. Measurements were conducted under identical experimental conditions to assess analytical consistency. The uric acid concentration in the blood was continuously monitored every 1 h using a uric acid detector (Kefu Yi uric acid tester UA03-C, China).

The present study employed the SWISS-MODEL template library to perform homology modeling analysis of the TrUox protein. The results revealed that it shares the highest sequence identity (53.85%) with the X-ray crystal structure template 7F2V (PDB ID), while demonstrating complete conservation of catalytic residues. The quality, stability, and accuracy of the TrUox structure were modeled and evaluated using VERIFY 3D and ProQ tools (Chiu et al., 2021b).

The initial structure of AfUox for molecular dynamics (MD) simulations was retrieved from the Protein Data Bank (PDB: 4D12). Simulations were performed using the GROMACS-2021.5 software with the following parameters and protocols: the AMBER99SB-ILDN force field (Pires et al., 2011; Abraham et al., 2015) and TIP3P water model (Jorgensen et al., 1983) were applied. Both structural models were centered in a dodecahedral box with a minimum distance of 1.0 nm between the protein and box edges. To neutralize the system and mimic physiological salt conditions, the box was solvated with water molecules, and appropriate amounts of Na⁺ and Cl⁻ ions were added by replacing equivalent volumes of water. Energy minimization was conducted using the steepest descent algorithm to resolve atomic clashes and stereochemical conflicts.

Prior to the production phase of MD simulations, the system underwent restrained equilibration under NVT (constant number of atoms, volume, and temperature) and NPT (constant number of atoms, pressure, and temperature) ensembles. Production MD simulation parameters were set as follows: an integration time step of 2 fs; covalent bond constraints implemented via the LINCS algorithm (Hess et al., 1997); long-range electrostatic interactions treated using the Particle Mesh Ewald (PME) method (Darden et al., 1993) with a cutoff radius of 1.0 nm; van der Waals (vdW) interactions modeled by the Lennard-Jones potential with a cutoff radius of 1.0 nm. The system temperature was maintained at 300 K using the v-rescale thermostat (Bussi et al., 2007) with a coupling time constant (τ_t) of 0.1 ps, while pressure was controlled at 1 atm via the Parrinello-Rahman barostat (Nosé and Klein, 1983; Parrinello and Rahman, 1981) with a coupling time constant (τ_p) of 0.5 ps. To enhance conformational sampling efficiency, a multi-replica strategy was employed, with three independent 200 ns production MD simulations conducted for each system, each initiated with distinct atomic velocities assigned by Maxwell-Boltzmann distributions at 310 K. Root-mean-square deviation (RMSD) and Cα root-mean-square fluctuation (RMSF) were calculated using the GROMACS tools “gmx rms” and “gmx rmsf”, respectively (Chiu et al., 2021b; Sang et al., 2016).

The free energy landscape (FEL) of TrUox and AfUox was constructed based on projections on eigenvectors PC1 and PC2 from the simulation trajectories, using the probability density function:

Where, k_B is Boltzmann constant, T is the temperature, N_i is the probability that the protein conformation is at I, and N_max is the maximum probability (free energy of state i).

Unless otherwise stated, all experiments were performed in triplicate, and the mean values were used for all analyses. Data were analyzed using SPSS 20.0 statistical software and are expressed as mean ± standard deviation (SD). Statistical comparisons between multiple treatment groups were performed using one-way ANOVA followed by Tukey's test. A p-value < 0.05 was considered statistically significant in all comparisons.

The open reading frame (ORF) of the uricase gene from T. rubra YIM 77501^T was amplified and analyzed using agarose gel electrophoresis, revealing a band ~900 bp closely corresponding to the sequencing result of 867 bp. The uricase, TrUox, was subsequently examined for its translation and physicochemical properties using the ExPASy tool (https://www.expasy.org/), predicting a composition of 288 amino acids and an isoelectric point of 5.75, classifying it as a stable acidic protein. A comparative analysis of the TrUox amino acid sequence with related urate oxidase in the NCBI database revealed a 84.72% sequence similarity to urate oxidase from Nonomuraea soli with a phylogenetic constructed using MEGA 7 software package (Supplementary Figure S1).

Positive recombinant pSHY-TrUox strains were screened on LB agar plates supplemented with 2 g/L uric acid, as evidenced by clear zones of uric acid degradation around the colonies (Figure 1a). This result confirms the successful cloning of pSHY-TrUox and its functional expression. Enzyme viability assays were conducted using samples from both the fermentation broth and cell lysates during the fermentation process. The assays established that the uricase expressed by pSHY-TrUox functions as an intracellular enzyme. SDS-PAGE analysis of the purified TrUox displayed a distinct protein band at 30 kDa (Figure 1b), consistent with the expected molecular weight of 31.871 kDa.

TrUox was subjected to temperature gradient testing by incubating the enzyme with its substrate across a temperature gradient ranging from 20 to 65°C, in 5°C increments. The enzyme retained over 50% of its activity between 30 and 50°C, with optimal activity observed at 35°C where it maintained ~98% of its activity at 37°C (Figure 2A). For pH sensitivity, the enzyme was tested in buffers ranging from pH 3 to pH 10, with 0.6 pH unit intervals. TrUox showed consistent over 50% activity within a pH range of 6.0–9.0 (Figure 2B).

The thermostability of TrUox was evaluated by incubation at 4, 35, 37, and 50°C. The results demonstrated significant temperature- and time-dependent characteristics: When stored at 4°C, TrUox retained >90% residual activity for up to 18 days. At 35 and 37°C, the enzyme maintained >90% residual activity during the first 10 days of incubation. However, prolonged exposure to these elevated temperatures led to gradual structural degradation, resulting in a decline to 50% residual activity by day 18. Under the more severe thermal stress of 50°C, TrUox initially preserved >90% activity until day 4, but subsequently underwent irreversible denaturation, with residual activity plummeting to 50% by day 6 (Figure 2C).

Long-term pH stability was examined by incubating the enzyme at various pH levels (6.0 to 10.0) for 12 and 24 h, with no significant difference observed between the two time points, indicating consistent activity across this pH range. TrUox activity was significantly reduced at pH values below 4.0 or above 9.6 (Figure 2D). These results highlight the enzyme's adaptability to a range of environmental conditions.

TrUox enzyme activity increased in the presence of metal ions Ca²⁺, Pb²⁺, and Zn²⁺, with relative activity exceeding 100%. Methanol exhibited the most significant stimulatory effect, increasing relative activity to over 120%. Conversely, chemicals such as PMSF, ethanol, and methanol showed no substantial impact on TrUox activity, while EDTA had an inhibitory effect, reducing relative activity to below 80% (Figure 3).

When blood levels of uric acid exceed the body's solubility threshold, urate crystals may precipitate and deposit in joints and periarticular cartilage, leading to specific diseases (Singh and Gaffo, 2020; Hansildaar et al., 2021). To replicate this physiological state in vitro, we introduced 11.4 μg/mL of TrUox into a high uric acid environment, using 600 μmol/L uric acid as the substrate. This treatment reduced the uric acid concentration to a normal range within 15 min. Additionally, using a lower concentration of 1.14 μg/mL TrUox, the uric acid level reached the normal range after 120 min and dropped to 0 μmol/L after 180 min (Figure 4A). These findings highlight the significant potential of TrUox for use in developing uric acid diagnostic kits and treating uric acid metabolic diseases.

Based on the degradation experiment of recombinant uricase TrUox in saline solution, this study selected anticoagulated whole blood samples from six hyperuricemic patients. For blood sampling, antecubital venous blood was collected from fasting subjects using heparin anticoagulant tubes. Immediately after collection, the tubes were gently inverted to ensure mixing and temporarily stored at 4°C. Uricase was subsequently added to the processed samples, achieving a final enzyme concentration of 1.14 μg/mL. All six patients exhibited blood uric acid levels below the reference range 2 h post-treatment (Figure 4B). This indicates that recombinant uricase TrUox can effectively reduce blood uric acid concentration in a short time.

The predicted protein model for TrUox was assessed with a QMEAN Z-score of −2.16, indicating a structure of good quality. Further evaluation using VERIFY 3D revealed that over 85.54% of the residues achieved a 3D-1D score of at least 0.2, confirming most residues are favorably positioned. ProQ analysis supported this with a ProQ LG score of 4.25, suggesting good stereochemistry of the TrUox structure. Ramachandran Plot, generated by PROCHECK, showed 96.2% of amino acid residues in the most favorable regions, underscoring the model's accuracy (Supplementary Figure S2). The overall quality factor as predicted by the ERRAT server was 95.66. These evaluations provide a solid foundation for subsequent structural studies. The 3D structure of TrUox was visualized using PyMOL (Figure 5A).

Sequence comparison results show that TrUox and AfUox share 34.2% amino acid sequence similarity, as depicted in Supplementary Figure S3. Both enzymes exhibit similar monomer structures, which include an eight-stranded β-sheet in sequence, complemented by two shorter β-strands, four primary α-helices, and two single-turn α-helices. Notably, TrUox features an additional half-turn α-helix toward the end of its amino acid sequence. In contrast, AfUox contains additional single-turn α-helical regions at positions 50 and 193, highlighted in dark blue on the structures (Figure 5).

The temperature chosen for the MD simulations of TrUox and AfUox was 310 K, which is the temperature at which uricase exerts its biological function. Using the initial structure of simulation as a reference, the RMSD values of the 200 ns complete trajectories were calculated. In the simulation process, not only was the overall RMSD value of TrUox was higher than that of AfUox during the simulation but also its curves showed less fluctuation (Figure 6A), which indicated that TrUox underwent fewer conformational changes. To further examine the molecular flexibility of these two enzymes, we calculated the RMSF values of their Cα atoms. As indicated in Figure 6B, the RMSF values of TrUox were lower than those of AfUox in most regions, and the average RMSF values of TrUox and AfUox were 0.195 and 0.216 Å, respectively, suggesting that TrUox showed higher structural rigidity and stability than AfUox during the 310 K simulations.

To compare the conformational distributions of TrUox and AfUox structures during simulations, two-dimensional free energy landscapes (FELs) were constructed (Figure 7). TrUox exhibits a smaller surface area of free energy and a lower global minimum free energy value, indicating reduced conformational entropy and diversity compared to AfUox. The global minimum of TrUox is relatively large and concentrated in the free energy graph, in contrast to AfUox, which has more free energy wells and dispersed global minima. These results indicated that TrUox has higher structural stability, which correlates with its enhanced thermal tolerance.