<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3-mathml3.dtd">
<article xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" dtd-version="1.3" article-type="research-article">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Microbiol.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Microbiol.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">1664-302X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fmicb.2025.1609598</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Modulation of viral replication, autophagy and apoptosis by induction and mutual regulation of transcription factors EB and E3 during coronavirus infection</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Yang</surname> <given-names>Bei</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &#x00026; editing</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Fung</surname> <given-names>To Sing</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &#x00026; editing</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Yuan</surname> <given-names>Lixia</given-names></name>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &#x00026; editing</role>
</contrib>
<contrib contrib-type="author">
<name><surname>Chen</surname> <given-names>Rui Ai</given-names></name>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &#x00026; editing</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology/">Methodology</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Liu</surname> <given-names>Ding Xiang</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>&#x0002A;</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation/">Investigation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision/">Supervision</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation/">Validation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization/">Visualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &#x00026; editing</role>
<uri xlink:href="https://loop.frontiersin.org/people/814999"/>
</contrib>
</contrib-group>
<aff id="aff1"><label>1</label><institution>Zhaoqing Branch Center of Guangdong Laboratory for Lingnan Modern Agricultural Science and Technology, Zhaoqing</institution>, <city>Guangdong</city>, <country country="cn">China</country></aff>
<aff id="aff2"><label>2</label><institution>Microbiology Research Centre, South China Agricultural University, Guangzhou</institution>, <city>Guangdong</city>, <country country="cn">China</country></aff>
<aff id="aff3"><label>3</label><institution>College of Veterinary Medicine, South China Agricultural University</institution>, <city>Guangzhou</city>, <country country="cn">China</country></aff>
<author-notes>
<corresp id="c001"><label>&#x0002A;</label>Correspondence: Ding Xiang Liu, <email xlink:href="mailto:dxliu0001@scau.edu.cn">dxliu0001@scau.edu.cn</email>; <email xlink:href="mailto:dxliu0001@163.com">dxliu0001@163.com</email></corresp>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2025-12-10">
<day>10</day>
<month>12</month>
<year>2025</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2025</year>
</pub-date>
<volume>16</volume>
<elocation-id>1609598</elocation-id>
<history>
<date date-type="received">
<day>10</day>
<month>04</month>
<year>2025</year>
</date>
<date date-type="rev-recd">
<day>12</day>
<month>11</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>24</day>
<month>11</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#x000A9; 2025 Yang, Fung, Yuan, Chen and Liu.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Yang, Fung, Yuan, Chen and Liu</copyright-holder>
<license>
<ali:license_ref start_date="2025-12-10">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<p>Viral invasion and replication in cells significantly impact lysosome structure and function. By sensing changes in the lysosome status, cascades of cellular responses are triggered to maintain lysosomal homeostasis. Two key regulators, transcription factors EB (TFEB) and E3 (TFE3), play essential regulatory roles in these processes by shuttling between the cytoplasm and the nucleus. In this study, we report that infection of cells and/or chickens by gammacoronavirus infectious bronchitis virus (IBV), human betacoronavirus OC43 (HCoV-OC43), and alphacoronavirus porcine epidemic diarrhea virus (PEDV) upregulates the expression of TFEB/TFE3 as well as their downstream targets, and induces the lysosomal stress response. Knockdown of TFE3 alone or together with TFEB demonstrated a pronounced role played by TFE3 in regulating viral replication, virus-induced autophagy and apoptosis in cells infected with the three viruses, and a synergistic effect of TFEB and TFE3 in cells infected with IBV and HCoV-OC43. Furthermore, inhibition of the biosynthetic secretory pathway with brefeldin A (BFA) demonstrated that the release of HCoV-OC43 is mainly via the lysosomal pathway. This study provides novel insights into the functional roles of the lysosomal biogenesis and stress response in coronavirus replication and virus-host interactions.</p></abstract>
<kwd-group>
<kwd>coronaviruses</kwd>
<kwd>lysosomal stress response</kwd>
<kwd>TFEB</kwd>
<kwd>TFE3</kwd>
<kwd>apoptosis</kwd>
</kwd-group>
<funding-group>
 <funding-statement>The author(s) declare that financial support was received for the research and/or publication of this article. This work was partially supported by the National Natural Science Foundation of China (grant number 32170152), Guangdong Basic and Applied Basic Research Foundation of China (grant number 2024A1515012930), and Zhaoqing Xijiang Innovative Team Foundation of China (grant numbers P20211154-0201 and P20211154-0202).</funding-statement>
</funding-group>
<counts>
<fig-count count="7"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="33"/>
<page-count count="15"/>
<word-count count="8935"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Virology</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="s1">
<title>Introduction</title>
<p>Coronaviruses are a class of single-stranded, plus-sense and enveloped RNA viruses that mainly cause respiratory and digestive tract diseases, in various hosts including humans, other mammals (cats, pigs, mice and cattle), poultry and birds (<xref ref-type="bibr" rid="B4">Fung and Liu, 2019a</xref>). Similar to other eukaryotic viruses, coronavirus entry into and replication in host cells cause a variety of host cell stress responses, playing essential regulatory roles in viral replication, pathogenesis and cellular responses to viral infection. By sensing changes in the intra- and extracellular environments, including nutrient levels and pathogen invasion, lysosomes upregulate stress-related gene expression, enabling cellular adaptation and the restoration of homeostasis. This process, known as lysosomal stress response (<xref ref-type="bibr" rid="B22">Saftig and Puertollano, 2021</xref>), is mainly mediated by microphthalmia/transcription factor E (MiTF/TFE). Under stress, MiT/TFE members are activated to coordinate the initiation of multiple stress response pathways, promoting the clearance of damaged macromolecules and organelles, maintaining cell function, and ultimately restoring cell homeostasis.</p>
<p>The lysosomal stress response is mediated by MiTF/TFE transcription factors, and the activation mechanisms of transcription factors EB (TFEB) and E3 (TFE3) have been extensively studied (<xref ref-type="bibr" rid="B19">Raben and Puertollano, 2016</xref>). Under physiological conditions, mTORC1 phosphorylates TFEB/TFE3 so that it binds to chaperone protein 14-3-3 and lingers in the cytoplasm. TFEB/TFE3 can also be phosphorylated by a variety of other kinases, including extracellular regulated protein kinases (ERK), glycogen synthase kinase 3&#x003B2; (GSK3&#x003B2;), protein kinase B (Akt) and protein kinase C (PKC), in different cellular signaling pathways (<xref ref-type="bibr" rid="B18">Puertollano et al., 2018</xref>). Dephosphorylation and nuclear translocation of TFEB/TFE3 can be triggered by inactivation of mTORC1 and/or activation of calcineurin/protein phosphatase 2A during starvation and cellular stress (<xref ref-type="bibr" rid="B13">Martina and Puertollano, 2018</xref>). Subsequent binding of the nuclear TFEB/TFE3 to the promoters of genes containing the coordinated lysosome expression and regulation (CLEAR) network sequences would transcriptionally activate autophagy and lysosomal target genes, and regulate apoptosis (<xref ref-type="bibr" rid="B19">Raben and Puertollano, 2016</xref>). Although TFEB and TFE3 are highly similar in amino acid sequence and play similar or even overlapping roles in lysosomal biogenesis and stress response, they may also play distinct regulatory roles in different signaling pathways. One example is that TFEB (but not TFE3) can be specifically phosphorylated by GSK3&#x003B2; in the PKC-GSK3&#x003B2; signaling cascade, differentiating the functional role of TFEB and TFE3 in the lysosomal biogenesis in certain circumstances (<xref ref-type="bibr" rid="B8">Li et al., 2016</xref>).</p>
<p>Recent studies have shown that the structure and function of lysosomes are closely related to viral replication, playing particularly important roles in viral invasion of cells and particle release during coronavirus infection. A prerequisite for coronavirus entry into cells is to activate the S protein by protease-mediated cleavage into S1 and S2 subunits before it would be able to mediate viral and cellular membrane fusion (<xref ref-type="bibr" rid="B4">Fung and Liu, 2019a</xref>). In addition to direct entry into cells after activation by transmembrane protease serines (TMPRSS2) on the plasma membrane, most coronaviruses enter the endosomal pathway via endocytosis followed by activation of S protein by lysosomal cathepsin L/B, mediating membrane fusion (<xref ref-type="bibr" rid="B17">Pi&#x00161;lar et al., 2020</xref>). Recent studies have also shown that the release of betacoronavirus particles is mainly through the lysosomal pathway, a process markedly different from other enveloped viruses that utilize the normal cellular secretory pathway (<xref ref-type="bibr" rid="B6">Ghosh et al., 2020</xref>).</p>
<p>In this study, we report the upregulation of TFEB and TFE3 in cells infected with avian gammacoronavirus infectious bronchitis virus (IBV), human betacoronavirus-OC43 (HCoV-OC43), and alphacoronavirus porcine epidemic diarrhea virus (PEDV), respectively. Characterization of the functional roles of TFEB and TFE3 in cells infected with these viruses suggests that these two key molecules play important regulatory roles in viral replication, autophagy and apoptosis. In addition, the lysosomal pathway is exploited by HCoV-OC43 in the release of mature virions during their replication cycles. This study provides novel insights into the functional roles of the lysosomal stress response and lysosomal biogenesis in coronavirus-host interactions.</p></sec>
<sec id="s2">
<title>Material and method</title>
<sec>
<title>Cell culture, SPF chickens and virus</title>
<p>HeLa, HEK293T and Vero cells were cultured in Dulbecco&#x00027;s modified Eagle&#x00027;s medium (DMEM, Life Technologies, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 mg/ml streptomycin (Gibco, Grand Island, NY, USA). H1299 cells were cultured in RPMI 1640 medium (Gibco) supplemented with 8% fetal bovine serum (FBS), and 100 U/ml penicillin and 100 mg/ml streptomycin (Gibco). All cells were grown in a 37 &#x000B0;C incubator supplied with 5% CO<sub>2</sub>.</p>
<p>White Leghorn specific-pathogen-free (SPF) chicks (one-day-old) were obtained from the SPF Experimental Animal Center of Xinxing Dahua Agricultural, Poultry and Egg Co., Ltd. (Xinxing, China), with approved number: SCXK (Guangzhou, China) 2018-0019. The SPF chicks were raised in individually ventilated cages within the SPF animal house of Zhaoqing Dahuanong Biology Medicine Co., Ltd. (Zhaoqing, China).</p>
<p>The egg-adapted Beaudette strain of IBV (ATCC VR-22) was obtained from the American Type Culture Collection (ATCC) and adapted to Vero cells as previously described (<xref ref-type="bibr" rid="B10">Lim and Liu, 1998</xref>; <xref ref-type="bibr" rid="B24">Shen et al., 2003</xref>). This Vero-adapted strain was named IBV-p65 (GenBank accession No. DQ001339; <xref ref-type="bibr" rid="B2">Fang et al., 2005</xref>). HCoV-OC43 (GenBank accession No. KU131570.1; <xref ref-type="bibr" rid="B14">Morfopoulou et al., 2016</xref>) were also obtained from ATCC. PEDV virulent strain DR13 (PEDV-vDR13) was isolated in Korea in 1999 (GenBank accession No. JQ023162) as previously reported (<xref ref-type="bibr" rid="B15">Park et al., 2012</xref>).</p>
<p>Virus stock was prepared by infecting monolayers of Vero or H1299 cells at a multiplicity of infection (MOI) of approximately 0.1 and cultured in DMEM at 37 &#x000B0;C for 24 h. After three freeze-thaw cycles, total cell lysates were clarified by centrifugation at 1,500 g at 4 &#x000B0;C for 30 min. The supernatant was aliquoted and stored at &#x02212;80 &#x000B0;C as a virus stock.</p>
<p>The titers of the virus stocks were determined by 50% tissue culture infective dose (TCID50) assay. IBV, PEDV, and HCoV-OC43 stocks were used for infection of cells at an MOI of &#x0007E;2 in all experiments, and the mock control was incubated with same amounts of a UV-inactivated virus as previously described (<xref ref-type="bibr" rid="B33">Yuan et al., 2021</xref>). Virus infection was carried out by incubation of cells with a virus stock for about 2 h, washing twice with PBS to remove the unbound viruses, and further incubation for the indicated times in each experiment after addition of fresh medium.</p></sec>
<sec>
<title>Antibodies, chemicals, and reagents</title>
<p>Anti-&#x003B2;-actin (catalog number HC201-01), Anti-&#x003B2;-tubulin (catalog number HC101-01), Anti-Histone H3 (catalog number HL102-01) and anti-DYKDDDDK (catalog number HT201-01) were purchased from TransGen Biotech (Beijing, China). Anti-TFEB (catalog number37785), anti-TFE3 (catalog number14779S), and anti-PARP (catalog number 9532) were purchased from Cell Signaling Technology (CST, Boston, MA, USA). Polyclonal antibodies against IBV N, M and S proteins were prepared from rabbits immunized with bacterially expressed fusion proteins as previously described (<xref ref-type="bibr" rid="B33">Yuan et al., 2021</xref>). Anti-OC43 N was purchased from Sinobiological (Beijing, China).</p>
<p>Nuclear and cytoplasmic protein extraction kit (catalog number P0028) was purchased from Beyotime (Shanghai, China). Brefeldin A (catalog number S7046) was purchased from Selleck (Houston, TX, USA).</p></sec>
<sec>
<title>Plasmid construction and transfection</title>
<p>Complementary DNA (cDNA) for human TFEB (NM_007162) and TFE3 (NM_006521) were amplified from total RNA extracted from H1299 cells by reverse transcription-PCR (RT-PCR), using appropriate primer pairs listed in <xref ref-type="table" rid="T1">Table 1</xref>. Chicken TFEB cDNA (NM_001030922.1) was amplified from RNA extracted from chicken tissue using appropriate primer pair listed in <xref ref-type="table" rid="T1">Table 1</xref>. These PCR products were inserted into pXJ40-Flag linearized with <italic>BamH</italic>I and <italic>Pst</italic>I by homologous recombination, and were named pXJ40-Flag-TFEB, pXJ40-Flag-TFE3 and pXJ40-Flag-TFEB(CHK), respectively.</p>
<table-wrap position="float" id="T1">
<label>Table 1</label>
<caption><p>Primers for construction plasmid and RT-qPCR.</p></caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th valign="top" align="left"><bold>Primers</bold></th>
<th valign="top" align="left"><bold>Sequences(5<sup>&#x02032;</sup>-3<sup>&#x02032;</sup>)</bold></th>
<th valign="top" align="left"><bold>Note</bold></th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Human TFEB</td>
<td valign="top" align="left">F:<bold>CGATGATAAGTCCGGATCC</bold>GCGTCACGCATAGGGTTG</td>
<td valign="top" align="left">Construction of pXJ40-Flag-TFEB</td>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:<bold>AAGATCTGGTACCGAGCTCCTGCAG</bold>TCACAGCACATCGCCCTC.</td>
<td/>
</tr>
<tr>
<td valign="top" align="left">Human TFE3</td>
<td valign="top" align="left">F:<bold>CGATGATAAGTCCGGATCC</bold>TCTCATGCGGCCGAACCAG</td>
<td valign="top" align="left">Construction of pXJ40-Flag-TFE3</td>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:<bold>AAGATCTGGTACCGAGCTCCTGCAG</bold>TCAGGACTCCTCTTCCATGCTGAAGC</td>
<td/>
</tr>
<tr>
<td valign="top" align="left">Chicken TFEB</td>
<td valign="top" align="left">F:<bold>CGATGATAAGTCCGGATCC</bold>G CGTCCCGCATCGGGCTG</td>
<td valign="top" align="left">Construction of pXJ40-Flag-TFEB(CHK)</td>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:<bold>AAGATCTGGTACCGAGCTCCTGCAG</bold>TCACAGCATGTCTGC GTCCTCC</td>
<td/>
</tr>
<tr>
<td valign="top" align="left">Human-GAPDH</td>
<td valign="top" align="left">F:CTGGGCTACACTGAGCACC</td>
<td valign="top" align="left">RT-qPCR</td>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:AAG TGGTCGTTGAGGGCAATG</td>
<td/>
</tr>
 <tr>
<td valign="top" align="left">IBV gRNA</td>
<td valign="top" align="left">F:GTTCTCGCATAAGGTCGGCTA</td>
<td/>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:GCTCACTAAA CACCACCAGAAC</td>
<td/>
</tr>
 <tr>
<td valign="top" align="left">Human-SQSTM1</td>
<td valign="top" align="left">F:CAACATGGTGCACCCCAATGT</td>
<td/>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:CGCTACACAAG TCGTAGTCTGG</td>
<td/>
</tr>
 <tr>
<td valign="top" align="left">Human-TFEB</td>
<td valign="top" align="left">F:CAAGGCCAATGACCTGGAC</td>
<td/>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:AGCTCCCTGGACTTTT</td>
<td/>
</tr>
 <tr>
<td valign="top" align="left">Human-TFE3</td>
<td valign="top" align="left">F:GCTGCTTTCCTTGGC</td>
<td/>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:ATCTGAGGGCGGTGC</td>
<td/>
</tr>
 <tr>
<td valign="top" align="left">Human-M6PR</td>
<td valign="top" align="left">F:CTCAGTGTGGGTTCCATCTTAC</td>
<td/>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:GGGAAACTGCTCCATTCCTT</td>
<td/>
</tr>
 <tr>
<td valign="top" align="left">Human-CTSB</td>
<td valign="top" align="left">F:GGACAAGC ACTACGGATACAA</td>
<td/>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:GTAGAGCAGGAAGTCCGAATAC</td>
<td/>
</tr>
 <tr>
<td valign="top" align="left">Human-RAB7A</td>
<td valign="top" align="left">F:CCTGGAGTCTT GGCCATAAAG</td>
<td/>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:GAGAAGGTCCAAGTTCTGGTTC</td>
<td/>
</tr>
 <tr>
<td valign="top" align="left">Human-MCOLN1</td>
<td valign="top" align="left">F:GGAAAGCAGCT CCAGTTACA</td>
<td/>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:GATGAGGCTCTGGAGGTTAATG</td>
<td/>
</tr>
 <tr>
<td valign="top" align="left">Human-ATP6V1H</td>
<td valign="top" align="left">F:CCCTGAAGAGAAGCAAGAGATG</td>
<td/>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:TGCAGCATATCATCCACCATAG</td>
<td/>
</tr>
 <tr>
<td valign="top" align="left">Human-CHOP</td>
<td valign="top" align="left">F:GGAAACAGAGTGGTC ATTCCC</td>
<td/>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:CTGCTTGAGCCGTTCATTCTC</td>
<td/>
</tr>
 <tr>
<td valign="top" align="left">Chicken-CTSB</td>
<td valign="top" align="left">F:GCACTACGGCATCACATCCT</td>
<td/>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:AACCTGCTCCCCTGACACAT</td>
<td/>
</tr>
 <tr>
<td valign="top" align="left">Chicken-GAPDH</td>
<td valign="top" align="left">F:GACCACTGTCCATGCCATCA</td>
<td/>
</tr>
 <tr>
<td/>
<td valign="top" align="left">R:TTTCCCCACAGCCTTAGCAG</td>
<td/>
</tr></tbody>
</table>
<table-wrap-foot>
<p>Homologous sequences are indicated in bold.</p>
</table-wrap-foot>
</table-wrap>
<p>Plasmid DNA was transfected into cells using TransIntro EL transfection regent (Transgen biotech). Briefly, cells seeded on a 12-well plate were cultured overnight in medium containing 10% FBS, and transfection was performed when cells approached 60&#x02013;70% confluence, with 2 &#x003BC;g of plasmid DNA and 4 &#x003BC;L of TransIntro EL diluted each with 100 &#x003BC;L of Opti-MEM (Gibco). After mixing by brief vortex and further incubation for 15 min, the mixture was added to each cell well dropwise, and was replaced with normal fresh complete medium after incubation for 4&#x02013;6 h. At 24 h post-transfection, cells were infected with IBV and harvested at indicated time points for further analysis.</p></sec>
<sec>
<title>RNA extraction and RT-qPCR analysis</title>
<p>Total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Tissue samples were collected from various organs of chickens at 7 days post-infection (dpi) with IBV. Cell samples were harvested from HeLa or H1299 cells at different time points after infection with IBV, PEDV, or HCoV-OC43. Tissue samples (100 mg) were homogenized in 1 mL of TRIzol on ice, and cultured cells were directly lysed in the plate by adding 800 &#x003BC;L of TRIzol per well of a 12-well plat. The homogenate/lysate was transferred to a fresh tube, mixed with chloroform (0.2 mL per 1 mL TRIzol), and centrifuged (12,000 &#x000D7; g, 15 min, 4 &#x000B0;C) for phase separation. The aqueous phase was collected and RNA was precipitated with an equal volume of isopropanol, followed by centrifugation (12,000 &#x000D7; g, 10 min, 4 &#x000B0;C). The resulting RNA pellet was washed with 75% ethanol, air-dried, and finally dissolved in RNase-free water by incubation at 55&#x02013;60 &#x000B0;C to aid solubilization. RNA was reverse-transcribed using the 5 &#x000D7; FastKing gDNA dispelling RT SuperMix kit (Tiangen, Beijing, China) according to the manufacturers&#x00027; instructions.</p>
<p>The first-strand cDNA was diluted 20-fold with RNase-free water for quantitative PCR (qPCR) analysis using Talent qPCR PreMix SYBR green kit (Tiangen) with a QuantStudio 3 real-time PCR system (Applied Biosystems). The standard protocol included enzyme activation at 50 &#x000B0;C for 3 min and an initial denaturation step at 95 &#x000B0;C for 3 min, followed by 40 cycles of denaturation (95 &#x000B0;C for 5 s) and annealing/extension (60 &#x000B0;C for 30 s), with fluorescence acquisition at the end of each cycle. The results obtained were in the form of cycle threshold (CT) values. Using the &#x00394;&#x00394;CT method, the relative abundance of a transcript was calculated using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as internal control for normalization. All RT-qPCR data are presented as log2 fold change.</p>
<p>The sequences of the related primers are listed in <xref ref-type="table" rid="T1">Table 1</xref>.</p></sec>
<sec>
<title>Construction of stable knockdown cell clones and RNA interference</title>
<p>Lentivirus-based shRNA vector pLKO.1 was used to infect H1299 cells and the knockdown cell clones were screened with 2 &#x003BC;g/mL of puromycin. The sequences of the shRNA sense strands are ATTGTTGCTGACATAGAATTA for TFE3, and ACTACCGTTGTTATAGGTGT for negative control. The siRNA duplexes used for RNA interference were purchased from Sangon Biotech (Shanghai, China). The sequences of the siRNA sense strands are AGACGAAGGUUCAACAUCAdTdT for TFEB and GCUGACCCUGAAGUUCAUCdTdT for EGFP as the negative control. Transfection of siRNA was performed using the TransIntro EL transfection reagent (TransGen Biotech) as previously described (<xref ref-type="bibr" rid="B7">Li et al., 2022</xref>).</p></sec>
<sec>
<title>SDS-PAGE and Western blot analysis</title>
<p>The harvested cells were centrifuged (16,000 g, 4 &#x000B0;C, 3 min). The supernatant was mixed with 5 &#x000D7; sodium dodecylsulfate (SDS) loading buffer, and the pellet was lysed in RIPA buffer containing 5 &#x000D7; SDS loading buffer. All samples were subsequently denatured by heating at 95 &#x000B0;C for 5 min. After a short centrifugation, same amounts of protein samples were loaded into each well and separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The resolved proteins were then transferred to a 0.2 &#x003BC;m nitrocellulose membrane using the Bio-Rad Trans-Blot protein transfer system, the membrane was incubated with 5% skim milk in Tris-buffered saline&#x02013;Tween 20 (TBST) buffer [20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 0.1% Tween 20] at room temperature for 1&#x02013;2 h, washed with 1 &#x000D7; TBST three times, and incubated with a specific primary antibody dissolved in TBST with 3% (wt/vol) BSA at 4 &#x000B0;C overnight. After removal of the primary antibody and washing with 1 &#x000D7; TBST, the membrane was incubated with a 1:10,000-diluted appropriate secondary antibody at room temperature for 2 h. Fluorescence imaging was performed using the Azure c600 imager, and densitometric measurement was performed using AzureSpot software.</p>
<p>All experiments were repeated at least three times and one of the representative results is shown.</p></sec>
<sec>
<title>Nuclear and cytoplasmic protein extraction</title>
<p>HeLa cells infected with IBV were collected at 2, 4, 8, 16, and 20 h post-infection (hpi) by washing once with PBS followed by scraping. Nuclear and cytoplasmic proteins were extracted using the nuclear and cytoplasmic protein extraction kit (Beyotime) and then denatured by adding 5 &#x000D7; SDS loading dye and heating at 95 &#x000B0;C for 3&#x02013;5 min. The denatured proteins were subsequently separated by SDS-PAGE and analyzed by Western blot. Anti-&#x003B2;-tubulin and Anti-Histone H3 antibodies were used as markers for the cytoplasmic and nuclear fractions, respectively.</p></sec>
<sec>
<title>Cell viability assay</title>
<p>Cell proliferation experiments were performed using TransDetect Cell Counting Kit (CCK, TransGen Biotech, Beijing, China). Cells were placed in 96-well plates with 5 &#x000D7; 10<sup>3</sup> cells in 100 &#x003BC;L per well and incubated overnight, 10 &#x003BC;L of CCK Solution were added. After incubation for 2&#x02013;4 h, the absorbance at 450 nm was measured by spectrometry in tetraplicate per cell clone.</p></sec>
<sec>
<title>Infection of chickens with IBV</title>
<p>One-day-old SPF chickens were randomly divided into two groups (<italic>n</italic> = 5/group), one group infected with (&#x0007E;105.5 EID50) KP-GI-19, a local IBV isolate of G1&#x02013;19 genotype (<xref ref-type="bibr" rid="B29">Xiong et al., 2024</xref>), by the nasal&#x02013;ocular route. The remaining five chickens were infected with the same volume of PBS as control. All chickens were euthanized at 7 days post-inoculation for pathological autopsy and examination of lesions in all organs. Total RNA extracted from each organ was collected for RT-qPCR, and the expression levels of IBV-gRNA and cathepsin B (CTSB) in all chicks were detected.</p></sec>
<sec>
<title>Inhibition of the biosynthetic secretory pathway by BFA</title>
<p>The appropriate working concentration of BFA (without affecting cellular metabolic activity) was determined by evaluating its impact on cell proliferation. As 2&#x02013;5 &#x003BC;g/mL concentrations were commonly used in previous studies, H1299-shNC and H1299-shTFE3 cell lines were treated with 0, 2.5, 5, 8, and 10 &#x003BC;g/mL of BFA for 20 h. Cell viability was measured and 5 &#x003BC;g/mL BFA was selected as the highest concentration of BFA that did not significantly affect the proliferation rates of the treated cells across the tested concentration range. H1299-shNC and H1299-shTFE3 cells were treated with 5 &#x003BC;g/mL of BFA and infected with IBV, PEDV, and HCoV-OC43, respectively, after reaching 90&#x02013;100% confluence. At 10 hpi, the medium was replaced with fresh medium containing 5 &#x003BC;g/mL BFA. Cells and culture supernatants were collected at designated time points post-infection, and the supernatant was centrifuged at 12,000 rpm for 10 min at 4 &#x000B0;C to remove cellular debris. Both cell pellets and clarified supernatants were analyzed by Western blot to detect intracellular and extracellular viral proteins, and the absence of viral proteins in the supernatant would suggest that viral particle release depends on the biosynthetic secretory pathway.</p></sec>
<sec>
<title>Statistical analysis</title>
<p>One-way analysis of variance (ANOVA) was used to analyze significant differences between the indicated samples and the respective control samples. Significance levels are presented by the <italic>P</italic> value (ns, non-significant; <sup>&#x0002A;</sup><italic>P</italic> &#x0003C; 0.05; <sup>&#x0002A;&#x0002A;</sup><italic>P</italic> &#x0003C; 0.01; <sup>&#x0002A;&#x0002A;&#x0002A;</sup><italic>P</italic> &#x0003C; 0.001).</p></sec></sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec>
<title>IBV infection stimulates the nuclear translocation of TFEB and TFE3</title>
<p>The functional effect of IBV infection on TFEB/TFE3 was first assessed by isolating cytoplasmic and nuclear proteins from IBV-infected HeLa cells at different time points post-infection. Western blot analysis revealed that following IBV infection, TFE3 protein was detected in the cytoplasm at 2, 4, and 8 hpi. Starting from 16 hpi, the cytoplasmic TFE3 level decreased, as the majority of the protein translocated to the nucleus. By 20 hpi, TFE3 was almost completely localized to the nucleus (<xref ref-type="fig" rid="F1">Figure 1A</xref>). By constructing and utilizing a lysosomal stress reporting system, a HeLa cell clone stably expressing TFEB-EGFP, the distribution of green fluorescence was observed by fluorescence microscopy at 8 and 24 hpi, respectively, and the percentages of cells with the nuclear translocation of TFEB-EGFP were calculated (<xref ref-type="fig" rid="F1">Figures 1B</xref>, <xref ref-type="fig" rid="F1">C</xref>). In cells incubated with UV-inactivated virus, only approximately 5% of cells were found to show the nuclear translocation of TFEB-EGFP. On the contrary, over 90% of IBV-infected cells were shown to have TFEB-EGFP translocated to the nucleus (<xref ref-type="fig" rid="F1">Figures 1B</xref>, <xref ref-type="fig" rid="F1">C</xref>). These results demonstrate that IBV infection indeed induces the nuclear translocation of TFEB and TFE3.</p>
<fig position="float" id="F1">
<label>Figure 1</label>
<caption><p>Stimulation of the nuclear translocation of TFEB and TFE3 by IBV infection. <bold>(A)</bold> HeLa cells were infected with IBV at an MOI&#x0007E;2 and harvested at indicated times post-infection. Nuclear and cytosolic fractions were prepared and subjected to Western blotting with the indicated antibodies. Beta-actin was included as the loading control. <bold>(B)</bold> HeLa cells stably expressing TFEB-EGFP were infected with IBV at an MOI&#x0007E;2 or mock-treated with UV-inactivated IBV, nuclear stained with Hoechst 33342 at 8 and 24 hpi, respectively, and examined by fluorescence microscopy. The merged images show the nuclear colocalization of TFEB. Scale: 75 &#x003BC;m. <bold>(C)</bold> The percentages of cells with the nuclear translocation of TFEB-EGFP in IBV-infected and mock-treated HeLa cells as presented in <bold>(B)</bold> (<italic>n</italic> = 3 independent experiments). &#x0002A;&#x0002A;<italic>P</italic> &#x0003C; 0.01; &#x0002A;&#x0002A;&#x0002A;<italic>P</italic> &#x0003C; 0.001.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-16-1609598-g0001.tif">
<alt-text content-type="machine-generated">Western blot and fluorescence microscopy demonstrate the effects of IBV infection over time. Panel A shows Western blot results illustrating TFE3, tubulin, and H3 levels in cytoplasm and nucleus at varying hours of infection. Panel B presents fluorescence microscopy images with Hoechst 33342 and TFEB-GFP labeling, comparing UV to IBV-treated cells at different time points. Panel C is a bar graph indicating percentage of TFEB nuclear translocation, with a significant increase after twenty-four hours of IBV infection compared to UV treatment.</alt-text>
</graphic>
</fig></sec>
<sec>
<title>The expression of TFEB/TFE3 and target genes is induced by virus infection of culture cells and chicks</title>
<p>To test if the IBV-induced TFEB/TFE3 nuclear translocation activates the lysosomal stress response and up-regulates the expression of downstream genes, time-course experiments were conducted in H1299 and HeLa cells infected with IBV, and the expression of the downstream genes was analyzed by Western blot and RT-qPCR. Cell starvation can also inactivate mTORC1, resulting in TFEB/TFE3 dephosphorylation from 14-3-3 and nuclear translocation. To exclude this effect, protein and RNA samples were harvested from cells treated with UV-inactivated IBV and infected with IBV, respectively, in the early (8 hpi) and late (20 hpi) stages of the IBV infection cycle. We first observed that the protein level of TFE3 in IBV-infected cells was upregulated at both time points, compared with that in cells treated with UV-inactivated IBV, demonstrating that IBV infection of cells indeed upregulated the expression of TFE3 (<xref ref-type="fig" rid="F2">Figure 2A</xref>).</p>
<fig position="float" id="F2">
<label>Figure 2</label>
<caption><p>Induction of TFEB/TFE3 and target genes by virus infection of culture cells and chicks. <bold>(A)</bold> H1299 cells were infected with IBV at MOI&#x0007E;2 or mock-treated with UV-inactivated IBV and harvested at the indicated time points. Total cell lysates were prepared and subjected to Western blot analysis with indicated antibodies. <bold>(B)</bold> H1299 cells were infected and harvested as described in <bold>(A)</bold>. Total RNAs were extracted, the level of IBV genomic RNA (gRNA), and mRNA levels of TFEB, TFE3 and downstream target genes CTSB, RAB7A and M6PR were determined by RT-qPCR with the &#x00394;&#x00394;CT method after normalization to the GAPDH mRNA in cells treated with UV-inactivated IBV. <bold>(C)</bold> HeLa cells were infected with IBV at MOI&#x0007E;2 or mock-treated with UV-inactivated IBV and harvested at the indicated time points. Total cell lysates were prepared and subjected to Western blot analysis with indicated antibodies. <bold>(D)</bold> HeLa cells were infected and harvested as described in A. Total RNAs were extracted, the level of IBV gRNA, and mRNA levels of TFEB, TFE3 and downstream target genes CTSB, RAB7A and M6PR were determined by RT-qPCR with the &#x00394;&#x00394;CT method after normalization to the GAPDH mRNA in cells treated with UV-inactivated IBV. <bold>(E)</bold> One-day-old SPF chickens were either infected with a local isolate of IBV strain (KP-G1-19, a G1-19 genotype), or injected with PBS as negative control. At 7 days post-infection, trachea, kidney, heart, lung and liver were collected and total RNA extracted. The levels of IBV gRNA and CTSB mRNA in each organ were detected by RT-qPCR with the &#x00394;&#x00394;CT method using GADPH from the PBS-injected groups as the standard (ns, non-significant; &#x0002A;<italic>p</italic> &#x0003C; 0.05; &#x0002A;&#x0002A;<italic>p</italic> &#x0003C; 0.01; &#x0002A;&#x0002A;&#x0002A;<italic>p</italic> &#x0003C; 0.001).</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-16-1609598-g0002.tif">
<alt-text content-type="machine-generated">Western blot and bar graph images show protein and mRNA changes in cells and chick tissues infected with IBV over time. Panels A and C display TFE3, IBV N, and actin in H1299 and HeLa cells. B and D show mRNA fold changes for different genes in these cells. E presents mRNA fold changes in chick tissues, indicating significant variances, marked by asterisks, in various organs following IBV infection.</alt-text>
</graphic>
</fig>
<p>To investigate if IBV-induced nuclear translocation of TFEB/TFE3 activates the CLEAR network, three downstream gene targets, CTSB encoding a lysosomal cysteine protease, RAB7A (member of RAS oncogene family) encoding an endolysosomal trafficking small GTPase, and M6PR (mannose-6-phosphate receptor, cation dependent), were analyzed by RT-qPCR. The expression of these three lysosome-related genes was upregulated with increase of infection time in IBV-infected H1299 cells (<xref ref-type="fig" rid="F2">Figure 2B</xref>). A similar result was also obtained in IBV-infected HeLa cells (<xref ref-type="fig" rid="F2">Figures 2C</xref>, <xref ref-type="fig" rid="F2">D</xref>).</p>
<p>To reflect the results under physiological conditions in living birds, the expression levels of IBV-gRNA and CTSB in different organs from chickens infected with IBV strain KP-GI-19 were analyzed by RT-qPCR. As shown in <xref ref-type="fig" rid="F2">Figure 2E</xref>, the mRNA level of CTSB gene in the trachea, kidney, heart and lung from infected chicks was significantly up-regulated, compared with that in the control group. Among these organs, the highest is in trachea, with about 25-fold upregulation (<xref ref-type="fig" rid="F2">Figure 2E</xref>). Taken together, these results confirm the induction of lysosomal stress response by IBV infection of culture cells and chickens under experimental conditions.</p></sec>
<sec>
<title>Lysosomal stress response is also induced in culture cells infected with two other coronaviruses</title>
<p>To investigate if the lysosomal stress response was also induced in cells infected with other coronaviruses, protein and RNA samples were collected at 6, 12, 48, and 60 hpi with HCoV-OC43, and at 4, 12, 24, 36, and 60 hpi with PEDV for subsequent Western blot and RT-qPCR analyses. At the protein level, TFE3 was upregulated along with increased detection of coronaviral N protein in the time-course experiments (<xref ref-type="fig" rid="F3">Figure 3A</xref>). At the mRNA level, TFEB, TFE3 and lysosomal target genes MCOLN1, CTSB and RAB7A were also upregulated to varying degrees (<xref ref-type="fig" rid="F3">Figure 3B</xref>). These results confirm the induction of lysosomal stress response in cells infected with these two coronaviruses. The upregulation of these gene expression at varying levels and at different time points of their infection cycles may reflect distinct characteristics of the replication and infection kinetics of individual viruses.</p>
<fig position="float" id="F3">
<label>Figure 3</label>
<caption><p>Induction of lysosomal stress response in culture cells infected with HCoV-OC43 and PEDV. <bold>(A)</bold> H1299 cells were infected with HCoV-OC43 and PEDV, respectively, at an MOI&#x0007E;2 or mock-treated with UV-inactivated viruses. Cells were harvested at the indicated time points and subjected to Western blot analysis using the indicated antibodies. Beta-actin was included as the loading control. <bold>(B)</bold> Total RNA samples were extracted from cells in <bold>(A)</bold> and subjected to RT-qPCR. The levels of TFEB, TFE3, MCOLN1, CTSB, and RAB7A were determined by the &#x00394;&#x00394;CT method after normalization to the GAPDH mRNA level in cells treated with the corresponding UV-inactivated virus.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-16-1609598-g0003.tif">
<alt-text content-type="machine-generated">Panel A shows Western blot analyses of protein levels in H1299 cells infected with OC43 and PEDV viruses over time, with markers at 75 and 50 kilodaltons. Panel B presents line graphs of mRNA fold change for TFEB, TFE3, MCOLN1, CTSB, and RAB7A over time in H1299 cells infected with OC43 and PEDV. Each graph indicates an increase in mRNA levels at different hours post-infection.</alt-text>
</graphic>
</fig></sec>
<sec>
<title>Inhibition of IBV replication by TFEB/TFE3</title>
<p>To directly investigate if TFE3 and TFEB are functionally involved in the regulation of coronavirus replication, an H1299 cell clone with stable TFE3-knockdown (H1299-shTFE3 cells) with the knockdown efficiency of about 70% was constructed (<xref ref-type="fig" rid="F4">Figures 4A</xref>, <xref ref-type="fig" rid="F4">B</xref>). The stable cell clone showed a slightly but significantly reduced cell proliferation rate, as detected by CCK8 (<xref ref-type="fig" rid="F4">Figure 4C</xref>). Simultaneous knockdown of TFEB in this cell clone was also carried out with small interfering RNA (siRNA), achieving a knockdown efficiency of about 90% (<xref ref-type="fig" rid="F4">Figure 4E</xref>). Infection of the knockdown cells with IBV showed that knockdown of TFE3 facilitated IBV replication, and a similar trend effect was observed when both TFEB and TFE3 were simultaneously knocked down, as revealed by Western blot analysis of IBV N protein (<xref ref-type="fig" rid="F4">Figure 4D</xref>), and RT-qPCR analysis of viral genomic RNA in knockdown and control cells (<xref ref-type="fig" rid="F4">Figure 4E</xref>).</p>
<fig position="float" id="F4">
<label>Figure 4</label>
<caption><p>Regulation of viral replication by TFEB and TFE3 during IBV infection. <bold>(A)</bold> A stable H1299-shTFE3 cell clone was established as described in Material and Method section. The knockdown efficiency was assessed by Western blot using antibodies specific for TFE3. Beta-actin was included as the loading control. <bold>(B)</bold> The knockdown efficiency in stable H1299-shTFE3 cell clone described in <bold>(A)</bold> was assessed by RT-qPCR at the mRNA level. TFE3 mRNA level was determined by &#x00394;&#x00394;CT method after normalization to GADPH in shNC cells (&#x0002A;&#x0002A;&#x0002A;<italic>p</italic> &#x0003C; 0.001). <bold>(C)</bold> The cell proliferation of stable TFE3-knockdown H1299 cell clones described in <bold>(A)</bold> was assessed by CCK8 (&#x0002A;&#x0002A;<italic>p</italic> &#x0003C; 0.01). <bold>(D)</bold> The stable H1299-shTFE3 cells were either directly infected with IBV at an MOI&#x0007E;2 or transfected with the indicated siRNA 24 h prior to viral infection. Cells and culture supernatants were harvested separately and subjected to Western blot using the indicated antibodies. <bold>(E)</bold> The stable H1299-shTFE3 cells were transfected with the indicated siRNA, infected with IBV at an MOI&#x0007E;2 and harvested at the indicated time points. Total RNA was extracted and mRNA levels of TFEB and IBV gRNA were determined by RT-qPCR (ns, non-significant; &#x0002A;<italic>p</italic> &#x0003C; 0.05; &#x0002A;&#x0002A;<italic>p</italic> &#x0003C; 0.01; &#x0002A;&#x0002A;&#x0002A;<italic>p</italic> &#x0003C; 0.001). <bold>(F)</bold> Effects of TFEB and/or TFE3 overexpression on the replication of IBV. H1299 cells were transfected with pXJ40-Flag, pXJ40-Flag-TFEB, pXJ40-Flag-TFE3, and pXJ40-Flag-TFEB&#x0002B;pXJ40-Flag-TFE3, respectively. At 24 h post-transfection, cells were either infected with IBV at an MOI&#x0007E;2 or treated with UV-inactivated IBV, harvested at the indicated time points and subjected to Western blot analysis using the indicated antibodies. Beta-actin was included as the loading control.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-16-1609598-g0004.tif">
<alt-text content-type="machine-generated">Laboratory data image with multiple panels showing experiments related to TFE3 knockdown and its effects on IBV infection. Panel A shows a Western blot for TFE3 and actin, demonstrating knockdown efficiency. Panels B and C present bar graphs measuring TFE3 knockdown efficiency and cell viability, respectively. Panel D contains Western blots showing TFE3, IBV N, IBV S, and actin levels across different time points and treatment conditions. Panel E displays bar graphs of TFEB and IBV-gRNA mRNA fold change under various conditions. Panel F shows Western blots for TFEB, TFE3, IBV N, and actin, indicating time-dependent protein expression changes.</alt-text>
</graphic>
</fig>
<p>The effects of TFEB/TFE3 overexpression on IBV replication were then studied by cloning and overexpressing TFEB (mammalian) and TFE3 with an N-terminal Flag tag in H1299 (<xref ref-type="fig" rid="F4">Figure 4F</xref>) and TFEB (avian) in DF-1 cells (<xref ref-type="supplementary-material" rid="SM1">Supplementary Figure S1</xref>), respectively. Compared with the empty vector, overexpression of TFE3 had little effect on IBV replication, but overexpression of TFEB assuredly reduced viral protein synthesis in both H1299 (<xref ref-type="fig" rid="F4">Figure 4F</xref>) and DF-1 cells (<xref ref-type="supplementary-material" rid="SM1">Supplementary Figure S1</xref>). Coexpression of TFEB and TFE3 also reduced the expression of viral proteins, but at a less extent than that in cells overexpressing TFEB alone (<xref ref-type="fig" rid="F4">Figure 4F</xref>). In addition to the possibility that this Flag-tagged TFE3 may be functional inactive but may act as a dominant negative regulator, the induction of the endogenous TFE3 expression at high levels in the infected cells may offset the functional effect of the overexpressed TFE3.</p></sec>
<sec>
<title>Regulation of viral replication, autophagy and apoptosis by TFEB/TFE3 in cells infected with IBV, HCoV-OC43, and PEDV</title>
<p>The involvement of TFEB/TFE3 in IBV-induced autophagy was subsequently studied. We analyzed the mRNA level of SQSTM1/p62, an autophagy substrate that is also a transcriptional target of the autophagy-lysosomal pathway. Upon IBV infection, SQSTM1/p62 expression was upregulated in a time-dependent manner in all experimental groups relative to the UV-inactivated virus control. This is consistent with our previous report that IBV infection indeed induces autophagy (<xref ref-type="bibr" rid="B5">Fung and Liu, 2019b</xref>). In the knockdown cells infected with IBV, the induction level of SQSTM1 was significantly lower, compared with those in the control group, when TFE3 was knocked down alone or together with TFEB (<xref ref-type="fig" rid="F5">Figure 5A</xref>). These results demonstrate that upregulation of TFEB/TFE3 expression during IBV infection may be a strategy exploited by this virus to induce autophagy and regulate viral replication.</p>
<fig position="float" id="F5">
<label>Figure 5</label>
<caption><p>Regulation of autophagy and apoptosis by TFEB and TFE3 during IBV infection. <bold>(A)</bold> Total RNA was extracted from IBV-infected stable H1299-shTFE3 cells described in <xref ref-type="fig" rid="F4">Figure 4</xref> and mRNA levels of SQSTM1 and CHOP were determined by RT-qPCR (ns, non-significant; &#x0002A;<italic>p</italic> &#x0003C; 0.05; &#x0002A;&#x0002A;<italic>p</italic> &#x0003C; 0.01; &#x0002A;&#x0002A;&#x0002A;<italic>p</italic> &#x0003C; 0.001). <bold>(B)</bold> Western blot analysis of the total cell lysates prepared from IBV-infected stable H1299-shTFE3 cells described in <bold>(A)</bold> using antibodies against PARP. The percentage of PARP cleavage [PARP Clv. (%)] was shown as the intensity of cleaved PARP (Cl) divided by the total intensities of the full-length PARP (FL) &#x0002B; Cl.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-16-1609598-g0005.tif">
<alt-text content-type="machine-generated">Bar graphs and a Western blot image depict the effects of various treatments on SQSTM1 and CHOP mRNA levels and protein expression. Graphs show fold change over time with statistical significance indicated. Western blot displays protein bands under different conditions of IBV infection and UV treatment, with intensity values and conditions described below.</alt-text>
</graphic>
</fig>
<p>To evaluate the effect of TFEB/TFE3 knockdown on IBV-induced apoptosis, we monitored the cleavage of poly(ADP-ribose) polymerase (PARP), a well-established apoptosis marker. IBV-infected cells with double knockdown of TFEB and TFE3 exhibited a conspicuously reduced level of PARP cleavage compared to TFE3 single-knockdown cells at 12 and 20 hpi (<xref ref-type="fig" rid="F5">Figure 5B</xref>). This result underscores the essential role of both transcription factors in regulating IBV-induced apoptosis.</p>
<p>CHOP, also known as GADD153, is a transcription factor that regulates genes involved in the apoptotic pathway. Previous studies have demonstrated that IBV infection activates the eIF2&#x003B1;-ATF4-CHOP axis, wherein the upregulation of the pro-apoptotic protein CHOP is critical for virus-induced apoptosis (<xref ref-type="bibr" rid="B9">Liao et al., 2013</xref>). In a ChIP-seq analysis, CHOP and PUMA were identified as TFE3 targets, and both genes contained e-boxes in their promoter regions (<xref ref-type="bibr" rid="B12">Martina et al., 2016</xref>). The inter-connection of these factors in regulation of IBV-induced apoptosis was then studied in TFE3 single-knockdown and TFEB/TFE3 double-knockdown cells. With increase of infection time, the mRNA level of CHOP in each group of IBV-infected wild type cells was more significantly up-regulated, compared with that in cells treated with the UV-inactivated virus (<xref ref-type="fig" rid="F5">Figure 5A</xref>). This upregulateion was significantly inhibited by the knockdown of TFE3 alone or together with TFEB. As shown in <xref ref-type="fig" rid="F5">Figure 5A</xref>, about 50% down-regulated CHOP expression was detected in the knockdown cells, compared with the negative control cells. These results demonstrate that IBV-induced TFEB/TFE3 upregulation may promote apoptosis by inducing ER stress response through upregulation of CHOP, thereby inhibiting viral replication.</p>
<p>We reintroduced TFE3 into the H1299shTFE3 cell line to investigate its effects on IBV replication, autophagy, and apoptosis. Upon overexpression of TFE3 in the knockdown cells infected with IBV, the expression levels of IBV S and IBV N proteins, as well as viral gRNA, were significantly lower than those in the control group at 12 and 20 hpi (<xref ref-type="supplementary-material" rid="SM1">Supplementary Figure S4</xref>). In contrast, the mRNA levels of SQSTM1 and CHOP were significantly higher than those in the control group. Furthermore, overexpression of TFE3 led to a significant increase in the mRNA levels of its target genes, MCOLN1 and CTSB. These results are consistent with previous findings from IBV-infected TFE3-knockdown H1299 cells.</p>
<p>Similar experiments in knockdown cells infected with HCoV-OC43 and PEDV, respectively, were performed to explore if TFEB/TFE3 may play similar regulatory roles in cells infected with these two coronaviruses. In the knockdown cells infected with HCoV-OC43, the results were similar to those in IBV-infected cells. Knockdown of both genes promoted viral replication (<xref ref-type="supplementary-material" rid="SM1">Supplementary Figures S2A</xref>, <xref ref-type="supplementary-material" rid="SM1">B</xref>) and inhibited the upregulation of SQSTM1, but higher levels of CHOP were detected in TFEB and TFE3 double-knockdown cells infected with HCoV-OC43 than those in the TFE3 single-knockdown cells at 12, 36 and 60 hpi (<xref ref-type="supplementary-material" rid="SM1">Supplementary Figure S2B</xref>). In cells infected with PEDV, knockdown of TFE3 promoted viral replication (<xref ref-type="supplementary-material" rid="SM1">Supplementary Figures S3A</xref>, <xref ref-type="supplementary-material" rid="SM1">B</xref>), but very limited additional effects on viral replication, autophagy and apoptosis were observed in the double-knockdown cells, compared with knockdown of TFE3 alone (<xref ref-type="supplementary-material" rid="SM1">Supplementary Figure S3B</xref>). Taken together, these results demonstrate that TFEB/TFE3 may play general roles in regulation of coronavirus replication and virus-induced apoptosis and autophagy.</p></sec>
<sec>
<title>Implication of the lysosomal pathway in the release of HCoV-OC43 virions</title>
<p>Recent studies have demonstrated that betacoronavirus mouse hepatitis virus (MHV) excretes cells using the lysosomal transport, unlike other enveloped RNA viruses either using the secretion pathway or through fusion with the plasma membrane and budding (<xref ref-type="bibr" rid="B6">Ghosh et al., 2020</xref>). To investigate if the lysosomal pathway is a releasing mechanism utilized by IBV, HCoV-OC43 and PEDV, BFA was added to inhibit the biosynthetic secretory pathway. The effects of different concentrations of BFA on cell viability were first checked to rule out the possible detrimental effects of high concentrations of BFA on the cell proliferation. Different concentration gradients of BFA were added to H1299-shTFE3 cells, and the cell viability was measured with CCK8, showing that the cell viability was not affected by adding 0&#x02013;10 &#x003BC;g/mL of BFA (<xref ref-type="fig" rid="F6">Figure 6A</xref>). Virus-infected cells were then treated with 5 &#x003BC;g/mL of BFA, replaced with fresh medium at 10 h post-BFA addition, and both cells and supernatants were collected at indicated time points for Western blot analysis. Compared with cells incubated with the same amount of DMSO at the same time point, in cells infected with IBV and PEDV, viral proteins were readily detected in cell lysates after the addition of BFA, but IBV S and PEDV S were completely undetectable in the supernatants, indicating that the addition of BFA completely blocked the release of IBV and PEDV particles (<xref ref-type="fig" rid="F6">Figures 6B</xref>, <xref ref-type="fig" rid="F6">C</xref>). However, viral proteins were detected in the supernatants in cells infected with HCoV-OC43, after treatment of cells with BFA (<xref ref-type="fig" rid="F6">Figure 6D</xref>). These results demonstrate that the lysosomal pathway may be involved in the release of HCoV-OC43, but not IBV and PEDV particles.</p>
<fig position="float" id="F6">
<label>Figure 6</label>
<caption><p>Differential roles of the lysosomal pathway in the release of coronavirus particles. <bold>(A)</bold> Effects of different concentrations of BFA on the proliferation of the stable TFE3-knockdown H1299 cell clones. Cells were cultured in 96-well plates overnight, and 0 (DMSO), 2.5, 5, 8, and 10 &#x003BC;g/mL BFA, respectively, were added to the culture medium. At 24 h post-BFA treatment, CCK8 was added and the absorbance at 450 nm was measured after incubation for 2 h. The cell proliferation rates were calculated after normalization to the absorbance value in cells incubated with DMSO only (ns, non-significant; &#x0002A;<italic>p</italic> &#x0003C; 0.05; &#x0002A;&#x0002A;<italic>p</italic> &#x0003C; 0.01; &#x0002A;&#x0002A;&#x0002A;<italic>p</italic> &#x0003C; 0.001). <bold>(B&#x02013;D)</bold> The stable TFE3-knockdown H1299 cells were infected with IBV, PEDV, and HCoV-OC43, respectively, at an MOI&#x0007E;2, and 5 &#x003BC;g/mL BFA were added 10 hpi. Total cells and supernatants were harvested separately at the indicated time points and were analyzed by Western blot with the indicated antibodies.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-16-1609598-g0006.tif">
<alt-text content-type="machine-generated">Figure showing bar graphs and immunoblot analyses. Panel A presents bar graphs depicting relative cell viability of H1299 shNC and shTFE3 under varying concentrations of BFA. Panels B, C, and D display immunoblot analyses of cell lysates and supernatants. Various conditions are tested for the presence of proteins TFE3, IBV N, IBV M, IBV S, PEDV S, PEDV N, and OC43 N, with actin as a control. Conditions include treatments like UV exposure, shNC, shTFE3, DMSO, and BFA at different time points. Each panel presents specific setup and results related to virus and protein expression in treated cells.</alt-text>
</graphic>
</fig>
</sec></sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>Viral replication cycle is closely associated with host cell factors and signaling pathways, imposing drastic impacts on the cellular structure and physiology of different organelles. This would lead to the activation of host cell stress responses, which in turn regulate viral replication, pathogenesis, virus-induced apoptosis, autophagy and innate immunity. Lysosomes are now considered key players in regulation of these cellular processes. In this study, we report the upregulation of TFEB/TFE3 as well as downstream targets and induction of lysosomal stress response in cells and/or chickens infected with three coronaviruses of different genera. TFE3 was shown to play a prominent role in regulating viral replication, virus-induced autophagy and apoptosis in these infected cells, and a synergistic effect with TFEB in IBV- and HCoV-OC43-infected cells. Inhibition of the biosynthetic secretory pathway with BFA revealed lysosomal pathway-dependent release of mature HCoV-OC43 particles. The key lysosomal stress-related signaling pathways and their regulatory roles in the replication of these viruses are summarized in <xref ref-type="fig" rid="F7">Figure 7</xref>.</p>
<fig position="float" id="F7">
<label>Figure 7</label>
<caption><p>Diagram illustrating the current working model. Pointed arrows denote activation, P and -P denote phosphorylation and dephosphorylation, respectively, and dotted lines denote processes that are not fully characterized.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-16-1609598-g0007.tif">
<alt-text content-type="machine-generated">Diagram illustrating lysosomal and biosynthetic secretory pathways in cellular processes. It shows virus particles interacting with the plasma membrane. ERK2 and mTORC1 regulate TFEB/TFE3, influencing lysosomal target gene expression. Pathways lead to apoptosis, lysosome biogenesis, and autophagy. The lysosomal pathway for HCoV-OC43 and the biosynthetic secretory pathway for IBV/PEDV depict that these viruses may transport their mature virions through lysosomes and the biosynthetic secretory pathway, respectively.</alt-text>
</graphic>
</fig>
<p>CTSB is a lysosomal cysteine protease. As its upregulation is directly regulated by the TFEB/TFE3 transcriptional pathway, detection of its mRNA levels would serve as an indirect indicator of the lysosomal functional status. Given its evolutionary conservation nature, CTSB mRNA was used as a marker for lysosomal stress responses in chicken tissues in this study. Similar to other coronaviruses, IBV infection of cells requires host proteases to cleave and activate its spike protein at specific sites (<xref ref-type="bibr" rid="B30">Yamada and Liu, 2009</xref>). Numerous studies have shown that, in addition to transmembrane serine proteases, lysosomal cathepsins (including CTSB) are key host factors responsible for processing coronavirus spike proteins (<xref ref-type="bibr" rid="B27">Wang et al., 2023</xref>). To support efficient viral invasion and replication, host cells may employ certain feedback mechanisms to upregulate CTSB expression, thereby providing sufficient &#x0201C;molecular scissors&#x0201D; to meet the processing demands of viral proteins. Since the strain used to infect chickens in this study is a respiratory-type IBV (KP-GI-19), the trachea serves as the primary tissue for viral contact and invasion, resulting in significantly elevated transcription of both viral gRNA and CTSB mRNA in the tracheal region.</p>
<p>Autophagy is a self-protection mechanism that is closely related to apoptosis. It normally occurs before, but independently of, apoptosis (<xref ref-type="bibr" rid="B32">Yu et al., 2018</xref>). This sequential occurrence of autophagy and apoptosis may serve two purposes. First, autophagy may be induced by dying cells to initiate their catabolism, thus accelerating the clearance of dying cells. Autophagy may then help maintain optimally high ATP levels, leading to apoptosis when cells are unable to achieve homeostasis and are subjected to constant stress (<xref ref-type="bibr" rid="B11">Maiuri et al., 2007</xref>). TFE3 was shown to be a powerful regulator controlling the expression of autophagy flux-related genes in a variety of cancers. For example, TFE3 has been shown to enhance the number and function of lysosomes, enhanced autophagy, and promote the pathological process of pancreatic ductal adenocarcinoma (<xref ref-type="bibr" rid="B16">Perera et al., 2015</xref>). TFEB- and TFE3-knockout mouse embryonic fibroblast cells were significantly less susceptible to ER stress-induced cell death (<xref ref-type="bibr" rid="B12">Martina et al., 2016</xref>).</p>
<p>ER dysfunction was caused by transcriptional up-regulation of pro-apoptotic factors such as CHOP and PUMA, direct targets of CHOP and ATF4, to promote cell apoptosis. TFEB and TFE3 may, therefore, regulate the expression of CHOP and PUMA by inducing ATF4 expression or directly binding to their promoters, promoting apoptosis under prolonged ER stress conditions by maintaining sustained ATF4 activation (<xref ref-type="bibr" rid="B12">Martina et al., 2016</xref>). A recent study reported that knockout of TFEB led to a significant downregulation of CHOP protein levels, and overexpression of constitutively nuclear TFEB (S142A) augmented the up-regulation of BiP and CHOP at both protein and mRNA levels (<xref ref-type="bibr" rid="B25">Soleimani et al., 2025</xref>). These published studies demonstrate a clear positive correlation between TFEB activation and the upregulation of CHOP expression, supporting the regulatory role of TFEB/TFE3 in CHOP expression. In this study, infection of TFEB- and TFE3-knockdown cells with IBV, HCoV-OC43 and PEDV showed down-regulation of the pro-apoptotic factor CHOP and autophagy-related gene SQSTM1. As we have previously reported the activation of autophagy during coronavirus infection (<xref ref-type="bibr" rid="B5">Fung and Liu, 2019b</xref>), the novel finding of the upregulation of SQSTM1 mRNA by RT-qPCR in this study would have provided a mechanistic link between lysosomal stress and autophagy activation during coronavirus infection. Similarly, we have previously demonstrated the induction of ER stress and activation of CHOP during coronavirus infection (<xref ref-type="bibr" rid="B9">Liao et al., 2013</xref>; <xref ref-type="bibr" rid="B3">Fung and Liu, 2014</xref>), the link of CHOP activation to lysosomal stress in this study would have added an additional mechanistic insight into the ER stress response induced by coronavirus infection.</p>
<p>Elucidation of the regulatory roles of lysosomes and lysosomal biogenesis in innate immunity against viral infection is beginning to emerge. During dendritic cell maturation, TFEB activation enhances phagosome acidification, increases protein degradation, and improves major histocompatibility complex (MHC) class II antigen presentation, all of which are critical for initiating T cell responses against viral infections (<xref ref-type="bibr" rid="B23">Samie and Cresswell, 2015</xref>). Shortly after macrophages are infected with HIV, TFEB is activated via a TLR8-dependent pathway, leading to a brief increase in autophagy and enhancement of HIV replication (<xref ref-type="bibr" rid="B1">Campbell and Spector, 2013</xref>). <xref ref-type="bibr" rid="B31">Ying et al. (2025)</xref> recently reported that the anti-Hantavirus activity of apatinib was mediated by promoting TFEB translocation to the nucleus, thereby enhancing lysosomal function and facilitating the degradation of viral nucleocapsid proteins in a lysosome-dependent manner. Our results presented here also support that activation of lysosomal biogenesis in cells infected with three different coronaviruses accelerates clearance of these viruses after infection.</p>
<p>As final steps in the viral replication cycle, assembly and release of mature virion particles are highly complex and dynamic processes. It is generally believed that the assembly and germination of coronaviruses occur in the ERGIC, soon after the newly synthesized viral genomic RNA coated with N protein enters the ERGIC through budding (<xref ref-type="bibr" rid="B4">Fung and Liu, 2019a</xref>). The virus particles are then enveloped by host membranes containing viral M, E, and S transmembrane structural proteins. Once in ER/ERGIC, the virus particles enter the Golgi apparatus and the trans-Golgi network (TGN) for maturation by glycosylation and other post-translational modifications, transported in smooth vesicles through the biosynthetic secretory pathways, and released by binding of the vesicles to the cytoplasmic membrane to expel the viral particles from the cell (<xref ref-type="bibr" rid="B4">Fung and Liu, 2019a</xref>). This viral shedding process is shared by other enveloped RNA viruses, such as hepatitis C virus (HCV), dengue virus and West Nile virus (<xref ref-type="bibr" rid="B20">Ravindran et al., 2016</xref>; <xref ref-type="bibr" rid="B21">Robinson et al., 2018</xref>), and was thought to be the only pathway used by all coronaviruses for virion release. By using BFA to block the secretory pathways, recent studies, however, have provided evidence that betacoronavirus MHV uses the lysosomal transport to excrete cells (<xref ref-type="bibr" rid="B6">Ghosh et al., 2020</xref>).</p>
<p>The blockade of the secretory pathway by BFA may be manifested in two ways, one at the level of the ER-Golgi and the other at the trans-Golgi network. However, transport from the Golgi complex and the plasma membrane to the lysosome remains unaffected (<xref ref-type="bibr" rid="B26">Strous et al., 1993</xref>). Our observations that only the mature HCoV-OC43 particles were efficiently released in the presence of BFA demonstrated that HCoV-OC43 may be released through transport from lysosome to plasma membrane in addition to secretory pathways, while IBV and PEDV may only use the secretory pathways. A key question arising from this finding is how viruses can exploit the lysosomal pathway for egress without being degraded by the potent hydrolases within this cellular compartment. Our data and existing literature provide a plausible explanation. We and others have observed that lysosomal deacidification is a general phenomenon in cells infected with several coronaviruses, including IBV, PEDV, and HCoV-OC43, and a non-coronavirus Newcastle Disease Virus (NDV; unpublished observations). This virus-induced alteration of the lysosomal environment is critical. As the low pH of functional lysosomes is essential for the optimal activity of resident proteases, deacidification, therefore, significantly dampens the proteolytic activity, effectively transforming the lysosome from a degradative organelle into a more hospitable conduit for viral exit. This model is strongly supported by a study on HCV, a virus exits via the lysosome, demonstrating that by pharmacological inhibition of lysosomal acidification to mimic deacidification, the release of infectious HCV particles was drastically reduced (<xref ref-type="bibr" rid="B28">Wozniak et al., 2010</xref>). This counter-intuitive result underscores that it is not the acidic, degradative lysosome that is used for viral exit, but rather a functionally altered one. Thus, the viral strategy appears to be a two-step process, first, to neutralize the lysosomal pH to ensure the virion integrity, and second, to commandeer this modified compartment as a non-degradative release route.</p>
<p>In conclusion, this study provides novel insights into the functional roles of the lysosomal biogenesis and induction of lysosomal stress response during the infection of cells and/or chickens by three coronaviruses of different genera. This would pave a way for further studies of the underlying mechanisms and signaling pathways in regulation of coronavirus replication and virus-host interactions, identifying novel lysosome-related cellular targets for developing antiviral intervention strategies. While this study has robustly validated the activation of the canonical TFEB/TFE3 lysosomal axis through targeted gene expression analysis, genome-wide RNA-seq analysis would potentially uncover novel targets and unknown functions regulated by TFEB/TFE3 during coronavirus infection, significantly broadening the scope of this study and elucidating the full landscape of this regulatory network. This will be an important direction in our future investigations.</p></sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SM1">Supplementary material</xref>, further inquiries can be directed to the corresponding author.</p>
</sec>
<sec sec-type="ethics-statement" id="s6">
<title>Ethics statement</title>
<p>The animal study was approved by Animal Experiments Committee of Zhaoqing Dahuanong Biopharmaceutical Co., Ltd. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec sec-type="author-contributions" id="s7">
<title>Author contributions</title>
<p>BY: Data curation, Validation, Writing &#x02013; original draft, Writing &#x02013; review &#x00026; editing, Conceptualization, Investigation, Methodology. TF: Writing &#x02013; review &#x00026; editing, Conceptualization, Funding acquisition, Investigation, Project administration, Supervision. LY: Validation, Data curation, Software, Writing &#x02013; review &#x00026; editing. RC: Supervision, Validation, Writing &#x02013; review &#x00026; editing. DL: Conceptualization, Funding acquisition, Investigation, Project administration, Supervision, Validation, Visualization, Writing &#x02013; review &#x00026; editing.</p>
</sec>
<sec sec-type="COI-statement" id="conf1">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s9">
<title>Generative AI statement</title>
<p>The author(s) declare that no Gen AI was used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p></sec>
<sec sec-type="disclaimer" id="s10">
<title>Publisher&#x00027;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec><sec id="s11">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fmicb.2025.1609598/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fmicb.2025.1609598/full#supplementary-material</ext-link></p>
<supplementary-material xlink:href="Data_Sheet_1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image_1.tif" id="SM2" mimetype="image/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image_2.tif" id="SM3" mimetype="image/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image_3.tif" id="SM4" mimetype="image/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="Image_4.tif" id="SM5" mimetype="image/tif" xmlns:xlink="http://www.w3.org/1999/xlink"/></sec>
<ref-list>
<title>References</title>
<ref id="B1">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Campbell</surname> <given-names>G. R.</given-names></name> <name><surname>Spector</surname> <given-names>S. A.</given-names></name></person-group> (<year>2013</year>). <article-title>Inhibition of human immunodeficiency virus type-1 through autophagy</article-title>. <source>Curr. Opin. Microbiol.</source> <volume>16</volume>, <fpage>349</fpage>&#x02013;<lpage>354</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.mib.2013.05.006</pub-id><pub-id pub-id-type="pmid">23747172</pub-id></mixed-citation>
</ref>
<ref id="B2">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fang</surname> <given-names>S. G.</given-names></name> <name><surname>Shen</surname> <given-names>S.</given-names></name> <name><surname>Tay</surname> <given-names>F. P. L.</given-names></name> <name><surname>Liu</surname> <given-names>D. X.</given-names></name></person-group> (<year>2005</year>). <article-title>Selection of and recombination between minor variants lead to the adaptation of an avian coronavirus to primate cells</article-title>. <source>Biochem. Biophys. Res. Commun.</source> <volume>336</volume>, <fpage>417</fpage>&#x02013;<lpage>423</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.bbrc.2005.08.105</pub-id><pub-id pub-id-type="pmid">16137658</pub-id></mixed-citation>
</ref>
<ref id="B3">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fung</surname> <given-names>T. S.</given-names></name> <name><surname>Liu</surname> <given-names>D. X.</given-names></name></person-group> (<year>2014</year>). <article-title>Coronavirus infection, ER stress, apoptosis and innate immunity</article-title>. <source>Front. Microbiol.</source> <volume>5</volume>:<fpage>296</fpage>. doi: <pub-id pub-id-type="doi">10.3389/fmicb.2014.00296</pub-id><pub-id pub-id-type="pmid">24987391</pub-id></mixed-citation>
</ref>
<ref id="B4">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fung</surname> <given-names>T. S.</given-names></name> <name><surname>Liu</surname> <given-names>D. X.</given-names></name></person-group> (<year>2019a</year>). <article-title>Human coronavirus: host-pathogen interaction</article-title>. <source>Annu. Rev. Microbiol.</source> <volume>73</volume>, <fpage>529</fpage>&#x02013;<lpage>557</lpage>. doi: <pub-id pub-id-type="doi">10.1146/annurev-micro-020518-115759</pub-id><pub-id pub-id-type="pmid">31226023</pub-id></mixed-citation>
</ref>
<ref id="B5">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fung</surname> <given-names>T. S.</given-names></name> <name><surname>Liu</surname> <given-names>D. X.</given-names></name></person-group> (<year>2019b</year>). <article-title>The ER stress sensor IRE1 and MAP kinase ERK modulate autophagy induction in cells infected with coronavirus infectious bronchitis virus</article-title>. <source>Virology</source> <volume>533</volume>, <fpage>34</fpage>&#x02013;<lpage>44</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.virol.2019.05.002</pub-id><pub-id pub-id-type="pmid">31082732</pub-id></mixed-citation>
</ref>
<ref id="B6">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ghosh</surname> <given-names>S.</given-names></name> <name><surname>Dellibovi-Ragheb</surname> <given-names>T. A.</given-names></name> <name><surname>Kerviel</surname> <given-names>A.</given-names></name> <name><surname>Pak</surname> <given-names>E.</given-names></name> <name><surname>Qiu</surname> <given-names>Q.</given-names></name> <name><surname>Fisher</surname> <given-names>M.</given-names></name> <etal/></person-group>. (<year>2020</year>). <article-title>&#x003B2;-coronaviruses use lysosomes for egress instead of the biosynthetic secretory pathway</article-title>. <source>Cell</source> <volume>183</volume>, <fpage>1520</fpage>&#x02013;<lpage>1535</lpage>.e14. doi: <pub-id pub-id-type="doi">10.1016/j.cell.2020.10.039</pub-id><pub-id pub-id-type="pmid">33157038</pub-id></mixed-citation>
</ref>
<ref id="B7">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>S.</given-names></name> <name><surname>Liu</surname> <given-names>S.</given-names></name> <name><surname>Chen</surname> <given-names>R. A.</given-names></name> <name><surname>Huang</surname> <given-names>M.</given-names></name> <name><surname>Fung</surname> <given-names>T. S.</given-names></name> <name><surname>Liu</surname> <given-names>D. X.</given-names></name></person-group> (<year>2022</year>). <article-title>Activation of the MKK3-p38-MK2-ZFP36 axis by coronavirus infection restricts the upregulation of AU-rich element-containing transcripts in proinflammatory responses</article-title>. <source>J. Virol.</source> <volume>96</volume>:<fpage>e02086</fpage>-21. doi: <pub-id pub-id-type="doi">10.1128/jvi.02086-21</pub-id><pub-id pub-id-type="pmid">34985993</pub-id></mixed-citation>
</ref>
<ref id="B8">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname> <given-names>Y.</given-names></name> <name><surname>Xu</surname> <given-names>M.</given-names></name> <name><surname>Ding</surname> <given-names>X.</given-names></name> <name><surname>Yan</surname> <given-names>C.</given-names></name> <name><surname>Song</surname> <given-names>Z.</given-names></name> <name><surname>Chen</surname> <given-names>L.</given-names></name> <etal/></person-group>. (<year>2016</year>). <article-title>Protein kinase C controls lysosome biogenesis independently of mTORC1</article-title>. <source>Nat. Cell Biol.</source> <volume>18</volume>, <fpage>1065</fpage>&#x02013;<lpage>1077</lpage>. doi: <pub-id pub-id-type="doi">10.1038/ncb3407</pub-id><pub-id pub-id-type="pmid">27617930</pub-id></mixed-citation>
</ref>
<ref id="B9">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liao</surname> <given-names>Y.</given-names></name> <name><surname>Fung</surname> <given-names>T. S.</given-names></name> <name><surname>Huang</surname> <given-names>M.</given-names></name> <name><surname>Fang</surname> <given-names>S. G.</given-names></name> <name><surname>Zhong</surname> <given-names>Y.</given-names></name> <name><surname>Liu</surname> <given-names>D. X.</given-names></name></person-group> (<year>2013</year>). <article-title>Upregulation of CHOP/GADD153 during coronavirus infectious bronchitis virus infection modulates apoptosis by restricting activation of the extracellular signal-regulated kinase pathway</article-title>. <source>J. Virol.</source> <volume>87</volume>, <fpage>8124</fpage>&#x02013;<lpage>8134</lpage>. doi: <pub-id pub-id-type="doi">10.1128/JVI.00626-13</pub-id><pub-id pub-id-type="pmid">23678184</pub-id></mixed-citation>
</ref>
<ref id="B10">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lim</surname> <given-names>K. P.</given-names></name> <name><surname>Liu</surname> <given-names>D. X.</given-names></name></person-group> (<year>1998</year>). <article-title>Characterization of the two overlapping papain-like proteinase domains encoded in gene 1 of the coronavirus infectious bronchitis virus and determination of the C-terminal cleavage site of an 87-kDa protein</article-title>. <source>Virology</source> <volume>245</volume>, <fpage>303</fpage>&#x02013;<lpage>312</lpage>. doi: <pub-id pub-id-type="doi">10.1006/viro.1998.9164</pub-id><pub-id pub-id-type="pmid">9636369</pub-id></mixed-citation>
</ref>
<ref id="B11">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Maiuri</surname> <given-names>M. C.</given-names></name> <name><surname>Zalckvar</surname> <given-names>E.</given-names></name> <name><surname>Kimchi</surname> <given-names>A.</given-names></name> <name><surname>Kroemer</surname> <given-names>G.</given-names></name></person-group> (<year>2007</year>). <article-title>Self-eating and self-killing: crosstalk between autophagy and apoptosis</article-title>. <source>Nat. Rev. Mol. Cell Biol.</source> <volume>8</volume>, <fpage>741</fpage>&#x02013;<lpage>752</lpage>. doi: <pub-id pub-id-type="doi">10.1038/nrm2239</pub-id><pub-id pub-id-type="pmid">17717517</pub-id></mixed-citation>
</ref>
<ref id="B12">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Martina</surname> <given-names>J. A.</given-names></name> <name><surname>Diab</surname> <given-names>H. I.</given-names></name> <name><surname>Brady</surname> <given-names>O. A.</given-names></name> <name><surname>Puertollano</surname> <given-names>R.</given-names></name></person-group> (<year>2016</year>). <article-title>TFEB and TFE3 are novel components of the integrated stress response</article-title>. <source>EMBO J.</source> <volume>35</volume>, <fpage>479</fpage>&#x02013;<lpage>495</lpage>. doi: <pub-id pub-id-type="doi">10.15252/embj.201593428</pub-id><pub-id pub-id-type="pmid">26813791</pub-id></mixed-citation>
</ref>
<ref id="B13">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Martina</surname> <given-names>J. A.</given-names></name> <name><surname>Puertollano</surname> <given-names>R.</given-names></name></person-group> (<year>2018</year>). <article-title>Protein phosphatase 2A stimulates activation of TFEB and TFE3 transcription factors in response to oxidative stress</article-title>. <source>J. Biol. Chem.</source> <volume>293</volume>, <fpage>12525</fpage>&#x02013;<lpage>12534</lpage>. doi: <pub-id pub-id-type="doi">10.1074/jbc.RA118.003471</pub-id><pub-id pub-id-type="pmid">29945972</pub-id></mixed-citation>
</ref>
<ref id="B14">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Morfopoulou</surname> <given-names>S.</given-names></name> <name><surname>Brown</surname> <given-names>J. R.</given-names></name> <name><surname>Davies</surname> <given-names>E. G.</given-names></name> <name><surname>Anderson</surname> <given-names>G.</given-names></name> <name><surname>Virasami</surname> <given-names>A.</given-names></name> <name><surname>Qasim</surname> <given-names>W.</given-names></name> <etal/></person-group>. (<year>2016</year>). <article-title>Human coronavirus OC43 associated with fatal encephalitis</article-title>. <source>N. Engl. J. Med.</source> <volume>375</volume>, <fpage>497</fpage>&#x02013;<lpage>498</lpage>. doi: <pub-id pub-id-type="doi">10.1056/NEJMc1509458</pub-id><pub-id pub-id-type="pmid">27518687</pub-id></mixed-citation>
</ref>
<ref id="B15">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Park</surname> <given-names>S.-J.</given-names></name> <name><surname>Kim</surname> <given-names>H.-K.</given-names></name> <name><surname>Song</surname> <given-names>D.-S.</given-names></name> <name><surname>An</surname> <given-names>D.-J.</given-names></name> <name><surname>Park</surname> <given-names>B.-K.</given-names></name></person-group> (<year>2012</year>). <article-title>Complete genome sequences of a Korean virulent porcine epidemic diarrhea virus and its attenuated counterpart</article-title>. <source>J. Virol.</source> <volume>86</volume>:<fpage>5964</fpage>. doi: <pub-id pub-id-type="doi">10.1128/JVI.00557-12</pub-id><pub-id pub-id-type="pmid">22532530</pub-id></mixed-citation>
</ref>
<ref id="B16">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Perera</surname> <given-names>R. M.</given-names></name> <name><surname>Stoykova</surname> <given-names>S.</given-names></name> <name><surname>Nicolay</surname> <given-names>B. N.</given-names></name> <name><surname>Ross</surname> <given-names>K. N.</given-names></name> <name><surname>Fitamant</surname> <given-names>J.</given-names></name> <name><surname>Boukhali</surname> <given-names>M.</given-names></name> <etal/></person-group>. (<year>2015</year>). <article-title>Transcriptional control of autophagy-lysosome function drives pancreatic cancer metabolism</article-title>. <source>Nature</source> <volume>524</volume>, <fpage>361</fpage>&#x02013;<lpage>365</lpage>. doi: <pub-id pub-id-type="doi">10.1038/nature14587</pub-id><pub-id pub-id-type="pmid">26168401</pub-id></mixed-citation>
</ref>
<ref id="B17">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pi&#x00161;lar</surname> <given-names>A.</given-names></name> <name><surname>Mitrovi&#x00107;</surname> <given-names>A.</given-names></name> <name><surname>Saboti&#x0010D;</surname> <given-names>J.</given-names></name> <name><surname>Pe&#x0010D;ar Fonovi&#x00107;</surname> <given-names>U.</given-names></name> <name><surname>Peri&#x00161;i&#x00107; Nanut</surname> <given-names>M.</given-names></name> <name><surname>Jako&#x00161;</surname> <given-names>T.</given-names></name> <etal/></person-group>. (<year>2020</year>). <article-title>The role of cysteine peptidases in coronavirus cell entry and replication: the therapeutic potential of cathepsin inhibitors</article-title>. <source>PLoS Pathog.</source> <volume>16</volume>:<fpage>e1009013</fpage>. doi: <pub-id pub-id-type="doi">10.1371/journal.ppat.1009013</pub-id><pub-id pub-id-type="pmid">33137165</pub-id></mixed-citation>
</ref>
<ref id="B18">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Puertollano</surname> <given-names>R.</given-names></name> <name><surname>Ferguson</surname> <given-names>S. M.</given-names></name> <name><surname>Brugarolas</surname> <given-names>J.</given-names></name> <name><surname>Ballabio</surname> <given-names>A.</given-names></name></person-group> (<year>2018</year>). <article-title>The complex relationship between TFEB transcription factor phosphorylation and subcellular localization</article-title>. <source>EMBO J.</source> <volume>37</volume>:<fpage>e98804</fpage>. doi: <pub-id pub-id-type="doi">10.15252/embj.201798804</pub-id><pub-id pub-id-type="pmid">29764979</pub-id></mixed-citation>
</ref>
<ref id="B19">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Raben</surname> <given-names>N.</given-names></name> <name><surname>Puertollano</surname> <given-names>R.</given-names></name></person-group> (<year>2016</year>). <article-title>TFEB and TFE3: linking lysosomes to cellular adaptation to stress</article-title>. <source>Annu. Rev. Cell Dev. Biol.</source> <volume>32</volume>, <fpage>255</fpage>&#x02013;<lpage>278</lpage>. doi: <pub-id pub-id-type="doi">10.1146/annurev-cellbio-111315-125407</pub-id><pub-id pub-id-type="pmid">27298091</pub-id></mixed-citation>
</ref>
<ref id="B20">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ravindran</surname> <given-names>M. S.</given-names></name> <name><surname>Bagchi</surname> <given-names>P.</given-names></name> <name><surname>Cunningham</surname> <given-names>C. N.</given-names></name> <name><surname>Tsai</surname> <given-names>B.</given-names></name></person-group> (<year>2016</year>). <article-title>Opportunistic intruders: how viruses orchestrate ER functions to infect cells</article-title>. <source>Nat. Rev. Microbiol.</source> <volume>14</volume>, <fpage>407</fpage>&#x02013;<lpage>420</lpage>. doi: <pub-id pub-id-type="doi">10.1038/nrmicro.2016.60</pub-id><pub-id pub-id-type="pmid">27265768</pub-id></mixed-citation>
</ref>
<ref id="B21">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Robinson</surname> <given-names>M.</given-names></name> <name><surname>Schor</surname> <given-names>S.</given-names></name> <name><surname>Barouch-Bentov</surname> <given-names>R.</given-names></name> <name><surname>Einav</surname> <given-names>S.</given-names></name></person-group> (<year>2018</year>). <article-title>Viral journeys on the intracellular highways</article-title>. <source>Cell. Mol. Life Sci.</source> <volume>75</volume>, <fpage>3693</fpage>&#x02013;<lpage>3714</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s00018-018-2882-0</pub-id><pub-id pub-id-type="pmid">30043139</pub-id></mixed-citation>
</ref>
<ref id="B22">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Saftig</surname> <given-names>P.</given-names></name> <name><surname>Puertollano</surname> <given-names>R.</given-names></name></person-group> (<year>2021</year>). <article-title>How lysosomes sense, integrate, and cope with stress</article-title>. <source>Trends Biochem. Sci.</source> <volume>46</volume>, <fpage>97</fpage>&#x02013;<lpage>112</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.tibs.2020.09.004</pub-id><pub-id pub-id-type="pmid">33012625</pub-id></mixed-citation>
</ref>
<ref id="B23">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Samie</surname> <given-names>M.</given-names></name> <name><surname>Cresswell</surname> <given-names>P.</given-names></name></person-group> (<year>2015</year>). <article-title>The transcription factor TFEB acts as a molecular switch that regulates exogenous antigen-presentation pathways</article-title>. <source>Nat. Immunol.</source> <volume>16</volume>, <fpage>729</fpage>&#x02013;<lpage>736</lpage>. doi: <pub-id pub-id-type="doi">10.1038/ni.3196</pub-id><pub-id pub-id-type="pmid">26030023</pub-id></mixed-citation>
</ref>
<ref id="B24">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shen</surname> <given-names>S.</given-names></name> <name><surname>Wen</surname> <given-names>Z. L.</given-names></name> <name><surname>Liu</surname> <given-names>D. X.</given-names></name></person-group> (<year>2003</year>). <article-title>Emergence of a coronavirus infectious bronchitis virus mutant with a truncated 3b gene: functional characterization of the 3b protein in pathogenesis and replication</article-title>. <source>Virology</source> <volume>311</volume>, <fpage>16</fpage>&#x02013;<lpage>27</lpage>. doi: <pub-id pub-id-type="doi">10.1016/S0042-6822(03)00117-X</pub-id><pub-id pub-id-type="pmid">12832199</pub-id></mixed-citation>
</ref>
<ref id="B25">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Soleimani</surname> <given-names>M.</given-names></name> <name><surname>Duchow</surname> <given-names>M.</given-names></name> <name><surname>Goyal</surname> <given-names>R.</given-names></name> <name><surname>Somma</surname> <given-names>A.</given-names></name> <name><surname>Kaoud</surname> <given-names>T. S.</given-names></name> <name><surname>Dalby</surname> <given-names>K. N.</given-names></name> <etal/></person-group>. (<year>2025</year>). <article-title>Transcription factor EB (TFEB) activity increases resistance of TNBC stem cells to metabolic stress</article-title>. <source>Life Sci. Alliance</source> <volume>8</volume>:<fpage>e202302259</fpage>. doi: <pub-id pub-id-type="doi">10.26508/lsa.202302259</pub-id><pub-id pub-id-type="pmid">39814550</pub-id></mixed-citation>
</ref>
<ref id="B26">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Strous</surname> <given-names>G. J.</given-names></name> <name><surname>van Kerkhof</surname> <given-names>P.</given-names></name> <name><surname>van Meer</surname> <given-names>G.</given-names></name> <name><surname>Rijnboutt</surname> <given-names>S.</given-names></name> <name><surname>Stoorvogel</surname> <given-names>W.</given-names></name></person-group> (<year>1993</year>). <article-title>Differential effects of brefeldin A on transport of secretory and lysosomal proteins</article-title>. <source>J. Biol. Chem.</source> <volume>268</volume>, <fpage>2341</fpage>&#x02013;<lpage>2347</lpage>. doi: <pub-id pub-id-type="doi">10.1016/S0021-9258(18)53781-9</pub-id><pub-id pub-id-type="pmid">8428908</pub-id></mixed-citation>
</ref>
<ref id="B27">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>H.</given-names></name> <name><surname>Yang</surname> <given-names>Q.</given-names></name> <name><surname>Liu</surname> <given-names>X.</given-names></name> <name><surname>Xu</surname> <given-names>Z.</given-names></name> <name><surname>Shao</surname> <given-names>M.</given-names></name> <name><surname>Li</surname> <given-names>D.</given-names></name> <etal/></person-group>. (<year>2023</year>). <article-title>Structure-based discovery of dual pathway inhibitors for SARS-CoV-2 entry</article-title>. <source>Nat. Commun.</source> <volume>14</volume>:<fpage>7574</fpage>. doi: <pub-id pub-id-type="doi">10.1038/s41467-023-42527-5</pub-id><pub-id pub-id-type="pmid">37990007</pub-id></mixed-citation>
</ref>
<ref id="B28">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wozniak</surname> <given-names>A. L.</given-names></name> <name><surname>Griffin</surname> <given-names>S.</given-names></name> <name><surname>Rowlands</surname> <given-names>D.</given-names></name> <name><surname>Harris</surname> <given-names>M.</given-names></name> <name><surname>Yi</surname> <given-names>M.</given-names></name> <name><surname>Lemon</surname> <given-names>S. M.</given-names></name> <etal/></person-group>. (<year>2010</year>). <article-title>Intracellular proton conductance of the Hepatitis C virus p7 protein and its contribution to infectious virus production</article-title>. <source>PLoS Pathog.</source> <volume>6</volume>:<fpage>e1001087</fpage>. doi: <pub-id pub-id-type="doi">10.1371/journal.ppat.1001087</pub-id><pub-id pub-id-type="pmid">20824094</pub-id></mixed-citation>
</ref>
<ref id="B29">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xiong</surname> <given-names>T.</given-names></name> <name><surname>Xie</surname> <given-names>H.</given-names></name> <name><surname>Li</surname> <given-names>L.</given-names></name> <name><surname>Liang</surname> <given-names>S.</given-names></name> <name><surname>Huang</surname> <given-names>M.</given-names></name> <name><surname>Yu</surname> <given-names>C.</given-names></name> <etal/></person-group>. (<year>2024</year>). <article-title>Prevalence, genotype diversity, and distinct pathogenicity of 205 gammacoronavirus infectious bronchitis virus isolates in China during 2019-2023</article-title>. <source>Viruses</source> <volume>16</volume>:<fpage>930</fpage>. doi: <pub-id pub-id-type="doi">10.3390/v16060930</pub-id><pub-id pub-id-type="pmid">38932222</pub-id></mixed-citation>
</ref>
<ref id="B30">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yamada</surname> <given-names>Y.</given-names></name> <name><surname>Liu</surname> <given-names>D. X.</given-names></name></person-group> (<year>2009</year>). <article-title>Proteolytic activation of the spike protein at a novel RRRR/S motif is implicated in furin-dependent entry, syncytium formation and infectivity of coronavirus infectious bronchitis virus in cultured cells</article-title>. <source>J. Virol.</source> <volume>83</volume>, <fpage>8744</fpage>&#x02013;<lpage>8758</lpage>. doi: <pub-id pub-id-type="doi">10.1128/JVI.00613-09</pub-id></mixed-citation>
</ref>
<ref id="B31">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ying</surname> <given-names>Q.</given-names></name> <name><surname>Zhang</surname> <given-names>X.</given-names></name> <name><surname>Gu</surname> <given-names>T.</given-names></name> <name><surname>Zhang</surname> <given-names>J.</given-names></name> <name><surname>Dong</surname> <given-names>Y.</given-names></name> <name><surname>Feng</surname> <given-names>W.</given-names></name> <etal/></person-group>. (<year>2025</year>). <article-title>Apatinib inhibits HTNV by stimulating TFEB-driven lysosome biogenesis to degrade viral protein</article-title>. <source>Antiviral Res.</source> <volume>237</volume>:<fpage>106124</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.antiviral.2025.106124</pub-id><pub-id pub-id-type="pmid">40020878</pub-id></mixed-citation>
</ref>
<ref id="B32">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yu</surname> <given-names>L.</given-names></name> <name><surname>Chen</surname> <given-names>Y.</given-names></name> <name><surname>Tooze</surname> <given-names>S. A.</given-names></name></person-group> (<year>2018</year>). <article-title>Autophagy pathway: cellular and molecular mechanisms</article-title>. <source>Autophagy</source> <volume>14</volume>, <fpage>207</fpage>&#x02013;<lpage>215</lpage>. doi: <pub-id pub-id-type="doi">10.1080/15548627.2017.1378838</pub-id><pub-id pub-id-type="pmid">28933638</pub-id></mixed-citation>
</ref>
<ref id="B33">
<mixed-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yuan</surname> <given-names>L. X.</given-names></name> <name><surname>Liang</surname> <given-names>J. Q.</given-names></name> <name><surname>Zhu</surname> <given-names>Q. C.</given-names></name> <name><surname>Dai</surname> <given-names>G.</given-names></name> <name><surname>Li</surname> <given-names>S.</given-names></name> <name><surname>Fung</surname> <given-names>T. S.</given-names></name> <etal/></person-group>. (<year>2021</year>). <article-title>A gammacoronavirus, avian infectious bronchitis virus, and an alphacoronavirus, porcine epidemic diarrhea virus, exploit a cell survival strategy by upregulating cFOS to promote virus replication</article-title>. <source>J. Virol.</source> <volume>95</volume>, <fpage>e02107</fpage>-20. doi: <pub-id pub-id-type="doi">10.1128/JVI.02107-20</pub-id></mixed-citation>
</ref>
</ref-list>
<fn-group>
<fn fn-type="custom" custom-type="edited-by" id="fn0001">
<p>Edited by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/974147/overview">Samuel Pushparaj Robert Jeyasingh</ext-link>, Oklahoma State University, United States</p>
</fn>
<fn fn-type="custom" custom-type="reviewed-by" id="fn0002">
<p>Reviewed by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/436096/overview">Ran Wang</ext-link>, Capital Medical University, China</p>
<p><ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2019087/overview">Karthikeyan Raman</ext-link>, Northeastern University, United States</p>
</fn>
</fn-group>
</back>
</article>