Ninety five samples of Muscovy ducks (Cairina moschata) suspected of DAdV-3 infection were collected in Fujian Province. The sick ducks showed symptoms of depression, a decrease in feed intake and the excretion of yellowish-white loose feces, and their livers were found enlarged and bleeding upon necropsy. Collect the liver of the diseased ducks under aseptic conditions. RNA and DNA extraction was performed using the Animal Total RNA/DNA Isolation Kit from TianLong (Suzhou, China). The LbCas12a protein (a member of the Cas family of proteins and comes from Lachnospiraceae bacteria), EcoRI, and XbaI endonucleases were purchased from New England Biolabs (MA, United States). The RPA kit and LFS was obtained from EZassay Ltd. (Shenzhen, China). The Fiber2 gene was amplified from DAdV-3 genome DNA (strain FJGT01, GenBank No. MH777395.1) and inserted into pcDNA3.1 with a Flag tag. A constant temperature metal bath, purchased from Gingko Biotech (Beijing, China), was set at 37°C for the experiments. Gel imaging was carried out using equipment from Gene Company Limited (MA, United States). DNA and RNA concentrations were measured with the Nanodrop ND-2000 spectrophotometer (NanoDrop Technologies, DE), and fluorescence intensity was measured using the Tecan Infinite M200 plate reader (Männedorf, Sweden).

We used the RPA Design online tool¹ to design four pairs of primers targeting the DAdV-3 Fiber-2 gene (strain FJGT01, GenBank No. MH777395.1). The primers were selected based on the size of the amplified fragment, which ranged from 120 to 250 base pairs (bp), and primer lengths ranging from 25 to 35 bp. For Cas12a targeting, crRNAs were designed to follow the 3′ end of a PAM sequence (5′-TTTV-3′). Each crRNA sequence (5′-3′) included a T7 promoter (UAAUACGACUCACUAUA), a Cas12a scaffold sequence (UAAUUUCUACUAAGUGUAGAU), and a target sequence of 20–23 bp located after the PAM sequence. We employed the CrRNA Design online tool² to design crRNAs and choose the optimal one according to prediction scores. Primers and crRNAs were synthesized by EZassay Ltd. (Shenzhen, China). Detailed sequence information used in this study is summarized in Table 1.

The RPA reaction was executed utilizing the RPA Kit in accordance with the protocol provided by the manufacturer. In summary, the reactions were performed in a total volume of 20 μL, comprising 10.0 μL of reaction buffer, 6.0 μL of RNase/DNase-free water (ddH₂O), and 0.5 μL each of upstream and downstream primers at a concentration of 20 μM/L. The RPA reaction mixture was then incubated at 37°C in a metal bath for a duration of 20 min.

The reactions were performed with 5 μL of RPA products, 1 μL of LbCas12a protein, 2 μL of cleavage buffer, 1 μL of crRNA, 0.6 μL of single-stranded DNA (ssDNA) reporter (4 μM), and ddH₂O to a total volume of 20 μL. The reaction mixture was incubated in a metal bath at the temperature of 37°C for 25 min. The Black Hole Quencher (BHQ)-labeled ssDNA probe (FAM-TTATT-BHQ) and the biotin-labeled ssDNA probe (FAM-TTATT-Biotin) were synthesized and purified by EZassay Ltd. (Shenzhen, China). The activity of Cas12a DNA endonuclease was evaluated by employing blue light of 450 nm in wavelength, along with fluorescence signals where the excitation wavelength was 492 nm and the emission wavelength was 521 nm, respectively.

After completing the amplification and Cas12a detection reactions, 2 μL of the reaction product was mixed with 78 μL of dilution buffer. The test results were observed 2 min after adding a lateral flow test strip to the reaction mixture. DNA was detected using the elimination method. A single band appearing on the control line (C) indicated a positive result, while bands appearing on both the control line (C) and the test line (T) indicated a negative result.

To optimize the reaction concentrations of Cas12a and crRNA, the CRISPR/Cas12a reactions were conducted in different concentrations of Cas12a (25, 50, 100, 150, and 200 nmol/L) and crRNA (25, 50, and 100 nmol/L), and each reaction products was tested by reading the fuorescence signal to determine the optimal concentration.

To investigate the sensitivity of the RPA-CRISPR/Cas12a reaction, 10-fold serial dilutions of the pcDNA3.1-DAdV-3 Fiber-2-Flag plasmid standard were used as templates for the RPA reaction, whereas ddH2O was used as a negative control. The nucleic acids extracted from multiple viruses that seriously threaten poultry health, namely, Muscovy duck parvovirus (MDPV), Duck circovirus (DuCV), Adenovirus type 4 (AdV-4), Duck tembusu virus (DTMUV), Egg drop syndrome virus (EDSV), Duck hepatitis virus (DHV), Duck astrovirus (DAstV), and Duck plague virus (DPV), were detected to evaluate the analytical specificity of the RPA-CRISPR/Cas12a assay.

GraphPad Prism 9 software (GraphPad Software, Inc.) was utilized to analyze the data. Statistical significance was evaluated through the application of two-tailed t-tests. The results were shown as mean ± standard error of the mean (SEM) based on three independent experiments, with p values lower than 0.05 being considered significant.

Upon completion of the reaction, the CRISPR/Cas12a solution was introduced to the sample pad of the test strip. The principle of the strip detection method for DAdV-3 DNA is illustrated in Figure 1. In this method, gold nanoparticles conjugated with FAM antibodies bind to the ssDNA probe on the test strip, forming a detection probe designated as 5′-gold-Ab-FAM-ssDNA-biotin-3′. Streptavidin on the control (C) line captured the biotin-labeled probes, resulting in the formation of a visible gold line. In the presence of DAdV-3 genes in the sample, the FAM-labeled gold particles and biotin moieties were cleaved from the ssDNA probe due to Cas12a-mediated cleavage of the reporter RNA. Consequently, the FAM-labeled gold particles did not remain on the test (T) line, leading to the absence of detectable bands, which indicates a positive result. In the absence of DAdV-3 genes, the FAM-conjugated gold particles and biotin-labeled probes remained intact, resulting in bands on both the C and T lines, indicating a negative result. Conversely, the absence of bands on the C line rendered the test strip invalid.

The evaluation of oligonucleotide sequences is essential for RPA, especially for assessing primer efficacy. Four primer pairs targeting the Fiber-2 gene were initially tested, and their amplification products were separated using agarose gel electrophoresis. Figure 2A shows the successful amplification of a DNA fragment of the expected size (250 bp) with all primer sets. The Cas12a-LFS detection results (Figure 2B, upper) indicate that all tests with the four primer pairs (lines 1, 3, 5, and 7) yielded positive results, whereas the no-template control showed negative results. Subsequent Cas12a fluorescence analysis (below part of Figures 2B,C) revealed that primer set #2 exhibited the highest fluorescence intensity and values among the evaluated sets. Therefore, primer set #2 was selected for further experimental investigations.

To optimize the concentrations of Cas12a and crRNA in the CRISPR/Cas12a system, a series of reactions were conducted using varying concentrations of Cas12a (25, 50, 100, 150, and 200 nmol/L) and crRNA (25, 50, and 100 nmol/L). As shown in Figure 3A, the reaction group with 100 nmol/L Cas12a exhibited higher fluorescence intensity compared to the group with 50 nmol/L Cas12a. Furthermore, under the same conditions, the group with 50 nmol/L crRNA showed stronger fluorescence intensity than the group with 25 nmol/L crRNA. Despite these observations, the fluorescence values presented in Figure 3B did not reveal statistically significant differences with increasing concentrations of Cas12a and crRNA. Therefore, for subsequent experiments, concentrations of 100 nmol/L for Cas12a and 50 nmol/L for crRNA were selected based on these results.

The analytical sensitivity of the CRISPR/Cas12a system was assessed using the plasmid pcDNA3.1-DAdV-3 Fiber-2-Flag constructed in our laboratory as templates, diluted from 3.0 × 10⁸ to 3.0 × 10⁻¹ copies/μL. RPA amplification was done on each dilution, followed by CRISPR/Cas12a-LFS detection. The detection limit of the CRISPR/Cas12a method was established at 3.0 × 10⁰ copies/μL, as indicated by the complete absence of the test line on the test strip (Figure 4A) and significant differences in fluorescence intensity (Figure 4B) and fluorescence values (Figure 4C) between the 3.0 × 10⁰ copies/μL sample and the 3.0 × 10⁻¹ copies/μL sample.

To validate the specificity of the CRISPR/Cas12a detection method, nucleic acid samples from eight duck viruses other than DAdV-3 were tested, including MDPV, DuCV, AdV-4, DTMUV, EDSV, DHV, DAstV and DPV. The results from the CRISPR/Cas12a reaction using LFS (Figure 5A), blue light detection (Figure 5B), and fluorescence detection (Figure 5C) consistently showed that only DAdV-3 viral DNA produced a positive signal, confirming the reliability and specificity of the method.

To evaluate the performance of the RPA-CRISPR assay for detecting DAdV-3 in clinical samples, 95 duck samples were analyzed. The detection principle of the test strips used in this study is as described in Figure 1. The grayscale values of the T lines on lateral flow strips (LFS) were quantified using ImageJ software (National Institutes of Health, Bethesda, MD, United States). The detection of a grayscale value signifies the presence of a band, thereby indicating a positive detection result. The results showed that 49 samples were strongly positive and 46 samples were negative (Figure 6). In order to verify the reliability of the test strip for detecting DAdV-3, the qPCR method (Wan et al., 2018) developed by our team was used for verification detection. The results demonstrate that the concordance rate between the two methods can attain an impressive 98.95% (Table 2). These findings confirm the reliability of the RPA-CRISPR/Cas12a-LFS method for detecting DAdV-3 in clinical samples.