All animal studies were approved by the Animal Experiment Administration Committee of Army Medical University and were conducted in accordance with governmental guidelines and institutional policies for the Care and Use of Laboratory Animals.

Homozygous Frk^–/–mice (from Cyagen Biosciences) were bred under specific pathogen-free conditions at the National Engineering Research Center of Immunological Products. Six-week-old male specific pathogen-free (SPF) Frk^–/– mice and their WT littermates used in the experiments were bred separately and euthanized by cervical vertebra dislocation.

The following chemical reagents and antibodies were used in this study: anti-TBK1 (3504), anti-phospho-TBK1 (5483), anti-IRF3 (4302), anti-phospho-IRF3 (29047), rabbit anti-phospho-Tyr (8954), rabbit anti-Flag (14793), rabbit anti-HA (14031), mice anti-Myc (2276), fluorescent Alexa 488-conjugated anti-mice IgG (4408), fluorescent Alexa 594-conjugated anti-rabbit IgG (8889), and goat anti-rabbit IgG (5127), all from Cell Signaling Technology; rabbit anti-Frk (16197-1-AP) from Proteintech; anti-Flag M2 Affinity Gel (A2220) and rabbit anti-GAPDH (G9545), both from Sigma-Aldrich; Anti-HA Magnetic Beads from MCE (HY-K0201); rabbit anti-GST (CW0085M) from Cwbio; Protein G Sepharose 4 Fast Flow was purchased from GE Healthcare; DAPI (C1005), from Beyotime. Expression constructs for Flag-RIG-I, Flag-RIG-I-N, Flag-MAVS, Flag-TBK1, Flag-IRF3, Flag-cGAS, Flag-TRAF3, and HA-cGAS were obtained from Dr. B. Ge (Tongji University, Shanghai, China); Flag-STING was obtained from Dr. B. Sun (Shanghai Institute of Biochemistry and Cell Biology, Shanghai, China); cDNAs encoding Src, Frk, and Lyn were obtained from Dr. J. Han (Xiamen University, Fujian, China). HA-STING, HA-TBK1 and Myc-Ub K63 were stored in our labs. Site-directed point mutagenesis of TBK1 and Frk was performed using the QuickMutation™ Plus Mutagenesis Kit (D0208, Beyotime) according to the manufacturer’s instructions.

Mice peritoneal macrophages, RAW264.7, HEK293T, and Vero cells were maintained in Dulbecco’s modified Eagle’s medium (SH30022.01, HyClone) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (SH30406.05, HyClone) and 100 U/mL penicillin and streptomycin (SV30010, HyClone). HSV-1, and VSV were obtained from Dr. B. Ge (Tongji University, Shanghai, China).

To prepare mice peritoneal macrophages, 6-week-old homozygous Frk^–/– mice and their WT littermates were injected with 2 mL of 4% Brucella Broth. Three days later, peritoneal lavage fluid was collected from the mice, and the cells were washed three times with phosphate buffered saline (PBS). Peritoneal macrophages were cultured in DMEM supplemented with 10% FBS and 100 U/mL penicillin and streptomycin.

VSV and HSV-1 were collected from the supernatants of infected Vero cells. For in vitro infection, RAW264.7, HEK293T, and peritoneal macrophages (2 × 10⁶ cells) were cultured in DMEM for 12 h and infected with VSV (MOI = 1) or HSV-1 (MOI = 5) for the indicated times. For in vivo infection, 6-week-old male homozygous Frk^–/– mice and their WT littermates were infected with VSV (5 × 10⁷ PFU per mouse) by intravenous injection for 24 h.

HEK293T cells were transiently transfected with polyethylenimine (23966-2, Polysciences) according to the manufacturer’s protocol. RAW264.7 cells were transfected with INVI DNA RNA Transfection Reagent (IV1216025, Invigentech). For Frk knockdown, HEK293T cells were transfected with 10 μg pSPAX2, 5 μg pMD2.G, and 10 μg of shFrk or control vectors using Lipofiter™ (HB-TRLF, Hanbio). Supernatants contained virions were collected at 48 h and 72 h after transfection and virions were isolated by ultracentrifugation. The viral titer was determined via TCID50 assay in HEK293T cells by observing GFP fluorescence. Frk-specific shRNA (5′-GATCCGCGGCCAACATTTGAGACCCTGCATTTTCAAGAGA AATGCAGGGTCTCAAATGTTGGCCGTTTTTTG-3′) and control shRNA (5′- GATCCGTTCTCCGAACGTGTCACGTAAT TCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC-3′) were used to knock down Frk in RAW264.7 cells.

Small interfering RNAs (siRNAs) were transfected with jetPRIME (101000027, Polyplus). For Frk interference in RAW264.7 cells, the Frk-specific siRNA was purchased from Santacruz (sc-39232). For Frk interference in HEK293T cells, the target sequence for Frk employed in this study is as follows: 5′-GGAGUACCUAGAACCCUAUTT-3′.

Cells were incubated for 12 h without serum and infected with viruses for the indicated time. Total RNA was extracted using RNAiso Plus (9109, Takara) according to the manufacturer’s instructions. RNA (1 μg) was reverse transcribed using a PrimeScript™ RT Reagent Kit (RR037, Takara) to generate cDNA. TB Green^® Premix Ex Taq™ II (RR820A, Takara) was utilized for quantitative real-time RT-PCR analysis. All values were normalized to the level of GAPDH mRNA, and relative expression was calculated using the comparative cycle threshold (2^–ΔΔCT) method. Specific primers used for RT–PCR assays are listed in Supplementary Table 1.

Cells were incubated for 12 h without serum and infected with viruses for the indicated time. A Mice IFN-beta ELISA Kit (42400-1, R&D systems) was used to measure immunoreactive IFN-β in supernatants from RAW264.7 cells.

For immunoprecipitation, HEK293T cells were transfected with the indicated plasmids. After 48 h, the cells were washed three times with ice-cold PBS. The cells were lysed in lysis buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1% Triton X-100, and 1 mM EDTA, pH8.0) supplemented with a protease inhibitor cocktail (04693159001, Roche), 1 mM PMSF, 1 mM Na3VO4, and 1 mM NaF. After 30 min on ice, the lysates were centrifuged for 15 min at 13,200 rpm and 4°C to remove debris. The cell lysates were incubated with anti-Flag M2 Affinity Gel or anti-HA Magnetic Beads at 4°C overnight. For immunoprecipitation of endogenous proteins, peritoneal macrophages or RAW264.7 cells were lysed, and the lysates were incubated with specific antibodies and Protein G Sepharose 4 Fast Flow at 4°C overnight. The Sepharose samples were centrifuged and washed three times with ice-cold PBST (1% Triton X-100 in PBS). For immunoblotting, the precipitates or cell lysates were boiled in 1× SDS loading buffer at 100°C for 10 min and then analyzed via immunoblot assay.

GST fusion proteins were expressed in E. coli BL-21(DE3) (CB105-01, Tiangen Biotech) according to the manufacturer’s instructions. The lysates from RAW264.7 cells were incubated with GST-fusion proteins conjugated to glutathione beads at 4°C for 4 h. After centrifugation and washing three times with ice-cold PBS, the beads were incubated in 1× SDS loading buffer at 100°C for 10 min and then analyzed via immunoblot assay.

HEK293T cells were transiently transfected with IFN-β-Luc, pRL-TK, and other vectors as indicated for 24 h. A Dual-Luciferase Reporter Assay System (RG028, Beyotime) was used to detect luciferase activity according to the manufacturer’s instructions.

HEK293T cells were transfected with the appropriate plasmids for 48 h and infected with HSV-1 or VSV for the indicated times. Peritoneal macrophages were infected with viruses directly. Cells were fixed with 4% formaldehyde for 20 min at room temperature, permeabilized for 30 min in PBS containing 0.3% Triton X-100, and then blocked for 1 h at 4°C in a blocking buffer (1% BSA in PBS). Subsequently, the cells were incubated with the indicated primary antibodies at 4°C overnight and secondary antibodies at room temperature for 1 h. After staining with DAPI, images were obtained using a Confocal Microscope ZEISS LSM 780.

The phospho-tyrosine of TBK1 was analyzed using PTMcode 2 online tools at the following website: https://ptmcode.embl.de/index.cgi.

Data are expressed as mean ± standard error of the mean (SEM). GraphPad Prism7 was used for statistical analysis. The statistical tests conducted in this study are indicated in the figure legends as follows: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, two-tailed unpaired Student’s t-test. The sample sizes, reproducibility of experiments and the statistical tests used are presented in the figure legends. ZEN 2.1 on Zeiss LSM 780 confocal laser microscopy system was used for immunohistochemistry data collection and analysis. CFX Manager Software v3.0 on BioRad CFX96 Touch was used for qRT-PCR data collection and analysis. Bio-Rad ChemDoc Touch was used for western blot data collection and analysis.

To investigate the function of Frk in the antiviral innate immune response, Frk, Lyn and Src were transfected into HEK293T cells and subjected to the infection with VSV and HSV-1, followed by a dual-luciferase assay. The results demonstrated a significant enhancement of the IFN-β luciferase signal upon overexpression of Frk and Src (Figures 1A, B). Src is known to facilitate IFN-I signaling (Li et al., 2017), suggesting that Frk may similarly operate within IFN-I pathways. Next, we analyzed Frk gene expression using the GEO database (Bajwa et al., 2016; Nissim et al., 2012), the analysis revealed diminished Frk mRNA levels in both hepatitis B virus (HBV)-associated acute liver failure patients and influenza-stimulated human plasmacytoid dendritic cells (Supplementary Figures 1A, B). These findings implied that Frk may play a role in the physiological and pathological processes associated with virus infection. Therefore, we transfected HEK239T cells with either a negative control siRNA or Frk-specific siRNA and observed a decrease in Frk expression following transfection with Frk-specific siRNA (Supplementary Figure 1C). As expected, we observed decreased mRNA levels of IFNB and CXCL10 in Frk knockdown HEK293T cells compared to the control cells (Supplementary Figures 1D, E). Additionally, there were increased levels of VSV mRNA or HSV-1 genomic DNA in the knockdown cells (Supplementary Figure 1F). To further confirm the function of Frk, we achieved Frk knockdown in RAW264.7 cells via short hairpin (sh)RNA transfection (Figure 1C). Upon stimulation with VSV or HSV-1, significantly impaired mRNA expression of ifnb and cxcl10 was observed in Frk-knockdown macrophages as compared to their control counterparts (Figures 1D, E). Consistently, Frk knockdown significantly reduced IFN-β production and increased the viral replication in RAW264.7 cells post-infection (Figures 1F, G). Taken together, these results suggested that Frk may play an important role in promoting IFN-β signaling in response to viral infection.

To identify the direct target molecule of Frk in IFN-β signaling, we conducted a coimmunoprecipitation screening experiment and found that Frk exhibited a high affinity for TBK1 and IRF3 (Figure 2A). Furthermore, dual-luciferase assay results indicated that Frk overexpression enhanced IFN-β luciferase activity induced by RIG-I-N, MAVS, STING, and TBK1, with no effect on IRF3 (Figure 2B). Subsequent experiments demonstrated that Frk dose-dependently enhanced IFN-β and Interferon Stimulated Response Element (ISRE) luciferase activity mediated by TBK1 (Figure 2C). These results suggested that Frk may target TBK1 to enhance IFN-β signaling. The interaction between Frk and TBK1 was further confirmed by both forward and reverse co-immunoprecipitation (Co-IP) experiments (Figure 2D). A GST pulldown assay revealed that Frk directly interacts with endogenous TBK1 in peritoneal macrophages (Figure 2E). Furthermore, immunofluorescence confocal microscopy demonstrated efficient colocalization of Frk with TBK1 post-viral infection (Figure 2F). These findings suggested that the activation of IFN-β signaling by Frk is likely through its interaction with TBK1.

Given that Frk interacts with TBK1, we examined whether Frk enhances IFN-β expression through TBK1 in virus-infected macrophages. WT and TBK1^–/– RAW264.7 cells were transfected with either a control vector or Frk. Frk overexpression in WT RAW264.7 cells significantly elevated the IFN-β mRNA expression levels and inhibited the replication of VSV and HSV-1, otherwise in TBK1^–/– RAW264.7 cells (Figures 3A, B), suggesting that Frk primarily targets TBK1 to modulate the IFN-β signaling pathway.

Considering Frk is a protein tyrosine kinase, we assessed the role of its kinase activity in TBK1-mediated signaling. Frk becomes kinase-deficient when the lysine at position 262 in its ATP binding site is mutated to arginine (hereafter referred to as Frk-KD) (Jin and Craven, 2014). Thus, we transfected RAW264.7 and HEK293T cells with either Frk or Frk-KD, followed by infection with VSV or HSV-1, respectively. The results indicated that Frk-KD did not significantly increase the mRNA expression of ifnb/IFNB and cxcl10/CXCL10 (Figures 3C, D and Supplementary Figures 2A, B). Furthermore, we found that viral replication was suppressed in cells overexpressing Frk, whereas no such inhibition was seen in cells overexpressing Frk-KD (Figure 3E and Supplementary Figure 2C). These findings suggested that Frk’s promotion of TBK1-mediated IFN-β signaling is dependent on its kinase activity.

To ascertain whether Frk phosphorylates TBK1 during infection and to elucidate the mechanism, we infected RAW264.7 cells with VSV and HSV-1. The results showed that Frk overexpression significantly increased tyrosine phosphorylation of TBK1 (Figures 4A, B). To pinpoint the specific tyrosine residues phosphorylated by Frk, we analyzed the potential tyrosine phosphorylation sites of TBK1 by using PTMcode 2: https://ptmcode.embl.de/index.cgi. Afterward, we generated TBK1 mutants with six conserved tyrosine residues replaced by phenylalanine (Y → F) (Supplementary Table 2) (Minguez et al., 2013). Immunoprecipitation following co-transfection of these TBK1 mutants with Frk in HEK293T cells revealed that TBK1(Y174F) and TBK1(Y179F) displayed significantly lower phospho-tyrosine levels (Figure 4C) and indicating that both Y174 and Y179 could be phosphorylation sites of Frk. Moreover, TBK1-mediated IFN-β luciferase activity was diminished following substitution with either TBK1(Y174F) or TBK1(Y179F) (Figure 4D). However, Frk was still able to enhance IFN-β luciferase activity mediated by TBK1(Y174F) or TBK1(Y179F), suggesting that the phosphorylation of Y174 and Y179 both play crucial roles in Frk-mediated IFN-I pathway (Figure 4E).

Next, we created a dual mutant, TBK1(Y174/179F), which showed no detectable tyrosine phosphorylation when catalyzed by Frk (Figure 5A). Therefore, we further investigated the regulation of Frk-mediated Type I interferon pathway by the two sites, respectively. Previous reports have demonstrated that TBK1 recruits and phosphorylates IRF3 to activate the IFN-I pathway (Hosoya et al., 2005), and K63-linked ubiquitination of TBK1 also facilitates this process (Song et al., 2016). We found that the phosphorylation of Y179 on TBK1 promoted its K63-linked ubiquitination (Figures 5B–D), while the phosphorylation of Y174 on TBK1 mediated the recruitment of IRF3 to TBK1 (Figures 5E–G). Xuelian Li et al. determined that phosphorylation of TBK1 at Y179 is important for autophosphorylation of TBK1 at Ser - 172, which is required for TBK1 activation (Li et al., 2017). Consistent with this, we found that the phosphorylation of tyrosine on TBK1 mediated by Frk also mediates the phosphorylation of TBK1 at Ser-172 (Supplementary Figure 3). Subsequently, we complemented TBK1 and TBK1(Y174/179F) into TBK1^–/– RAW264.7 cells in the presence of Frk. Western Blot results showed that the expression of the transfected TBK1 and TBK1(Y174/Y179F) was successful (Figure 5H). Following virus infection, we observed the restoration of IRF3 phosphorylation and IFNB mRNA expression in cells complemented with TBK1, with further enhancement upon Frk overexpression. Conversely, cells complemented with TBK1(Y174/179F) did not demonstrate a comparable rescue effect (Figures 5I–L). Consistently, Frk improved the efficiency of viral replication restriction via TBK1, with no such effect seen with TBK1(Y174/179F) (Figures 5M, N). Collectively, these data indicated that Frk facilitates TBK1-mediated IFN-β signaling through the phosphorylation of Tyr174 and Tyr179 on TBK1.

To further elucidate the role of Frk in IFN-β production, peritoneal macrophages isolated from wild-type (WT) and Frk knockout (Frk^–/–) mice were infected with VSV or HSV-1. The results showed that virus-induced IFN-β production was substantially diminished, and viral replication was markedly enhanced in Frk^–/– macrophages (Figures 6A–F). Likewise, phosphorylation of IRF3 was also compromised in Frk^–/– macrophages (Figures 6G, H). Subsequently, the in vivo antiviral efficacy of Frk was examined using an intravenous viral injection model. In alignment with the in vitro findings, IFN-β secretion in the lungs was significantly diminished in Frk^–/– mice relative to wild-type mice following VSV or HSV-1 infection, concurrent with elevated viral replication (Figures 6I–N). In addition, Frk^–/– mice exhibited more severe lung injuries (Figure 6O). These in vitro and in vivo data indicated that Frk is an important positive regulator for antiviral immune responses.