The pET-28a plasmid, preserved in our laboratory, was used to express the 56 kDa protein of the O. tsutsugamushi. The myeloma cell line SP2/0 was also stored in our laboratory. The L929 cell line infected with the SJ and PT strains of O. tsutsugamushi was preserved in our laboratory. Female BALB/c mice (SPF grade), aged 6–8 weeks, were purchased from the animal center of SpeedBio Company [Animal Production License No. SCXK (Beijing) 2019-0010; Animal Use License No. SYXK (Beijing) 2019-0030]. All mice were housed in the animal experimental room of Nanjing Pharmaceutical Biotechnology (Gene) Technology Center under standard conditions: temperature (24 ± 0.5) °C, humidity (55 ± 5) %, and a 12/12-h light/dark cycle. The study was approved by the Experimental Animal Ethics Committee of Nanjing Pharmaceutical Biotechnology (Gene) Technology Center.

The amino acid sequences of the 56 kDa proteins from different strains of Orientia, including Gilliam, Karp, Kato, Sj, Pt, Kawasaki, and Young worl, were aligned using BioEdit software, and a conserved region spanning amino acids 170–400 was identified. Specific primer pairs were designed using Primer Premier 5: F: ATGGGTCGCGGATCCGAATTC AATCCTCAGCTTGATCATG; R: TCTCGAGTGCGGCCGCAAGCTTATCTTCTTCTTGTTGAGCAG. DNA extracted from SJ Orientia-infected cell lines was used as a template to amplify the 717 bp target fragment by PCR. The fragment was cloned into the EcoR I and Hind III restriction sites of the pET-28a plasmid vector to prepare the recombinant plasmid. After induction and expression, the recombinant protein was purified using QIAGEN Ni-NTA Agarose, and its activity was verified by Western blot and indirect ELISA.

The previously prepared recombinant outer membrane protein of the 56 kDa Gilliam strain of Orientia (Cao et al., 2007) was injected subcutaneously at multiple sites into three mice (6–8 weeks old), with 1 mouse serving as a negative control. For the initial immunization, Freund’s complete adjuvant was used as the emulsifier, and the immunization dose was 100 μg per mouse. A total of three immunizations were performed, with a 15-day interval between each. Except for the first immunization, which was administered subcutaneously at multiple sites, the other two immunizations were administered intraperitoneally using Freund’s incomplete adjuvant as the emulsifier. Fifteen days after the third immunization, blood was collected from the tails of the mice, and the serum titers were detected using an indirect ELISA method with the 56 kDa recombinant outer membrane protein of Gilliam strain as the coating antigen. Mice with high titers were selected for booster immunization 3 days before cell fusion, with an intraperitoneal injection of 100 μg of recombinant protein. After the booster immunization, the mice were euthanized, and immune splenocytes and myeloma cells were obtained for cell fusion. After 3–4 rounds of subcloning, stable monoclonal cell lines were obtained and expanded. Approximately 1 × 10⁶–5 × 10⁶ cells were inoculated into the abdomen of each mouse. The ascites were purified using Protein G affinity chromatography columns, and the titers of the purified ascites were detected using an indirect ELISA method.

Using the 56 kDa conserved region BS-717 recombinant protein as the screening antigen, hybridoma cell lines that specifically recognized the BS-717 protein were screened by indirect ELISA. The obtained monoclonal antibody (mAb) was further purified and identified by ELISA and Dot ELISA. Dot-ELISA was performed as follows: nitrocellulose (NC) membranes were cut into 1 × 1 cm squares and placed in a 24-well plate. Five microliters of recombinant protein, disrupted Pt-infected cell suspension, Sj-infected cell suspension, and L929 cell suspension were pipetted onto the center of the NC membranes, respectively, and dried at 37°C for 20 min. Five hundred microliters of blocking solution was added, and the membranes were oscillated at 37°C for 1 h for blocking. Afterward, the membranes were washed three times with PBST for 5 min each. The mAbs were diluted 1,000-fold in blocking solution and added to the 24-well plate at 200 μL/well. The plates were oscillated at 37°C for 1 h, followed by washing with PBST. Then, HRP-conjugated goat anti-mouse secondary antibody diluted 2000-fold was added to the wells at 200 μL/well and oscillated at 37°C for 1 h, followed by washing with PBST. After thorough washing, excess liquid was removed, and 20 μL of DAB color developing solution was pipetted onto the center of the NC membranes. The reactions were allowed to proceed in the dark for 10 min. After the reaction, the membranes were washed three times with distilled water, and excess liquid was removed. Brownish yellow spots on the membranes indicated positive results, while the absence of spots indicated negative results. The disrupted L929 cell supernatant served as a negative control, the 56 kDa recombinant protein served as a positive control, and the Pt and Sj-infected cell strains of Orientia served as detection antigens.

Colloidal gold was prepared using the sodium citrate reduction method of chloroauric acid. A rotor soaked in aqua regia was placed in a conical flask, and the rotation speed was adjusted to stir the liquid evenly. The final concentration of chloroauric acid was adjusted to 0.01% using ultrapure water. The chloroauric acid solution was brought to a boil, and the flask mouth was covered with aluminum foil. Sodium citrate was then added, and the mixture was heated for 30 min. During this process, the color changed from yellow to gray-black and finally to wine red. The solution was then cooled to room temperature. The colloidal gold solution was characterized using a UV–visible spectrophotometer (450–600 nm) and transmission electron microscopy (TEM).

To establish the optimal pH, the sodium chloride disruption method is employed. Eight 1.5 mL centrifuge tubes are prepared, each containing 1 mL of the prepared colloidal gold solution. The pH of these solutions is adjusted to 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9.0 using 0.1 M K₂CO₃, while the eighth tube containing the untreated colloidal gold solution serves as a blank control. An excess of polyclonal antibody is added to each tube, followed by vigorous shaking to ensure homogeneous mixing. The tubes are then allowed to stand at room temperature for 15 min. Next, 100 μL of 10% NaCl solution is added to each tube, and the mixtures are left undisturbed at room temperature for 2 h. During this period, the color of each solution is observed. The minimum pH that results in a solution color closest to the original color of the colloidal gold without any aggregation or precipitation is selected as the optimal pH. This optimal pH ensures the stability of the colloidal gold and promotes effective antibody binding, critical for the subsequent immunological reactions.

With adjusted optimum pH, eight 1.5 mL centrifuge tubes are prepared, each containing 1 mL of the prepared colloidal gold solution. The pH of the colloidal gold solution in each tube is adjusted to the optimal pH using 0.1 M K₂CO₃. Subsequently, 40, 35, 30, 25, 20, 15, 10, and 5 μg of polyclonal antibody are added to each tube, respectively. The mixtures are thoroughly mixed and allowed to stand at room temperature for 15 min. Following this, 100 μL of 10% NaCl solution is added to each tube, and the tubes are left undisturbed for 2 h. When an excessive amount of protein is added, the color of the solution remains unchanged. Conversely, when the protein amount is insufficient, the solution turns blue and aggregation occurs. Therefore, the protein concentration at the intersection of these two phenomena is selected. To ensure optimal stability and sensitivity, an additional 10% of this protein concentration is added, resulting in the determination of the optimal protein labeling amount.

The colloidal gold solution was adjusted to the optimal pH and stirred using a magnetic stirrer. The anti-Gilliam 56 kDa polyclonal antibody at the optimal protein concentration was added to the colloidal gold solution, and the mixture was stirred for 30 min using the magnetic stirrer. Subsequently, 1% PEG-20000 was added, and stirring was continued for another 30 min. Then, 10% BSA solution was added, and stirring was continued for 30 min to block non-specific binding sites. The solution was transferred to a centrifuge tube and stored overnight in a 4°C refrigerator. The next day, the solution was centrifuged at 12,000 rpm for 20 min, and the supernatant was discarded. The gold-labeled precipitate was dissolved in one-tenth of the original volume of resuspension solution and stored at 4°C.

Each 3 mm × 60 mm strip consists of five components: a polyvinyl chloride (PVC) support plate, a nitrocellulose (NC) membrane, an absorbent pad, and a conjugate pad (Figure 1A). The NC membrane is adhered to the center of the PVC support plate. An anti-56 kDa monoclonal antibody (0.5 mg/mL) is sprayed onto the test region (“T”) at a speed of 1 μL/cm, and goat anti-rabbit (0.5 mg/mL) is sprayed onto the control region (“C”) at the same speed using an automatic benchtop fine sprayer (Autokun, Hangzhou, China). These regions are located in the middle of the NC membrane, with a distance of 4 nm between them. The membrane is then dried at 37°C for 4 h, sealed in a plastic bag, and stored in a desiccator at room temperature (as shown in Figure 1A). The sample pad and absorbent pad are attached to one end of the PVC support plate, overlapping the NC membrane by 2 mm. The prepared strips are stored at room temperature in a plastic box containing silica gel desiccant.

In the assay, 30 μL of sample solution is applied to the sample pad. Then, due to capillary action, the solution migrates through the nitrocellulose (NC) membrane towards the absorbent pad. When the liquid passes through the test line (T line), the O. tsutsugamushi in the sample solution that has already bound to the colloidal gold anti-56 kDa polyclonal antibody is fixed on the membrane by the anti-56 kDa monoclonal antibody. The liquid continues to migrate to the control line (C line), where the colloidal gold anti-56 kDa polyclonal antibody is fixed by goat anti-rabbit IgG. After approximately 15 min, the presence of red bands on both the T and C lines can be observed visually. As shown in the Figure 1B, the presence of two red bands indicates a positive result for scrub typhus. The absence of a red band at the T line indicates a negative result. The C line, which serves as a control for the assay, must show a red band regardless of whether the T line is red or not; if there is no red band on the C line, the test is considered invalid.

As O. tsutsugamushi is an intracellular parasitic bacterium, its cultivation and isolation process being time-consuming and complex, making it extremely difficult to count and quantify. This study aims to construct a standard curve using qPCR and then establish a relationship between the number of infected cells and the copy number of O. tsutsugamushi based on this standard curve, ultimately determining the detection limit of the colloidal gold immunochromatographic test strip.

Establishment of a qPCR standard curve for O. tsutsugamushi. A recombinant plasmid containing the 56 kDa fragment of O. tsutsugamushi, preserved in our laboratory, was used to calculate its copy number and then subjected to a 10-fold gradient dilution, with eight dilutions (10⁻¹ to 10⁻⁸) serving as templates for qPCR. Six parallel reactions were performed for each gradient, qPCR was conducted under the conditions specified in Supplementary Table S3. The qPCR amplification was performed using primers Ot-F: 5′-GGAGGTGAGATAAAGGC-3′ and Ot-R: 5′-ATAGTCAATACCAGCACAA-3′. The reaction data were read using LightCycler^® 96 SW to determine the linear relationship.

Establishment of the relationship between O. tsutsugamushi copy number and cell count. Sj and Pt cells were cultivated until the cell culture flask was completely covered. All cells were scraped off and centrifuged at 1,500 rpm for 5 min. The supernatant was discarded, and the cells were resuspended in 1 mL of PBS, 20 μL of the suspension was taken for observation and counting using a hemocytometer. A 10-fold gradient dilution of the counted cells was performed with PBS for DNA extraction. qPCR was conducted on the extracted DNA, and the relationship between cell count and copy number was determined based on the standard curve, enabling quantitative analysis of the number of O. tsutsugamushi cells.

The specificity of colloidal gold immunochromatographic test strips was evaluated using Escherichia coli, Salmonella, Staphylococcus aureus, and Listeria monocytogenes.

To determine the stability of the colloidal gold immunochromatographic test strips, they were sealed and stored at room temperature for 7 days, 1 month, 2 months, and 3 months, respectively. At each time point, the test strips were retrieved, and their stability was verified using samples.

Each experiment was performed with three replications. Data were analyzed by a two-tailed, unpaired t-test. A p-value of <0.01 was considered highly significant.

The amino acid sequences of the 56 kDa protein from the prevalent standard strains and local strains of O. tsutsugamushi in China were aligned using ESPript 3.0 software, and the results are shown in Figure 2. The amino acid sequence within the region marked by a black line (170–400) was selected as the target protein for experimentation. The gene encoding this regional protein was cloned into the pET-28a plasmid to obtain the recombinant plasmid. After induction and expression, SDS-PAGE analysis revealed a 32 kDa target band (Supplementary Figures S1A,B). Western blot results (see Supplementary Figures S1C,D) and ELISA results (see Supplementary Table S1) indicated that the recombinant protein specifically reacted with sera from patients with scrub typhus caused by O. tsutsugamushi but did not react with negative sera, suggesting that this conserved protein possesses biological activity.

After the cell fusion process, six hybridoma cell lines secreting antibodies against the Gilliam 56 kDa protein were successfully isolated through four rounds of subcloning, followed by purification and identification procedures (refer to Supplementary Figure S2 for details). To further refine the selection, a conservative region protein, Sj-717, was employed in an ELISA-based screening method to identify a specific hybridoma cell, designated as 5B3, capable of secreting antibodies that specifically recognized this conserved region (Supplementary Figure S3). The 5B3 was furtherly purified (Supplementary Figure S4) and identified (Supplementary Table S2).

Subsequently, the binding capability of the 5B3 monoclonal antibody (mAb) towards Orientia strains was rigorously evaluated using Dot ELISA. The experimental outcomes, as presented in Figure 3, reveal that upon utilizing the 5B3 mAb to detect Pt and Sj Orientia-infected cell lines, distinct yellowish-brown spots emerged on the nitrocellulose membrane (NC), mirroring the positive control pattern. Conversely, no such bands were observed in the negative control, confirming that the 5B3 mAb exhibits robust reactivity towards Orientia-infected strains. This discovery underscores the potential of the 5B3 mAb as a valuable diagnostic tool for the development of rapid immunological detection methods.

The size and uniformity of colloidal gold particles significantly impact the sensitivity of assays (Frens, 1973). In this study, a colloidal gold solution was prepared using the citrate trisodium reduction method of chloroauric acid, resulting in a clear, transparent, and wine-red solution without any suspended particles or precipitates, consistent with the expected wine-red color (Figure 4A). The particle size distribution of the colloidal gold can be preliminarily evaluated using ultraviolet (UV) full-wavelength scanning. A higher absorption peak indicates larger particle sizes, while a smaller peak width-to-height ratio signifies better size uniformity. The UV-visible spectrophotometer was employed to detect the maximum absorption peak, which was found to be at 521 nm, with a relatively narrow peak width, indicating the uniformity of the synthesized colloidal gold particles (Figure 4B).

Transmission electron microscopy (TEM) scanning revealed well-formed, spherical colloidal gold particles without overlapping or aggregation (Figures 4C,D). The particle size was measured using ImageJ software, confirming an average diameter of 20 nm. The prepared gold particles exhibited uniform size and excellent dispersion, making them suitable for specific detection applications.

To investigate the specificity of this method, four common pathogenic bacteria, including Escherichia coli, Salmonella, Staphylococcus aureus, and Listeria monocytogenes, were cultured to a concentration of 1 × 10⁷ CFU/mL. The samples were then added to the prepared colloidal gold immunochromatographic test strip for detection. Repeated experimental results showed that no bands appeared on the T-line of the test strip for all four pathogenic bacteria, indicating negative detection results for these pathogens (Figure 8). This demonstrates that the prepared colloidal gold test strip detection method has good specificity. The test strips, which can be stored at room temperature for up to 10 months, showed consistent results with previous experiments after equilibrating for 30 min and applying the sample to the sample pad, indicating good stability of the test strips.