In three northern Karnataka districts, namely, Bagalkote, Kalaburagi, and Vijayapura, during rabi in 2017–18, rhizosphere soil samples (n = 50) were obtained from crops including chickpea, pigeon pea, and maize. A total of 10 g of rhizosphere soil was transferred to a 250 mL conical flask containing 90 mL of sterile distilled water and vortexed for approximately 5 min. After that, 0.1 mL of the 10⁻⁵ and 10⁻⁶ dilutions were added to the respective media plate (Nutrient agar). The plates were placed in a BOD incubator and kept at 28°C for 48 h (Nagaraju et al., 2021), and the typical bacterial colonies were selected and purified by four-way streaking.

The sorghum seeds (M-35-1, 70% germination percentage) were tested for germination using the paper towel technique indicated by ISTA guidelines (Anonymous, 1999). The test was performed using 100 seeds per blotting paper with three replications. In a nutshell, 100 sorghum seeds weighing on average 3.9 g were surface-sterilized with 0.1% HgCl₂ (mercuric chloride, w/v) for 2 min, followed by three washes with sterile distilled water. The seeds were treated with test cultures of 24 h old with less than 10⁹ cfu/mL for 10 min. A reference strain (Pseudomonas fluorescens) was employed as a control. In the cabinet seed germinator, germination paper with treated seeds was incubated in the slanting position. The germination test was conducted at a constant temperature of 25 ± 2°C and a relative humidity of 95 ± 1% (%). The percentage (%) was calculated based on the number of germinated seeds. As a control, seeds were treated with sterile distilled water. After 7 days of seeding, the root length, shoot length, and germination percentage were measured (Dasgupta et al., 2015). Refer to Supplementary Table 1 for further information.

After the seventh day of incubation, five seedlings were randomly chosen from each treatment. Root and shoot lengths were measured using a gradient scale from the tip of the primary root to the base of the hypocotyl, and the shoot length was measured from the tip of the primary leaf to the base of the hypocotyl (cm). For measures of root and shoot length, five healthy seedlings were chosen at random. The vigor index was determined by multiplying the germination percentage by the average root and shoot lengths (Abdul and Anderson, 1973).

Based on the profile of the potential to enhance seed germination, the five best test isolates were chosen for further research. The colonies were moved to nutrient agar slants and were morphologically and biochemically characterized (Cappuccino and Sherman, 1992); the details may be found in Supplementary Tables 2, 3. Under in vitro circumstances, the properties of the five rhizosphere microorganisms, namely, PG-145, PG-148, PG-152, PG-178, and PG-197 that promote plant development were assessed. The production of indole acetic acid (Gordon, 1951), gibberellic acid (Paleg, 1965), P-solubilization, potassium release, Zn solubilization (Nagaraju et al., 2017, 2021), and HCN production (Castric and Castric, 1983) are all included in the functional characterization.

The IAA generation of test isolates was assessed using active cultures that had existed for 24 h. The test isolates were grown separately in tubes filled with 5 mL of nutrient broth and incubated for the specified time and temperature. These cultures underwent a 10-time, 10,000 rpm centrifugation procedure after incubation. A 2 mL of Salkowski reagent was added to the supernatant, and the development of color was regarded as positive for IAA generation after 30 min of incubation.

A test tube containing 2 mL of zinc acetate and 25 mL of the fresh culture supernatant was used. After 2 min, 2 mL of potassium ferrocyanide was added, followed by a 15-min centrifugation at 10,000 rpm. Then, 5 mL of this supernatant was mixed with 5 mL of 30% hydrochloric acid, and the mixture was then incubated at 20°C for 75 min. Next, 5% HCl was used to treat the control sample. In a UV–Vis spectrophotometer, the absorbance of the samples and the control was measured at 254 nm (Paleg, 1965). The gibberellic acid concentration was determined using a standard curve and was expressed in g/ml of medium.

The broth culture was centrifuged in a centrifuge tube at 10,000 rpm for 10 min to separate the supernatant from the cell mass and insoluble phosphate (tricalcium phosphate) (Pikovskaya, 1948). The phosphomolybdic blue color technique (Jackson, 1973) assessed the amount of soluble P in the supernatant by measuring the blue color using a spectrophotometer at 610 nm after 15 min. After 5 days of inoculation, the quantity of Pi released in the broth was calculated compared to a control group that had not been inoculated.

The isolates were tested for their capacity to release potassium from insoluble potassium sources, such as mica (alumino silicate), added to Aleksandrov’s medium. A 10 μL spot of overnight-grown culture was added to each plate, and it was then incubated at 28 ± 2°C for 2 to 3 days (Nagaraju et al., 2017). The isolates with a distinct solubilization zone surrounding the colony were identified as potassium solubilizers. The observations were made up to 7 days after inoculation.

The test isolates were examined using the Tris minimum medium supplemented with 0.1% zinc oxide to determine their capacity to solubilize the inorganic zinc from the zinc oxide. (ZnO, calamine, or zinc white). Then, 10 μL of the test isolates’ overnight-grown culture were spotted onto the solid medium. Zinc was considered soluble in the isolates, with a clear zone surrounding the colony on the medium (Nagaraju et al., 2017). We measured and indicated the diameter of the solubilization zone in mm.

The N₂-free malate broth was used to test the strains’ ability to fix nitrogen. A total of 1 mL of culture that had been grown for 24 h was added to the broth, and it was then incubated at 37°C for 7 days. The culture was homogenized, and 10 mL of it was digested using 5 mL of concentrated H₂SO₄ and 0.2 g of a K₂SO₄: CuSO₄: selenium (100, 10:1) digestion catalyst combination. After cooling, distilled water was added to bring the level to 10 mL. Later, 20 mL of 40% NaOH was added to an aliquot of 10 mL, then transferred to a micro-Kjeldhal distillation unit, and distilled. Then, 0.066 g of bromocresol green and 0.033 g of methyl red were added to 100 mL of methanol, and a 4% boric acid mixed indicator was used to trap ammonia until the solution changed pink to green. To assess the total nitrogen content of the culture, it was titrated against 0.01 N H₂SO₄; the findings were represented as mg N₂ fixed per g of malate (Ashraf et al., 2011).

The hydrogen cyanide (HCN) test was carried out using nutritional agar plates with 3% NaCl. Each test isolate’s pure culture was injected in 1 mL portions on individual media plates. A disk of Whatman filter paper No. 1 impregnated with an alkaline picric acid solution (0.5% picric acid (w/v) in 1% sodium carbonate) and sized to fit a Petri plate was placed in the upper lid of the inoculated while maintaining aseptic conditions. The plates were wrapped with parafilm to avoid the losses of HCN, and the control plate did not receive the inoculum. The plates were incubated at 28 ± 2°C for 48–72 h in a BOD incubator. HCN production was assumed to be indicated by a change in color from yellow to light brown, moderate, or reddish solid brown (Castric and Castric, 1983). Each experiment was repeated three times, and controls were kept.

Following the instructions provided by Schwyn and Neilands (1987) and Wei et al. (1991), respectively, siderophore production was determined. The overnight-grown cultures were inoculated into the chrome azurol S (CAS) agar media, and 10 μL of each culture was spotted on the media plates. The corresponding plates were incubated at 28 ± 2°C for 48 h. The formation of an orange-colored zone around the colony was considered positive for siderophore production. The orange zone’s diameter was measured for the qualitative evaluation.

The PGPR strains were evaluated in vitro using a dual culture approach described by Sakthivel and Gnanamanickam (1987) against two specific sorghum crop diseases, namely, Macrophomina phaseolina and Fusarium sp. The fungi were first cultivated on potato dextrose agar (PDA) plates until they completely covered the medium surface. Using a sterile cork borer, the fungal cultures (10 mm diameter) were transferred on fresh PDA plates and developed for up to 48 h. The test isolate was then parallel streaked over both sides of the fungal disk, leaving a 1.5 cm space from the plate’s border. The PDA dishes that had only been inoculated with pathogens served as the appropriate controls. The dishes underwent an additional 96-h incubation period at 30°C. The fungal growth diameter was measured on the control and test culture inoculated plates. The zone of inhibition (ZOI) of each fungal pathogen by different isolates was calculated using the following formula:

where,

I is the percent inhibition, C is the radial growth of the fungal pathogen in control, and T is the radial growth of the pathogen in treatment.

The efficacy of five effective plant growth-promoting bacterial isolates, namely, PG-145, PG-148, PG-152, PG-178, and PG-197, on the growth and yield of sorghum was examined in a pot culture experiment carried out during rabi in 2019–20. For the pot experiment, the University of Agricultural Sciences, Dharwad’s College of Agriculture, provided the black cotton soil (regur), which was then taken from there. The soil was placed in plastic containers and autoclaved at 121°C for 1 h at a weight of 15 lbs. (9 kg) (30 cm top diameter). The sorghum seedlings (var. M-35-1, duration: 125–135 days) were treated with the appropriate strains; more information on the treatment is provided in Supplementary Table 4. The inoculum production for seed bacterization was performed in a nutrient broth medium, and the broth was inoculated with the appropriate strains and incubated for 3 days at 28 ± 2°C. After being properly combined with talc powder in a 1:3 ratio, the cultures were air-dried for an entire night in a laminar airflow chamber before being utilized to treat the seeds (Weller and Cook, 1983).

Five treated seeds were planted in each pot when the treated seeds were planted. Following germination, trimming was done to keep just one plant in each pot, and constant watering was done throughout the experiment to keep the soil at the ideal moisture level. After 30, 60, and 90 days of planting, measurements, such as plant height, root and shoot dry weights, chlorophyll index (using a SPAD meter), and total dry weight, were recorded. Following the crop’s harvest, the grain yield was measured. The recommended dose of fertilizers for sorghum is 50:25:00 kg NPK per hectare, which was applied as urea and single superphosphate (SSP) to each treatment. The required quantity of fertilizer per pot was calculated, and 0.33 g of urea and 0.12 g of SSP were added to each pot to supply 50:25 Kg of N:P₂O₅ (per ha) on a soil weight basis as per the package of practices.

The isolates with growth-promoting attributes under pot culture conditions were further characterized using the 16S rDNA analysis. For this, the strains were grown 24 h in nutrient broth at 30°C in a BOD incubator. The genomic DNA of the rhizobacterial isolates and reference strains was isolated by following Sambrook and Russell (2001), and the 16S rRNA gene was amplified with a set of universal primers 27F (5’AGAGTTTGATCCTGGCTCAG3`) and 1492R (5’TACGGYTACCTTGTTACGACTT3’). The reaction mixture details are given in Supplementary Table 6. The quality of the DNA was evaluated using agarose gel electrophoresis. Later, polymerase chain reaction (PCR) was performed with 100 ng template DNA, 5 U Taq DNA polymerase, 1 mM dNTP, 10 pM primer each, and 25 mM MgCl₂ to make up a final volume of 20 μL (The reaction mixture details are given in Supplementary Table 5). Amplification was done in an Eppendorf Thermal Cycler (Supplementary Table 6). PCR-amplified DNA fragments of 1.3 kb products were analyzed for 16S rDNA sequencing using the Sanger sequencing method. The resulting contiguous DNA sequences were compared with the other sequences in the NCBI database using the Basic Local Alignment Search Tool (BLAST). The strains’ closest 16S rDNA gene sequences were retrieved from the www.ncbi.nlm.nih.gov database and aligned using Clustal_W, and the phylogenetic tree was constructed using the UPGMA method with MEGA X. The nucleotide sequences were deposited in the GenBank, and the accession numbers were obtained.

The data were analyzed in Minitab v.19.2, and the results were interpreted by following the guidelines of Pansey and Sukhatme (1985). The level of significance used in the F- and t-tests was p = 0.01. Critical difference values were calculated wherever the F-test values were significant. The molecular data were analyzed using MEGA-XI and Split Plot software.

Based on the BLAST similarity percentage, the isolates were identified as Bacillus subtilis (PG-152) and Enterobacter sp. (PG-197). The sequences were submitted to the NCBI GenBank with accession numbers CP0211231.1 and KY930712.1.

In northern Karnataka, specifically Bagalkote, Kalaburagi, and Vijayapura, a comprehensive and detailed study was carried out during rabi in 2017–18, and 50 samples of chickpea, pigeon pea, and maize rhizospheres were gathered (Figure 1). In total, 209 strains were isolated based on the variations in colony morphology. Following three additional purifications to validate strains, careful choices of various colonies were made based on the colony’s color, structure, and surface. According to purity, the strains were further identified into 197 isolates, each tested in vitro for its ability to improve sorghum seed germination under controlled conditions.

One of the main criteria for classifying the isolates as plant growth-promoting isolates is improving seed germination. Therefore, screening for isolates with improved seed germination abilities gained significance among the screening techniques. The current study employed 197 isolates, one reference, and one control for seed bio-priming (water treatment). Pseudomonas fluorescens treatment improved the germination percentage, which was 3.5% higher than the seeds treated with the PG-152 and PG-145 test isolates, which had encouraging germination rates of 82.5%. For the remaining isolates, the seeds germinated at a rate ranging from 85 to 50%, with a median of 70.50%. The examination of root length revealed that the longest root measured 8.32 cm, 5% shorter than the plants immunized with the reference strain (8.75 cm). The average shoot length in plants inoculated with PG-152 was 6% (or 13 cm) shorter than in plants inoculated with the reference strain (13.82 cm). Later, the seed vigor analysis was 5.6% lower than the plants vaccinated with the reference strain (1873.31). The control treatment results showed that, in comparison with effective culture treatments, the water treatment had little impact on improving seed germination. Based on the seed germination percentage and seed vigor index, five strains were selected for further studies, such as PG-145, PG-148, PG-152, PG-178, and PG-197. The results are presented in Figures 2, 3 and Supplementary Table 1.

The colony morphology of three isolates—PG-145, PG-148, and PG-152—and the reference strain (Pseudomonas fluorescens) was found to be round, whereas other strains produced colonies with irregular shapes. All colony features were examined and documented. In instances PG-145 and PG-152, the colony was milky white, whereas, in cases PG-178 and PG-197, it was yellowish. Both the Pseudomonas fluorescens reference strain and PG-148’s colonies were white. PG-145 had elevated colonies, PG-148, PG-152, and the reference strain had flat colonies, and PG-178 and PG-197 had convex colonies, according to reports on colony elevation. For PG-148, PG-178, and PG-197, the colony consistency was smooth; however, for PG-145 and PG-152, it was dry. Undulated colony margins were seen in the strains PG-145 and PG-152 but not in the reference strains PG-148, PG-178, or PG-197 (Pseudomonas fluorescens). Except for PG-152, all of the cells showed Gram negative responses and were rod-shaped, according to the measurements of cell morphology at the microscopic level. Endospore production was observed only in PG-152 (Supplementary Table 2).

The outcomes of the biochemical tests revealed heterogeneity. All isolates and reference strains passed the ammonia synthesis, citrate utilization, and oxidase tests but failed the indole production and lactose fermentation tests. Other isolates, including the reference strain (Pseudomonas fluorescens) other than PG-145, demonstrated positive starch hydrolysis. Except for PG-178, other isolates and reference strains (Pseudomonas fluorescens) were positive for casein hydrolysis and nitrate reduction. Except for two isolates (PG-178 and PG-197), other isolates and reference strains showed positive for gelatin hydrolysis, catalase, and urease tests. The information is given in Supplementary Table 3.

Most rhizosphere microbes create phyto-regulatory substances, which aid plants in coping with challenging situations and sustaining a healthy life cycle. These include screening for the elite isolates with indole acetic acid (IAA), gibberellic acid (GA), hydrogen cyanide (HCN), siderophores, phosphorous, zinc, and potassium solubilization. Tryptophan-fortified broth to estimate indole-3-acetic acid is produced by the test isolates, ranging from 12.00 to 20.17 g/mL. IAA production is present in all isolates, with Pseudomonas fluorescens (the reference strain) and PG-152 reporting the highest levels of IAA production (Bacillus subtilis).

All the strains, including the reference strain, produced gibberellic acid under in vitro conditions ranging from 0.42 to 2.69 μg/mL of broth. The phytohormone production was reportedly high in the isolate PG-152 (B. subtilis) strain with 2.14 μg/mL of broth under optimal growth conditions. In the phosphate solubilization test, all the isolates showed solubilization zones of phosphate on Pikovskaya’s agar medium. The zone of solubilization ranged from 3 to 7.5 mm, which falls under the FCO 1985 commercial biofertilizers requirements. The isolate PG-197 (Enterobacter sp.) showed the maximum zone of P solubilization (7.5 mm) and released the highest amount of P_i (4.45%) from TCP broth. The amount of inorganic phosphate (P_i) released from tricalcium phosphate in Pikovskaya’s broth after 5 days of inoculation (DAI) was quantified (Table 1). The percent P_i released by test isolates ranged from 0.91 to 4.45%. Among the isolates, PG-197 (4.45%) released the highest amount of inorganic phosphate (p < 0.01), followed by isolate PG-178 (4.3%). The amount of P_i released by the reference strain (Pseudomonas fluorescens) was 4.05%, and the lowest amount of P_i was released by the PG-145 (0.91).

In the zinc oxide solubilization test, strains showed Zn solubilization zones ranging from 2 to 6 mm, wherein strain PG-152 exhibited a maximum zone of solubilization (6 mm). The strains were also positive for HCN production but were limited to three. Among them, reference strain produced intense (+++) HCN, PG-152 was scaled as moderate (++), and PG-148 and PG-178 were scored as weak HCN producers based on the brown color production (Table 1). All the rhizobacterial isolates were tested for the production of siderophores, which was identified by the production of brown to orange color on chrome azurol S (CAS) agar media. All the isolates showed positive test results, including the reference strain (P. fluorescens). In the potassium-releasing test, none of the isolates tested positive.

The dual culture method was used to test the strains’ hostile behavior. The five top rhizobacterial strains were evaluated against the Macrophomina phaseolina and Fusarium sp. fungi. The screening findings revealed that the isolates tested positively for the test with varying levels of pathogen percent inhibition above control. From 58.56 to 85.13%, less M. phaseolina mycelial growth was inhibited compared to the control. The Bacillus subtilis strains PG-148 and PG-152 showed the inhibition of Fusarium Sp. culture under invitro conditions, the inhibition percentages were 85.56 and 93.33% respectively. One native isolate, PG-152 (B. subtilis), showed competitive inhibition of 85.56, 8.7% less than the reference strain (93.33%).

Under pot culture, the five top isolates and one reference strain were examined for the traits that encourage plant development. During the growth of the crop, several points were used to record features such as shoot and root length (Plant height). With the reference strain (P. fluorescens) treatment, the shoot length was at its maximum after 30, 60, and 90 days of seeding. The longest shoot measured in plants treated with the reference strain after 90 days of germination was 161.20 cm. The strain PG-152 (B. subtilis) treatment showed a commensurate shoot length during 30, 60, and 90 DAS, and the shoot lengths of 32.90, 83.00, and 143.20 cm were reported, respectively. The control has the most diminutive plant height throughout the experiment (p > 0.01). Correspondingly, the dry shoot weights were maximum with P. fluorescens treatment at 60 and 90 DAS; meanwhile, B. subtilis treatment showed an effect during initial (30 DAS) dry weights. The maximum dry weights were reported as 3.19, 8.76, and 33.3 g/plant at 30, 60, and 90 days after sowing. The root dry weights were significantly (p < 0.01) higher in reference-treated plants than in the other treatments. The highest root dry weight of 1.38 g/plant was recorded in P. fluorescens treatment at 30, 60, and 90 days after sowing, followed by PG-152-treated plants (1.02 g/plant) at 30 DAS. The dry root weights reported at 60 and 90 days after sowing were 4.02 and 5.02 g/plant with the reference strain. The strain PG-152 also showed statistically significant (p < 0.01) root dry weights after 60 and 90 days, which were recorded as 3.54 and 4.7 g/plant, respectively (Figure 4). The total dry weight of 38.03 g/plant (90 DAS) was recorded as the highest with the treatment of P. fluorescens (the results are presented in Table 2).

The rhizobacterial isolate-infused treatments considerably increased the chlorophyll content compared to the absolute control. The plants’ chlorophyll concentration was noted at 30, 45, and 60 DAS. Interestingly, even with 60 DAS after bacterial inoculation, the chlorophyll content in the plants was still at its highest, reaching a maximum of 47.56 SPAD in the PG-152-treated plants. The treatment of P. fluorescens at 30 DAS revealed a chlorophyll concentration of 26.42 SPAD value, indicating that the original chlorophyll content was constant. The exemplary control had the lowest level of chlorophyll (18.00 SPAD value). At 45 DAS, the highest chlorophyll content of 36.58 SPAD value was recorded with PG-152, and on-par results were observed in the P. fluorescens-treated plants with 35.72 SPAD value. The highest grain yield of sorghum observed was 41.62 g plant⁻¹ in P. fluorescens-treated plants, which were significantly superior over all other treatments. The subsequent highest grain yield of 39.72 g plant⁻¹ was recorded with the PG-152-treated plants. Plant phosphorus (P_i) and nitrogen (N₂) absorption were measured at harvest time. The plants treated with PG-152 absorbed most nitrogen (0.64 g plant⁻¹), followed by those treated with PG-197 (0.63 g plant⁻¹). The reference strain (P. fluorescens)-treated plants showed 0.57 g plant⁻¹ N uptake, and the control plants showed negligible N uptake (0.21 g plant⁻¹). The P absorption peaked in the PG-147-treated plants and was measured at 0.43 g plant⁻¹. The PG-152-treated plants and 0.41 g plant⁻¹ and 0.40 g plant⁻¹ were reported as having on-par P uptake. Comparing treatments, absolute control had the lowest P uptake (0.15 g plant⁻¹).

The rhizobacterial isolates PG-152 and PG-197 were subjected to molecular identification using 16SrDNA sequence analysis. Genomic DNA was isolated from both isolates. PCR-amplified DNA fragments of 1.3 kb products were analyzed for 16SrDNA sequencing. The sequences obtained from the Sanger sequence were blasted in NCBI-BLAST¹ and BLAST tool in EzBioCloud² for identifying the true identity of the isolates. The second tool was used to confirm the results obtained from the NCBI-BLAST. In the NCBI-BLAST, the B. subtilis sequence had an identity of 99.93% with a query cover of 99% with B. subtilis and B. tequilensis type strains (Table 3). In EzBioCloud, the same sequence had an identity of 99.72% with a query cover of 95.9% with Bacillus tequilensis. In the case of Enterobacter sp. sequence, when blasted in NCBI, it has a similarity of 98.81% with a query cover of 100% to E. cloacae type strains, whereas in EzBioCloud, it has 98.81% similarity with 51.8% coverage only. The nucleotide sequences were deposited in the NCBI GenBank, and the accession numbers obtained for the isolates PG-152 and PG-197 were OR828236 and OR699974, respectively. The phylogenetic tree was constructed using the Mega-XI software (Figure 5).

Later, using the same sequences, mining was done for the open reading frames (ORF) embedded in the sequences using the open-source ORF founder.³ Parameters were selected with ATG or any other sense codon as a start codon, and the results were blasted in the protein BLAST. When the Enterobacter sp. sequence was used for the ORF finding, 26 ORFs were reported: 14 were positive strands, and 12 were negative strands. When blasted, most sequences were similar to the Enterobacteriaceae family’s hypothetical proteins. In the case of B. subtilis, ORF blast results had similarities with the 21 hypothetical proteins of Firmicutes (Bacillus amyloliquefaciens, Streptococcus pneumoniae, B. subtilis, Lacticaseibacillus paracasei, Alkalihalophilus pseudofirmus, Rossellomorea aquimaris, Bacillus cereus, Pullulaniacillus purei, Staphylococcus aureus (3), Paenibacillus bouchesdurhonensis, and Coprobacillus sp.), enterobacteria (Klebsiella pneumoniae and Campylobacter jejuni), high G + C bacteria (Mycobacteroides abscessus), fungus (Glomus cerebriform), and mayflies (Ephemera danica).