Alfalfa silvery night moth (Sf9) cells (Invitrogen, United States) were cultured in Sf-900 II serum-free medium (SFM; Gibco, Grand Island, NY, United States) at 27°C. The baculovirus expression vector pFastBac Dual (Invitrogen, United States) was a gift from Prof. Yulong He of Zhejiang Sci-Tech University. The wild-type baculovirus rvA-dual was kept in our laboratory, and vector validation sequencing was performed by Jilin Kumi Biological Co.

Based on previous studies and the epidemiological investigation of CCHF in the Xinjiang region conducted by our laboratory (Kong et al., 2022a), the glycoproteins Gn (MN832721.2) and Np (MN832721.1) of the Chinese Xinjiang strain HANM18 (MN832721) were selected (Kong et al., 2022b), and the surface display sequence SPgp64 (GenBank AFO10080.1), the fluorescent proteins mCherry and eGFP and the histidine tag were cloned into the baculovirus pFastBac Dual vector to form the recombinant plasmids SPgp64-Gn-mCherry-TMDgp64, SPgp64-Np-eGFP-TMDgp64 and PH (SPgp64-Gn-mCherry-TMDgp64)-P10 (SPgp64-Np-eGFP-TMDgp64), which were synthesized by Anhui General Biotechnology Co.

The constructed recombinant plasmids were transformed into DH10 Bac receptor cells (Biomed, China), and the recombinant bacmid was extracted using a kit (Beyotime, China) and verified by PCR amplification using M13 universal primers (F′: CCCAGTCACGACGTTGTAAAACG, R’: AGCGGATAACAATTTCACACAGG). Subsequently, Sf9 cells were transfected with the following mixture according to the instructions: 4 μL of transfection reagent, 1 μg of bacmid and Sf9 medium to a total volume of 100 mL. The P0 generation of the virus was then obtained after constant incubation.

To observe the expression and localization of Gn protein and Np, Sf9 cells were observed 72 h, 96 h and 120 h after transfection by inverted fluorescence microscopy, and the localization of Gn protein and Np in Sf9 cells was observed by indirect immunofluorescence. The rvAc-Gn, rvAc-Np and rvAc-Gn-Np recombinant baculoviruses were added dropwise to cultured cells in 6-well plates at multiplicity of infection (MOI) of 0.1; the primary antibody was a mouse anti-His monoclonal antibody (1:500 dilution; Incubate for 8 h; Abcam), and the secondary antibodies were CoraLite 488-labeled goat anti-mouse IgG and CoraLite 594-labeled goat anti-mouse IgG (1:500 dilution; Incubate for 1 h; Proteintech). Protein fluorescence was observed at different wavelengths using a laser confocal microscope (Leica TCS SPE, Wetzlar, Germany). Viral supernatants were purified by sucrose density gradient centrifugation, and the recombinant baculoviruses were collected for immunoelectron microscopy with colloidal gold particles using the following primary antibodies: mouse anti-mCherry monoclonal antibody (1:1000 dilution; Abmart) and mouse anti-eGFP monoclonal antibody (preserved for this experiment). The secondary antibody protein-A-Gold (1:100 dilution; Bios) and electron microscopy grids were stained with 3% phosphotungstic acid and photographed using a transmission electron microscope at 80 kV (Hitachi H-7650, Tokyo, Japan).

Fluorescent tags may affect the immunogenicity of target proteins; thus, we sequenced the recombinant plasmids with the fluorescent tags removed, verified the bacmid sequences by PCR amplification, transfected Sf9 cells and passaged them to P1, P2 and P3 generations with an MOI of 0.5. Viral supernatants were collected, and the baculovirus recombinant proteins rvAc-Gn, rvAc-Np and rvAc- Gn-Np were identified by Western blotting; the primary antibody used was a mouse anti-His monoclonal antibody, and the secondary antibodies were CoraLite 488-labeled goat anti-mouse IgG and CoraLite 594-labeled goat anti-rabbit IgG (1:500 dilution; Proteintech).

Thirty-five 7-week-old BALB/c mice (purchased from Beijing Viton Lever Laboratory Animal Technology Co., Ltd., weighing 16–20 g, Certificate of Conformity No. SCXK Jing2021-0006) were randomly divided into five groups (n = 9). Serum samples were collected from the posterior orbital sinus at 0 days, 14 days, 28 days, 35 days, and 42 days (Table 1). Three mice from each group were randomly selected and sacrificed at 35 days and 42 days by cervical dislocation, and their spleens were used for splenic lymphocyte value-adding experiments. The mouse experiments were performed according to the guidelines of the Animal Experimentation Ethics Committee of Ningxia Medical University.

Serum antibody levels were measured by indirect enzyme-linked immunosorbent assay (ELISA), and the experimental procedure was previously described in detail. The antigens were Gn protein and Np and were prepared using a prokaryotic expression system at a concentration of 0.1 mg/mL. The primary antibodies were serum samples analyzed on 0 days, 14 days, 28 days, 35 days, and 42 days after the first immunization (diluted 1:100 with the blocking solution). The secondary antibodies were labeled goat anti-mouse IgG (1:1000 dilution, Proteintech). After termination of the reaction, the absorbance values at 450 nm were measured using an enzyme marker (Bio-Tek, Winooski, VT, United States), and all ELISA experiments were performed in triplicate.

The experimental procedure was performed as described previously (Xu et al., 2012) based on stimulation with 2 μg/mL Gn and Np and using RPMI-1640 (Gibco) medium as a negative control, and 5 mg/mL cutin A as a positive control. Three replicates of each sample were prepared and incubated at 37°C for 42 h. MTT solution (5 mg/mL, 20 μl, Sigma) was added to each well, and the absorbance values were measured at 490 nm using an enzyme marker (Bio-Tek, Winooski, VT, United States). The stimulation index was calculated for each group as follows: stimulation index (SI) = OD490 nm of antigen-stimulated cells (Gn and Np)/mean OD490 nm of negative control (RPMI-1640).

The statistical analyses were performed using GraphPad Prism® V version 6 for Windows (GraphPad Software, San Diego, CA, United States). The data are expressed as the means ± standard deviations. The Bonferroni post hoc test was used to compare the immune response between the groups. The data were significantly different if p < 0.05.

In this study, the plasmids pFastBac Dual (pH)-Gn, pFastBac Dual (p10)-Np and pFastBac Dual-Gn (pH)-Np (p10) were constructed (Figure 1). After gene synthesis, the correctly sequenced recombinant plasmids were transfected into E. coli DH10Bac cells, and the obtained recombinant bacmids were amplified using M13 universal primers. Verification of the obtained recombinant bacmids was completed by PCR amplification using M13 universal primers. Bacmid-Gn-mCherry (4,517 bp), Bacmid-Np-eGFP (5,110 bp), and Bacmid-GnmCherry-Np-eGFP (7,060 bp), and the electrophoretic band positions were consistent with the expected sizes (Figure 2).

Sf9 cells were infected with the recombinant baculoviruses rvAc-Gn-mCherry, rvAc-Np-eGFP and rvAc-Gn-mCherry-Np-eGFP and observed under different excitation (white, green and blue) wavelengths after incubation at 27°C for 72 h, 96 h, and 120 h. All three recombinant baculoviruses expressed fluorescent proteins (Figure 3). We further examined the localization of Gn protein and Np in the cells by indirect immunofluorescence and laser confocal microscopy, and the target proteins expressed by rvAc-Np-eGFP, rvAc-Gn-mCherry and rvAc-Gn-mCherry-Np-eGFP were localized near the cell membrane (Figure 4).

To examine the expression of Gn protein and Np on baculoviruses, the four recombinant baculoviruses rvAc-dual, rvAc-Gn-mCherry, rvAc-Np-eGFP and rvAc-Gn-mCherry-Np-eGFP were observed by immunoelectron microscopy with colloidal gold particles. The results showed that all the recombinant viruses had colloidal gold particles with a diameter of approximately 10 nm aggregated on the capsid region, indicating that the fluorescent proteins carrying Gn and Np were anchored on the surface of recombinant baculoviruses (Figure 5).

The three constructed recombinant vectors were modified by removing the fluorescent labeling to obtain rvAc-Gn, rvAc-Np and rvAc-Gn-Np, and Western blot assays showed that the Gn and Np antigens were correctly expressed (Figure 6). To investigate the effects of recombinant baculovirus rvAc-Gn, rvAc-Np and rvAc-Gn-Np antigens on humoral immunity in mice, the immunoglobulin G (IgG) levels in mouse serum were measured by indirect ELISA. The rvAc-Gn group had significantly higher IgG levels than the negative control group, PBS group and wild-type virus group at 35 days (Figure 7A), and these levels peaked at 42 days (p < 0.001). In the rvAc-Np group, the total IgG levels in serum were significantly higher (p < 0.001) at 14 days after immunization and peaked at 42 days (Figure 7B), and the differences in the total IgG levels among the rvAc-Gn, rvAc-Np and rvAc-Gn-Np groups were not significant (7A-C; p < 0.001). To investigate the cellular immune response to recombinant baculovirus in mice, we examined the stimulation index (SI) of mouse splenic lymphocytes at 35 days and 42 days (Figure 7C). The results showed that the SIs of the rvAc-Gn, rvAc-Np and rvAc-Gn-Np groups were higher than that of the control group, but the SI of the rvAc-Gn group was significantly higher than that of the other two groups at 35 days and 42 days (p < 0.001; Figure 7D).

To further evaluate cellular immune responses, we examined the changes in the IL-4 and TNF-α levels in mouse serum (Figures 7E,F). The results showed that the serum levels of IL-4 and TNF-α were significantly higher in the mice belonging to the rvAc-Gn and rvAc-Np groups, and the IL-4 level of the rvAc-Gn-Np group was not different from that of the negative control group. The TNF-α level of the rvAc-Gn group was significantly higher than that of the rvAc-Np group (p < 0.001). The rvAc-Gn, rvAc-Np and rvAc-Gn-Np groups had TNF-α levels of 17.887 ± 0.379 pg/mL, 6.211 ± 0.693 pg/mL and 8.804 ± 2.260 pg/mL, respectively, and IL-4 levels of 40.530 ± 3.288 pg/mL, 34.394 ± 0.387 pg/mL and 16.509 ± 1.530 pg/mL, respectively.