All procedures for the scientific use of animals were reviewed according to the Brazilian ethical guidelines (Law 11,794/08) and approved by the Ethics Committee for Animal Use (CEUA) of the Oswaldo Cruz Foundation under license numbers LW13/13 and LW12/16.

The following reagents were used for parasite culture, Glasgow Minimum Essential Medium (GMEM), triiodothyronine, lactalbumin, HEPES, MEM vitamin solution, Schneider’s Insect Medium, hypoxanthine, and hydrocortisone were purchased from Sigma-Aldrich. Penicillin/streptomycin, RPMI 1640 medium, and Fetal Bovine Serum (FBS) were from Gibco; glucose from VETEC; TRIzol Reagent from Invitrogen.

All primers were purchased from IDT, Smcarm1-dsRNA_F: taatacgactcactatagggCATGGCATGGATCTAACTGC, Smcarm1-dsRNA_R: taatacgactcactatagggTGTTGTTGTTGCTGTTGTGC, Smcarm1-qPCR_F: TGCTGTTGAAGCATCTAATATGG, Smcarm1-qPCR_R: ATAATGACATCCACTGGTTCG; SmcoxI (Smp_900000) SmcoxI-qPCR_F: TACGGTTGGTGGTGTCACAG, SmcoxI-qPCR_R: ACGGCCATCACCATACTAGC; GFP-dsRNA_F: taatacgactcactatagggTCTTCAAGTCCGCCATG, GFP-dsRNA_R: taatacgactcactatagggTGCTCAGGTAGTGGTTGTC. The sequences in lowercase correspond to the T7 promoter sequence added to the 5′-end in primers designed for dsRNA synthesis.

The “Lobato Paraense” snail facility at the René Rachou Institute—FIOCRUZ provided cercariae of S. mansoni (LE strain). The parasite cycle is maintained throughout passages between hamsters (Mesocricetus auratus) and snails (Biomphalaria glabrata).

As previously described, cercariae were mechanically transformed into schistosomula (Milligan and Jolly, 2011). Schistosomula were cultured in GMEM supplemented with 0.2 μM triiodothyronine; 0.1% glucose; 0.1% lactalbumin; 20 mM HEPES; 0.5% MEM vitamin solution; 5% Schneider’s Insect Medium; and 0.5 μM hypoxanthine, 1 μM hydrocortisone, 1% penicillin/streptomycin, and 2% heat-inactivated FBS.

Hamsters (M. auratus) were infected with cercariae and subjected to perfusion (Pellegrino and Siqueira, 1956) after 45 days for obtaining adult worms. Males and females were washed, separated manually, and cultured in Roswell Park Memorial Institute 1640 (RPMI 1640) medium supplemented with 2% penicillin/streptomycin and 10% heat-inactivated FBS.

To verify the expression data of SmPRMTs in the different cell types of adult S. mansoni worms, single-cell RNAseq (scRNAseq) data were obtained from the Gene Expression Omnibus database (GEO, https://www.ncbi.nlm.nih.gov/geo/, BioProject PRJNA611783, SRA SRP252217; https://www.collinslab.org/schistocyte/; Wendt et al., 2020). We also verified Smcarm1 expression in clusters of cells identified in schistosomula at the cellxgene platform¹ (Diaz Soria et al., 2020). The RDS file containing the expression data in the different cell types was loaded in the R software (v4.1.2; R Core Team, 2020) using the Seurat package (v4.1.1; Satija et al., 2015) and used to build a heatmap with the package ComplexHeatmap (v2.10.0; Gu et al., 2016). Additionally, we checked the SmPRMTs expression in a publicly available RNAseq dataset (Protasio et al., 2017) retrieved from WormBase ParaSite as counts of aligned reads per run per gene. Differential expression analysis was carried out using DESeq2 (v. 2_1.38.2; padj < 0.05; Love et al., 2014) and we used the pheatmap package (v1.0.12; Kolde, 2015) in R (v4.1.2; R Core Team, 2020) to construct a heatmap representing the log2 fold change for 18-, 28-, 35-, and 38-day post-infection (dpi) relative to 21 dpi.

The Smcarm1 coding sequence was obtained from the GeneDB database.² The T7 promoter sequence was added to the 5′-end of primers designed to amplify a template of 569 bp for double-stranded RNAs (dsRNAs) synthesis. A fragment of 360 bp from the green fluorescent protein (GFP) cloned in the pCRII plasmid vector, was used as non-schistosome RNA interference (RNAi) control. The PCR amplified fragments were purified with the QIAquick Gel Extraction KIT (QIAGEN) and used for dsRNA synthesis using the T7 RiboMAX Express RNAi System kit (Promega) according to the supplier’s protocol; except for the time of reactions which was changed to 16 h. DsRNAs annealing and integrity were verified in 1% agarose gel electrophoresis, and the quantification was estimated in a Nanodrop Spectrometer ND-1000 (Thermo Fischer Scientific).

Approximately 2,000 schistosomula were exposed to 100 nM of dsRNAs (Smcarm1 or GFP), immediately after mechanical transformation, in 24-well plate and incubated for 7 days at 37°C, 5% CO₂, and 95% humidity with 2 ml of GMEM supplemented as previously mentioned.

Eight adult worms (males and females, separately) were placed in 100 μl of RPMI 1640 medium with 25 μg of dsRNA. The worms were electroporated with specific Smcarm1-dsRNA or unspecific GFP-dsRNA into 4 mm cuvettes at 125 V for 20 ms and cultivated in 24-well plate with 1 ml RPMI 1640 medium supplemented with 10% heat-inactivated FBS and 2% penicillin/streptomycin. Similarly, to count the number of eggs laid, eight worm pairs were electroporated and cultured in six-well plate and the medium was changed daily.

Seven days after dsRNA exposure, 1,000 schistosomula were separated for RNA extraction and relative expression analysis by quantitative real-time PCR (RT-qPCR). Schistosoma mansoni cytochrome C oxidase I gene (SmcoxI—Smp_900000) was used as the internal control gene. RNA extractions were performed using the TRIzol Reagent method followed by purification with the RNeasy Mini Kit (Qiagen), according to the manufacturer’s guidelines. RNA samples were treated with the TURBO DNA-free kit (Ambion) to remove residual genomic DNA, quantified using the Nanodrop Spectrometer ND-1000, and stored at −70°C.

For adults, for 7 days, two worm pairs per day were removed and macerated with TRIzol Reagent for RNA extraction as described previously. Experiments were performed in four biological replicates.

The cDNAs were synthesized with equal amounts of the extracted RNAs using the SuperScript II Reverse Transcriptase (Invitrogen), with oligo(dT)18 following the manufacturer’s protocol. Primers for qPCR analysis were designed using the Primer 3 program.³ Primer efficiencies were estimated by titration analysis to be 100 ± 5% (data not shown), and the specificity was verified by the melting curve. qPCR reactions were performed on 7500 Real-Time PCR System (Applied Biosystems) with SYBR Green PCR Master Mix (Applied Biosystems) and 200 nM of each primer in a final volume of 25 μl. Internal controls to evaluate genomic DNA contaminations (RNA samples) and reagent purity (no cDNA) were included in all analyses. The 2^−ΔΔCt method (Livak and Schmittgen, 2001) was used for relative quantification and normalized with SmcoxI. Transcript levels were expressed as a percentage of difference relative to the unspecific (GFP) or negative control.

Schistosomula cultures were daily observed by inverted light microscopy (ABO 100, ZEISS) to verify viability and phenotypic changes, such as movement, color, and tegument integrity.

To evaluate the motility of the worms, we capture worm movement (eight males or females separately) for 1 min and 30 s for 7 days using the WormAssay software (Marcellino et al., 2012), in six replicates. Additionally, to verify the influence of SmCARM1 on oviposition, eggs laid in the media were counted daily in the cultures containing worm pairs, in five replicates.

After schistosomula exposure to dsRNAs for 2 days, 300 schistosomula were subcutaneously inoculated in Swiss mice (Mus musculus). Each experimental group consisted of at least six mice in three independent biological replicates. Before the infection, the Smcarm1 transcript levels in schistosomula were checked by qPCR, as described above. Schistosomula exposed to unspecific dsRNA-GFP and untreated parasites were used as controls. After 37 days adult worms were recovered by perfusion (Pellegrino and Siqueira, 1956). After perfusion, the worms recovered from the mice were separated into males and females and counted. Mouse livers were removed and individually weighed, crushed with a scalpel, and treated overnight with 10% KOH, for subsequent egg counting (Tavares and Mourão, 2021).

The adult worms recovered after 37 days of mouse infection were fixed and stored in Alcohol-Formalin-Acetic Acid (AFA, 95% ethanol, 3% formaldehyde, and 2% glacial acetic acid), at room temperature, and stained with 2.5% chloride carmine, dehydrated in alcoholic series (70, 90%, and absolute), clarified in methyl salicylate with Canadian balsam (1:2), and prepared as whole-mounts (Neves et al., 1998). We analyzed at least six males and six females recovered from mice infected with schistosomula previously exposed to Smcarm1-, GFP-dsRNA, or untreated, from the three biological replicates.

Computer images (Image Pro Plus, Media Cybernetics), from male and female worms captured by a camera (640/480 pixels, RGB) coupled to a light microscope (BX50, Olympus), were used for morphometric analyses. We evaluated the number and area of testicular lobes, ovary area, presence of tubercles, presence of eggs and vitelline glands, and integrity of the tegument (Neves et al., 2004).

Whole mounts of male and female worms were also analyzed under confocal laser scanning microscopy (LSM-410, Zeiss) using a 543 nm laser and a BP560-615 IR filter, in reflected mode. We examined male (testicular lobes, seminal vesicle) and female (yolk glands, ovary, uterus, and ootype) reproductive systems, as well as the integrity of the tegument and the shape of the oral and ventral suckers.

All statistical analyses were performed using GraphPad Prism, v. 7 for Windows (GraphPad Software, www.graphpad.com). After verifying for outliers, using the ROUT method (Q = 1%; Motulsky and Brown, 2006), and applying normality test analysis to check if the data follows a Gaussian distribution, statistical analyses used the Mann–Whitney test (Wilcoxon-Sum of Ranks, p < 0.05), Paired or Unpaired t-test (p < 0.05), as described in the respective figure legends.

At first, we aimed at analyzing existing RNAseq and single-cell RNAseq data available in the WormBase ParaSite, the Gene Expression Omnibus database, and cellxgene platform. All results for differential expression analysis retrieved for PRMTs (Smp_025550—SmPRMT7, Smp_029240—SmPRMT1, Smp_070340—SmCARM1, Smp_171150—SmPRMT6, and Smp_337860—SmPRMT3) are available in Supplementary Table S1. In this analysis, we found that PRMTs identified in the S. mansoni genome present a significative decrease in the expression profiles for male adult worms from single-sex infections, from 18- to 21-dpi (Supplementary Figure S1), except for Smprmt6. Females from unisexual or mixed infections presented a similar expression profile of Smcarm1 from 21- to 35-dpi, with a significant reduction in expression. However, only females in the presence of male worms return to the transcript levels of those observed for 21 dpi, which is observed for all PRMTs, specially Smprmt6. Whereas, in males, single or mixed infections do not differently impact the Smcarm1 expression profile.

The analysis of the scRNAseq data provided by Wendt et al. (2020) and Diaz Soria et al. (2020) allowed the assessment of the expression of S. mansoni SmPRMTs in different cell types of S. mansoni adult worms and schistosomula, respectively, (Figure 1). Smprmt1 (Smp_029240) expression is enriched in Supplementary Figure S1 and late female germ cells, whereas expression of the other SmPRMTs, including Smcarm1, is not enriched in any cell cluster. In schistosomula, Smprmt1 expression is enriched in NDF+ neurons and stem/germinal cells, and Smcarm1 expression is enriched in clusters of ambiguous cells (Figure 1E), while expression of the other SmPRMTs is not enriched in any cell cluster.

There is a lack of functional characterization of PRMTs in the S. mansoni parasite. Since important roles have been attributed to CARM1 in other organisms, we further investigated whether SmCARM1 had effects on worm biology, so to that end we knocked-down the Smcarm1 transcripts by RNAi experiments. After 7 days of dsRNA exposure, schistosomula presented an average 83% reduction in Smcarm1 transcript levels (Figure 2) compared to the controls. No significant changes were observed in viability or evaluated phenotypes, such as movement, color, tegument integrity, or area in in vitro cultivated parasites (data not shown).

Adult worms electroporated with Smcarm1-dsRNA showed up to a 69% reduction in Smcarm1 transcript levels on the first day after electroporation (Figure 3A). Smcarm1-dsRNA knockdown resulted in a significant reduction of 54.9% in egg laying compared to the negative control (Figure 3B), although no relevant changes were observed in the movement of females or males for 7 days (Figures 3C,D).

The conclusions drawn from in vitro experiments could be limited since parasites are not challenged by a real biological system. Therefore, we sought to investigate the role of SmCARM1 on in vivo infections. Before infection, the reduction of Smcarm1 transcript levels in schistosomula was confirmed by RT-qPCR (Supplementary Figure S2). After perfusion, there was no significant change in the number of worms, male or female, recovered from mice infected with Smcarm1 knocked-down schistosomula (Figure 4A). However, there was a significant reduction in the number of eggs recovered from the livers of these mice (Figure 4B).

Morphometric analyses showed that there was a significant decrease in the ovaries area in females recovered from mice infected with Smcarm1 knocked down schistosomula (Figure 5A). In addition to area reduction, it is possible to observe a lower degree of cell differentiation in the ovary (Figure 6) and disorganization of vitelline gland cells (immature cells without the characteristic cluster morphology when compared to the control, which, in turn, presents evident nucleus and characteristic organization of clusters; Figure 7).

Furthermore, there was a decrease in the area of the testicular lobes in male worms recovered from these mice (Figure 5B), however, without a variation in the number of lobes present in each group (data not shown). The testicular lobes were well-demarcated and without the presence of vacuoles (data not shown).

In the tegument of the adult worms recovered from mice infected with Smcarm1 knocked-down schistosomula, the presence of fewer tubercles is clearly observed (Figure 8). The ventral sucker of the parasites presented a damaged tegument and a few points of detachment to the parasite (Figure 9).