The strain was isolated on August 21, 2018, from a blood specimen obtained from a 3-month baby who presented with biliary tract infection in Guangzhou, Guangdong, China, and was identified by Vitek MS MALDI-TOF (BioMérieux) system in Peking Union Medical College Hospital. The hemogram indexes are the results of the first examination after admission within 1–3 days of the occurrence of a bloodstream infection. Escherichia coli rifampicin-resistant strain EC600 were used in the construction of transconjugants experiments.

We used the broth microdilution method for antimicrobial susceptibility testing as per the Clinical and Laboratory Standards Institute (CLSI) recommendations (CLSI, 2020). MICs were interpreted according to the CLSI M100-S30 guidelines (CLSI, 2020). Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853, and K. pneumoniae ATCC700603 were used as quality controls.

UltraClean^® Microbial DNA Isolation Kit (MOBIO Laboratories, Inc.) was used for genomic DNA extraction. Whole-genome sequencing was implemented using the PacBio Sequel platform. A 10 kb SMRTbell library was prepared from sheared genomic DNA (≥5 g) with an additional bead clean-up step before primer annealing (Zhu et al., 2016).

We also re-sequenced this isolate using Illumina sequencing platform in order to correct the polymer errors generated during PacBio sequencing. Paired-end libraries were constructed from 5 μg of isolated genomic DNA using a TruSeq DNA sample prep kit (Illumina Inc., San Diego, California, United States), and sequenced using Illumina with a read length of 2 × 150 bp. A threshold of 0.01 (phred score of 20) was used for raw reads filtration. Genome assembly was conducted using Unicycler (Wick et al., 2017) from short and long sequencing reads.

Genome sequences were initially annotated with the rapid prokaryotic genome annotation software Prokka (Seemann, 2014) and further annotated by BLAST searches against the RefSeq and UniProtKB/Swiss-Prot databases. Pairwise sequence comparisons were also performed using BLAST. All mobile elements were identified using ExPASy (Artimo et al., 2012), ISFinder (Siguier et al., 2006), the Transposon Registry (Tansirichaiya et al., 2019), INTEGRALL (Moura et al., 2009), and Integron Finder.¹ Comparisons of plasmid structures were conducted to analyze the sequence homology. BRIG software was used for the generation of plasmid circular structure maps.

STs were determined using SRST2 (Inouye et al., 2014) based on the Illumina reads. Serotype was analyzed using SerotypeFinder 2.0 (Joensen et al., 2015) based on the assembled contigs. Virulence genes were downloaded from Virulence Factor Database (VFDB). FASTA sequences of the downloaded virulence genes were used for searching corresponding genes by BLAST with coverage of 50% and identity of 90%. Antimicrobial resistance genes were analyzed through ResFinder 4.0 based on the whole genomic sequences.

The transferability of pAZS099-NDM-IMP among isolates was determined using AZS099 as donor and E. coli EC600 as the recipient by conjugation assay. The procedure of conjugation was performed according to the protocol previously described (Yang, 2015). 100 μl overnight culture of clinical isolate (AZS099) in Luria–Bertani (LB) broth containing meropenem (2 μg/ml) and 200 μl overnight culture of recipient EC600 in LB broth containing rifampicin (100 μg/ml) were mixed into 5-ml antibiotic-free LB broth and were incubated at 37°C for 18 h. Then, the conjugant mixtures were placed on selective LB agar containing 100 μg/ml rifampin and 1 μg/ml meropenem. PCR analysis and agarose gel electrophoresis were performed to confirm the effects of transconjugation.

To further characterize the plasmid pAZS099-NDM-IMP in AZS099 and the transconjugant EC600-pAZS099-NDM-IMP, S1 nuclease digestion analyzed with PFGE was performed using a CHEF Mapper XA apparatus (Bio-Rad Laboratories, Hercules, CA). Briefly, the adjusted bacterial suspension mixed in a 1% Seakem Golden Agarose and 1% Sodium dodecyl sulfate (SDS) was digested with proteinase K for 2 h at 56°C and then further treated with S1 nuclease. XbaI-digested Salmonella enterica serovar Braenderup H9812 as a reference molecular weight marker. The electrophoresis conditions used in this study were as follows: initial switch time, 3 s; a final switch time, 36 s; gradient, 6 V/cm; angle, 120; temperature, 14°C; and time, 18 h. After the electrophoresis was complete, the gel was stained with Ultra GelRed and visualized with the ImageQuant LAS 500 (GE LifeScience, Pittsburgh, United States) or transferred to nylon membrane (GE LifeScience, Pittsburgh, United States), followed by hybridization with digoxigenin-labelled probes specific to NDM-1 or IMP-4. Probe labelling and signal detection were done by DIG DNA Labeling and Detection Kit (Roche Diagnostics, GmbH, Germany).

The plasmid pAZS099-NDM-IMP separated by S1 nuclease treatment and pulsed-field gel electrophoresis (PFGE) was then recovered and used as the templates for PCR amplification and Sanger sequencing to identify target genes bla_IMP (primer sequence 5′-3′: Forward GTAGCATTGCTACCGCAGCAG; Reverse TCGTTTAACCCTTTAACCGCC) and bla_NDM (primer sequence 5′-3′: Forward TGCCCAATATTATGCACCCG; Reverse CCCAACGGTGATATTGTCACTG) in AZS099 and the transconjugant EC600-pAZS099-NDM-IMP.

Plasmid stability was assessed upon several successive subculture of plasmid-carrier AZS099 strain for 10 days with 1:1000 dilution on antibiotic-free LB broth at 37°C in a shaking bath (180 rpm). The 10th day’s culture was serially diluted and plated onto LB plates with or without meropenem (1 mg/L). The retention rate of plasmid was calculated by dividing the number of colonies on LB plates supplemented with meropenem by the number of colonies on LB plates (Gao et al., 2020). 50 colonies on the antibiotic-free LB plates were randomly selected and subjected to PCR validation of bla_IMP (primer sequence 5′-3′: Forward TGGTTTGTGGAACGTGGCTA; Reverse GAGTGATGCGTCTCCAGCTT) and bla_NDM (primer sequence 5′-3′: Forward CTCGCATTTGCGGGGTTTTT; Reverse ACGCCTCTGTCACATCGAAA) genes.

Growth curve was used to assess the fitness impact of plasmid carriage under noncompetitive conditions as Wang et al. described previously (Wang et al., 2018). The recipients and transconjugants carrying pAZS099-NDM-IMP plasmid from AZS099 isolate were cultured overnight in LB broth without or with 2 mg/L meropenem at 37°C, respectively. Bacterial suspensions were diluted 1:1000 in LB medium (approximately 10⁶ CFU/ml) and grown at 37°C in triplicate for 36 h by Epoch™ 2 Microplate Spectrophotometer from BioTek Instruments. The OD600 of each culture was measured every 30 min, and the plates were shaken for 15 s before measuring. GraphPad Prism version 8 (GraphPad Software, Inc., United States) was used to estimate the growth curves. Statistical significance was determined for an overall error at 0.05 level (95% confidence interval) using one-way ANOVA, followed by Tukey tests.

The Klebsiella pneumoniae strain AZS099 was isolated from a blood specimen obtained from a 3-month baby who presented with biliary tract infection. The patient was hospitalized with cholangitis after biliary atresia and had a fever >39°C lasting for more than 3 days. The total white blood cells (WBC), neutrophil percent (NEU), C-reactive protein (CRP), and procalcitonin (PCT) were 12.85*10⁹/L, 22.7%, 161.71 mg/L, and 1.52 ng/ml, respectively. In the duration of hospitalization, the patient was treated with meropenem (0.15 g, q 8 h, 5 days). Surgical intervention was involved during the treatment, and finally, the patient was improved and discharged.

The results of susceptibility testing showed that the clinical isolate AZS099 was resistant to almost all β-lactams examined, including cephalosporins (cefoxitin, ceftriaxone, ceftazidime, cefepime), carbapenems (imipenem, meropenem, ertapenem), combinations of β-lactams and β-lactamase inhibitors (imipenem/relebactam, piperacillin/tazobactam, ceftazidime/avibactam, ceftolozane/tazobactam), and aztreonam. The MIC of imipenem, meropenem, and ertapenem is >16 μg/ml, >16 μg/ml, and > 4 μg/ml, respectively (Table 1). The strain was susceptible to amikacin, levofloxacin, and colistin (Table 1).

To reveal the genetic basis of the multidrug-resistant (MDR) phenotype, we obtained the complete genome of the clinical isolate AZS099 including a 5.2-Mb chromosome, a 296-kb plasmid (pAZS099-NDM-IMP), and a 15-kb plasmid (pAZS099-2; Table 2 and Figure 1). Bioinformatics analysis provided the general information of the chromosome genome, including GC% content (57.63%), predicted protein-coding genes (4,998), average gene length (922 bp), and coding region (88.82%). The two plasmids possess a shorter average gene length, lower ratio of coding regions, and lower GC% content. Sequence type (ST) and serotype analysis showed that AZS099 belongs to ST20 and K28.

Virulence genes (Table 2) analysis showed that the clinical isolate AZS099 only contains nine virulence genes, which are all located on the 5.2-Mb chromosome, including ferric aerobactin receptor protein (iutA), and type III fimbria proteins (mrkABCDFHIJ) that are related to cell adhesion. No virulence genes were discovered on two plasmids. Eleven antimicrobial-resistance genes were found in AZS099 including four antimicrobial-resistance genes on the chromosome: fosA, glutathione transferase encoding gene; oqxA and oqxB, multidrug efflux pump protein encoding genes; bla_SHV-12, β-lactamase encoding gene. Seven antimicrobial-resistance genes on the 296-kb plasmid (pAZS099-NDM-IMP): two aminoglycoside-resistance genes [aph(6)-Id and aph(3″)-Ib], one sulfonamide resistance gene (sul2), one bleomycin resistance gene (ble_MBL), one β-lactamase (bla_SHV-12), and importantly two carbapenemase resistance gene bla_NDM-1 and bla_IMP-4 (Table 2). These antimicrobial-resistance genes, especially bla_NDM-1 and bla_IMP-4, are responsible for the MDR phenotype, including most β-lactam drugs, which is in accordance with antimicrobial susceptibility testing. No antimicrobial resistance genes were found on the 15-kb plasmid (pAZS099-2).

Antimicrobial-resistance genes analysis showed both bla_NDM-1 and bla_IMP-4 are located on the 296-kb plasmid (pAZS099-NDM-IMP), which was further confirmed by S1-PFGE, Southern blot, and PCR amplification (Supplementary Figures S1–S3). The complete nucleotide sequence of the plasmid pAZS099-NDM-IMP was 296,148 bp in length, constituting a circular DNA with an average G + C content of 50.91% and 331 open reading frames (Table 2). This plasmid pAZS099-NDM-IMP contained three types of plasmid replication initiation genes: IncFIB(K), IncHI1B and IncX3. We performed a full-plasmid BLAST comparative analysis in NCBI, but no plasmids with a similar structure as pAZS099-NDM-IMP were found. Further analysis showed that the sequence of pAZS099-NDM-IMP consists of four main parts, which were came from four different types of plasmids (Figure 2A): the main backbone region (1 bp - ~175,000 bp) shared >99% identity with pNH25.1 (CP024875.1) and pBckp021-2 (CP050836.1); the bla_IMP-4 region (~175,000 bp– ~190,000 bp) shared >99% identity with p20389-IMP (MH909337.1) and CP050160.1_IMP-4 of E. coli; the bla_NDM-1 region (~190,000 bp - ~245,000 bp) shared >99% identity with pA575-NDM (MH917283.1) and p12018-NDM (MH909343.1); the aminoglycoside resistance region (~245,000–296,148 bp) shared >99% identity with pKPN-065 (CP015026.1) and p10057-catA (MN423364.1). These four parts make up the new hybrid plasmid.

A linear genomic comparison and mobile genetic element (MGE) annotation were further conducted among pAZS099-NDM-IMP, pNH25.1, pKPN-065, pA575-NDM (bla_NDM-1-carrying plasmid), and p20389-IMP (bla_IMP-4-carrying plasmid; Figure 3) since they share the high identity and both belong to K. pneumoniae. Although the region 1 bp– ~175,000 bp and ~ 245,000–296,148 bp shared high identity with pNH25.1 and pKPN-065, many inversion regions were identified. bla_NDM-1 and bla_IMP-4 are located in a 70 kb region, which also contains a β-lactamase bla_SHV-12. There is an inversion of the accessory modules containing bla_IMP-4 compared with the bla_IMP-4 region of p20389-IMP, and an inversion of the accessory modules containing bla_NDM-1 was also identified compared with the bla_NDM-1 region of pA575-NDM. Additionally, this 70 kb region covered almost 100% of the IncX3-type plasmid pA575-NDM, and the bla_IMP-4 region was inserted into downstream of this region (Figures 2A, 3). Detail MGE annotation showed that (Figure 3) the region harboring bla_IMP-4 is located in a class 1 integron designated as In0, which is carried by an IS6100-IS26 transposon-like structure with a total length of ~5 kb. This integron also contains the retron-type RNA-directed DNA polymerase ltrA. Compared to the integron In0 in p20389-IMP, In0 in this hybrid plasmid pAZS099-NDM-IMP lost ant(3″)-Ia and tniB. The region harboring bla_NDM-1 is located in the Tn125 transposon remnant. This region also contained a bleomycin resistance protein (ble_MBL), trpF, nagA, cutA, groS, and groL. Additionally, Tn2680 (with two IS26 elements at terminal regions in opposite directions), carrying β-lactamase bla_SHV-12, is located between the Tn125 remnant region containing bla_NDM-1 and integron In0 containing bla_IMP-4. Integron In0, Tn2680, and Tn125 remnant region lay adjacent to one another and formed a continuous 20 kb multidrug-resistant region that confers resistance to almost all β-lactams examined, containing cephalosporins, combinations of β-lactams and β-lactamase inhibitors, carbapenems, aztreonam, and ampicillin.

We also performed a full-plasmid BLAST comparative analysis of pAZS099-2 in NCBI, and it exhibited 99% identity with a plasmid from K. pneumoniae strain FDAARGOS_630 (CP044037.1; Figure 2B). This plasmid (pAZS099-2) is IncFIA(HI1) type, 15,410 bp in length, constituting a circular DNA with an average G + C content of 45.55% and 17 open reading frames. No virulence and antimicrobial-resistance genes were found.

To evaluate the transferability of the resistance plasmid carrying bla_NDM-1 and bla_IMP-4, conjugation assays were performed by co-culturing AZS099 with E. coli EC600. S1-PFGE confirmed the size of the plasmid, which was consistent with the donor AZS099, in the transconjugant (Supplementary Figure S1A). The following Southern blot and PCR results confirmed the coexistence of bla_NDM-1 and bla_IMP-4 on the plasmid pAZS099-NDM-IMP (Supplementary Figures S1B,C, S2, S3). These results indicated that the plasmid pAZS099-NDM-IMP harboring bla_NDM-1 and bla_IMP-4 in the clinical strain AZS099 has the potential for horizontal transfer. Moreover, the two carbapenem resistance genes bla_NDM-1 and bla_IMP-4 were also transferred along with the plasmid. As shown in Table 1, the susceptibility results of the transconjugant were consistent with the donor (clinical isolate AZS099): resistant to cephalosporins, carbapenems, combinations of β-lactams and β-lactamase inhibitors. And the MIC range of meropenem for NDM-IMP-bearing transconjugants was >16 μg/ml.

The stability of plasmid pAZS099-NDM-IMP was also evaluated during serial passage in the laboratory last for 10 days. It displayed high stability, as the retention rates were still over 95% at the end of the experiment for both bla_NDM-1 and bla_IMP-4, which were confirmed by PCR.

Further, the effect of acquiring bla_NDM-1 and bla_IMP-4 plasmid on biological fitness cost was evaluated. Of interest, no significant differences in the growth rate were observed among the recipient strain EC600 and the transconjugant harboring bla_NDM-1 and bla_IMP-4 plasmid pAZS099-NDM-IMP (p > 0.05; Figure 4). Therefore, the antibiotic resistance mediated by pAZS099-NDM-IMP did not increase the growth fitness cost of the resistant strains compared to their susceptible counterparts.