Salmonella enterica serovar Gallinarum (S. Gallinarum) 287/91, a spontaneous nalidixic acid-resistant strain (Ojima et al., 2021), was maintained in Luria-Bertani (LB) broth plus 30% glycerol at −80°C. Bacteria were routinely grown in LB broth (Eiken Chemical, Tokyo, Japan) at 37°C with shaking (at 150 rpm). For infection experiments in chickens, S. Gallinarum 287/91 and a deletion mutant (wecB::Cm) were cultured at 37°C in LB broth to logarithmic phase and then collected by centrifugation and washed twice with sterile 0.01 M phosphate-buffered saline (PBS). The washed bacteria were diluted with PBS, adjusted spectrophotometrically at 600 nm to reach 1.0 × 10⁹ colony-forming unit (CFU)/ml, and then were diluted to 1.0 × 10⁸ CFU/ml or 2.0 × 10⁷ CFU/ml. Chloramphenicol (Cm; 20 μg/ml) or ampicillin (Amp; 100 μg/ml) was added to the media when needed.

S. Gallinarum ECA mutant strain (wecB::Cm) was constructed in S. Gallinarum 287/91 wild-type background using the Lambda Red recombination method (Datsenko and Wanner, 2000). PCR primers, which were 60 bases long, SG3523-F1 (AGGGGGCTGGGCCCCTACTGTCTAT TCGAAGAGAATCGATGTGTAGGCTGGAGCTGCTTC), and SG3523-R1 (TTTCGTCGT GCAGCAGACGCATAACTTCCGCCACAATCCGCATATGAATATCCTCCTTAG), were designed with 40 bp of the 5′ ends corresponding to the ends of the desired deletion and the 20 bp of 3′ ends to amplify the Cm cassettes from plasmid pKD3 (GenBank accession number: AY048742.1). PCR was performed in a 50 μl reaction mix containing 5 μl of 10 × PCR buffer for KOD plus version 2, 5 μl of 2 mM dNTPs, 3 μl of 25 mM MgSO₄, 3 μl of primer mix (0.3 μM final concentration of each primer), 1 μl of KOD plus version 2 polymerase (1 unit, Toyobo, Osaka, Japan), 1 μl of DNA template (about 0.1 ng pKD3 plasmid), and distilled water. The thermal cycling conditions were initial denaturation at 94°C for 2 min, followed by 30 three-step cycles of denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 68°C for 1 min, and a final extension cycle at 68°C for 3 min. PCR products were electroporated into S. Gallinarum carrying pKD46 grown at 30°C in LB broth containing Amp (100 μg/ml) and L-arabinose (10 mM; Sigma-Aldrich, St. Louis, MO, USA). Electroporated bacteria were selected on LB agar plates containing Cm (20 μg/ml) at 37°C. The colonies collected from the LB agar plates containing Cm were streaked onto an LB agar plate and incubated at 42°C to remove thermosensitive plasmid pKD46. The recovered colonies were checked for sensitivity to Amp, and the mutation was confirmed by PCR amplification using a flanking region primer, SG3523-F2 (ATCACGCGGTCATTTTTAAT), and a priming site within the Cm cassette of pKD3, C1 (TTTTCACCATGGGCAAATAT).

Bacterial growth characteristics of wecB::Cm mutant were monitored and compared with wild-type strain by measuring the optical density (OD_{600 nm}) of bacterial cultures at 37°C with shaking (150 rpm) at 2 h intervals. At the indicated time points, 100 μl of each culture was serially diluted in LB broth and 100 μl of each dilution was spread on an LB agar plate. After overnight incubation at 37°C, colonies on the plates were counted as CFUs. For the resistance assays, bacteria were grown in LB broth for 14 h and diluted to 2.0 × 10⁷ CFU/ml, and 50 μl diluted culture was mixed with 50 μl of LB broth that contained various concentrations of bile acid (Sigma-Aldrich; final concentration was 0.01 or 0.02 mM), hydrogen peroxide (H₂O₂) (Wako, Osaka, Japan; final concentration was 0.5 or 1.0 mM), or nalidixic acid (Wako; final concentration was 1.25 or 2.5 mg/ml) in 96-well flat-bottom plates (Greiner Bio-One, Kremsmünster, Austria). The plates were incubated at 37°C without shaking. Bacterial growth at the indicated time points was determined by monitoring the optical density (OD_{595 nm}) of bacterial cultures using a 96-well plate reader (Bio-Rad, Model 680 microplate reader, Hercules, CA, USA).

All animal experiments were conducted in accordance with the animal experiment rules set out in the Animal Welfare Law and Guide for the Care and Use of Laboratory Animals. All efforts were made to minimize the suffering of the animals during the experiments. Female Boris Brown chickens, which are well known to be susceptible to salmonellosis (Smith, 1956; Ojima et al., 2021), were housed and provided water and food ad libitum. To ensure the chickens were free from Salmonella, fecal swabs were taken from the transport box for the bacteriological detection of Salmonella before experimental infection. For oral infection, each chicken was inoculated by oral gavage either with 10⁸ CFU of wild-type or wecB::Cm mutant strain in a volume of 1.0 ml at 20 days old. After inoculation, chickens were reared for 14 days and observed twice a day to monitor their clinical signs. Animal experimentation protocol was approved by the President of Kitasato University through the judgment of the Institutional Animal Care and Use Committee of Kitasato University (Approval No. 20-055 and 21-039).

For the detection of bacterial counts in the systemic sites of the chickens post-infection, chickens were inoculated by oral gavage with 10⁸ CFU of wild-type or wecB::Cm mutant, as described earlier, and were euthanized on 1, 3, 5, and 7 days post-infection. The chickens orally inoculated with 1.0 ml of PBS were used as negative controls. Three to six chickens in each group were euthanized at each time point. The liver and spleen samples were collected aseptically and then homogenized in 9 volumes of PBS. The homogenates were further serially diluted 10-fold with PBS and spread on LB agar plates. After incubating at 37°C for 24 h, the number of colonies on the plate was counted, and it was calculated as a CFU/g organ.

The clinical changes in chickens infected with the wild-type or wecB::Cm mutant were observed and evaluated for the onset of systemic infection. Clinical signs, redness, and discoloration of the comb and ruffled feathers were observed and recorded. Three to six chickens in each group were euthanized at 1, 3, 5, and 7 days after infection and were investigated for the extent of inflammation by observing redness, swelling, congestion, bleeding, and discoloration of the tissues. To estimate histological changes and inflammation levels, the liver and spleen of each group were fixed in 4% paraformaldehyde (pH 7.4) for 24 h at 4°C and embedded in paraffin wax. Sections were cut at three levels to a thickness of 4 μm and stained by the Hematoxylin-eosin (HE) staining. Histological changes, such as infiltration of inflammatory cells and tissue damages, were recorded for each section.

To analyze the host responses in the organs of the chickens infected with the wild-type or wecB::Cm mutant, five or six chickens in each group were euthanized at 1, 3, 5, and 7 days post-infection, as described earlier. Tissue samples of the liver and spleen were immersed separately in 0.5 ml of RNAlater (Thermo Fisher Scientific, Waltham, MA, USA) and stored at −80°C until use. Total RNA was extracted from 5 × 5 mm of the tissue using RNAiso Plus (TaKaRa, Kusatsu, Japan) according to the manufacturer's instructions. The quantity and quality of RNA were determined by spectral analysis (NanoDrop 2000, Thermo Fisher Scientific). After being treated with DNase, RNA was transcribed to complementary DNA (cDNA) using the ReverTra Ace^® qPCR RT Master Mix (Toyobo), following the manufacturer's instructions. The expression of mRNA for interleukin (IL)-1β, IL-6, tumor necrosis factor (TNF)-α, interferon (IFN)-γ, IL-12, and CXCLi1 in the tissues was measured using quantitative real-time RT-PCR. Primer sequences are listed in Table 1. Notably, 20 μl reaction mixture, which contained 2.0 μl cDNA, 10 μl THUNDERBIRD^® SYBR^® qPCR Mix, 0.6 μl of each primer (at 10 μM), 0.4 μl 50 × ROX reference dye, and 6.4 μl nuclease-free water, was prepared using the THUNDERBIRD^® SYBR^® qPCR Mix (Toyobo). Quantitative real-time RT-PCR was performed on StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with the following reaction profile: one cycle at 95°C for 20 s, and 40 cycles at 95°C for 3 s and 60°C for 30 s. The melt-curve mode was used to check the specificities of amplified products (one cycle at 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s) after amplification. The expression of the target genes was determined using the cycle threshold value relative to that of the housekeeping gene GAPDH. The results were expressed as fold changes in corrected target gene expression in the infected chickens relative to the uninfected controls.

To assess the level of antibody production in chickens inoculated with the wecB::Cm mutant, blood samples were collected from the 5 inoculated chickens at 45 days post-infection. Serum samples were prepared by centrifugation and filtered through a 0.22-μm membrane. All serum samples were stored at −20°C until use. A slide agglutination test using wild-type bacterial antigen preparations was used to detect antibodies in chicken serum that was serially diluted 2-fold, according to the previously reported method (Soria et al., 2015). PBS and serum from uninfected chickens (n = 5) were used as a negative control, and anti-O9 serum (Denka, Tokyo, Japan) was used as a positive control. To rechallenge with the wild-type strain in wecB::Cm-inoculated chickens (n = 5), the chickens were inoculated by oral gavage with a 1.0-ml volume of 10⁸ CFU of the wild-type strain at 35 days after wecB::Cm inoculation. The chickens were reared for 14 days and observed twice daily to monitor their clinical signs.

The bacterial counts were converted logarithmically, and the differences between means of wild-type and wecB::Cm mutant obtained for each day were analyzed using Student's t-test. For the analysis of cytokine expressions, the statistical comparison was made by one-way ANOVA analysis, followed by Tukey's multiple comparison test to detect differences between uninfected control group, wild-type infected group, and wecB::Cm mutant infected group at each day. Both analyses were performed using GraphPad Prism version 9.2.0 (GraphPad Software; San Diego, CA, USA), and p < 0.05 was considered statistically significant.

We first examined whether the wecB::Cm mutant has any alterations in the morphological, physiological, or biochemical properties. The growth curves and viable counts of the mutant in LB broth under aerobic conditions were highly similar to that of the wild-type strain, although the mutant tended to grow slower, the differences were not statistically significant (Figures 1A,B). There were no differences in the morphology and size of the colonies between the mutant and the wild-type strains (data not shown). The effects of the wecB gene deletion on the sensitivity of S. Gallinarum to bile acids, H₂O₂, and nalidixic acid were also evaluated. In the presence of 0.01 mM or 0.02 mM bile acid, the wecB::Cm mutant showed significantly lower OD values after 2 h of exposure to bile acid, indicating it was more sensitive than the wild-type strain (Figure 1C). In the presence of 0.5 and 1.0 mM H₂O₂, the wecB::Cm mutant showed comparable growth to the wild-type strain after exposure for 10 h, although the mutant showed lower OD values at the 24-h time point at 1.0 mM H₂O₂ (Figure 1D). To examine whether the wecB gene is also relevant for antibiotic resistance, the growth of the wecB::Cm mutant was analyzed in LB supplemented with nalidixic acid. At 1.25 mg/ml of nalidixic acid, the growth of the mutant showed a significantly lower OD value than the wild-type strain (Figure 1E). When a high concentration of 2.5 mg/ml was added to the media, both the mutant and wild-type strains abrogated growth.

To investigate the pathogenic roles of the wecB gene in the infected chicken in vivo, we next analyzed the clinical changes and mortality in chickens orally infected with the wecB::Cm mutant or the wild-type S. Gallinarum. Chickens infected with 10⁸ CFU of wild-type S. Gallinarum showed significant clinical symptoms of fowl typhoid, such as feather disturbance and depression. All chickens infected with the wild-type S. Gallinarum died between 6 and 9 days post-infection (Figure 2A). In contrast, the chickens infected with the wecB-deficient mutant at the same dose as the wild-type strain exhibited no significant clinical changes and no deaths occurred. They showed a survival rate of 100% even when they were observed up to 25 days post-infection (data not shown).

A previous study has reported that the most characteristic pathological lesions of fowl typhoid, such as hypertrophy, white lesions, and small necrotic foci, were observed in the liver of chickens (Ojima et al., 2021). In this study, we compared the pathological changes in the liver of chickens infected with wild-type and wecB::Cm mutant strains. In wild-type infected chickens, white lesions and small necrotic foci were observed on 3 days after infection, and liver hypertrophy and congestion were observed on 7 days after infection (Figure 2B). In contrast, although slight white lesions and small necrotic foci were observed on 5 days after infection, no hypertrophy or swelling was observed in the liver of chickens infected with the wecB::Cm mutant.

To investigate the spreading and proliferation abilities of the wecB-deficient mutant in the infected chickens, we detected the bacterial burdens in the liver and spleen of chickens at 1–7 days after oral infection with 10⁸ CFU of wild-type or wecB::Cm mutant. The results showed that the bacterial counts of wild-type strain in the liver and spleen increased from 1 to 7 days post infection and showed bacterial numbers from 10² CFU/g increasing to 10⁸ CFU/g, respectively, indicating that the wild-type strain rapidly spread to the systemic sites through the gastrointestinal tract and rapidly proliferated in large amounts in the liver and spleen that further caused systemic infection (Figure 3). In contrast, the bacterial counts of the wecB::Cm mutant in the liver and spleen slowly increased from days 5 and 7 post-infection and the bacteria numbers remained at 10⁴ CFU/g. There were significantly lower bacterial numbers of the wecB::Cm mutant in the liver and spleen than those of the wild-type strain at 5 and 7 days post-infection (p < 0.01; Figure 3).

To understand whether the wecB gene is related to tissue inflammation caused by S. Gallinarum, we performed histopathological examinations on the liver and spleen of infected chickens. In the livers, lesions became detectable on 3 days after infection and the lesions were characterized by marked infiltration of heterophils and lymphocytes with degeneration and necrosis of hepatocytes (Figure 4). In contrast, very limited or no significant pathological changes were observed in the liver of wecB::Cm mutant-infected chickens. In the spleen, histopathological changes, such as degeneration and necrosis in white pulp, were observed on 5 and 7 days post-infection in the wild-type infected chickens (Figure 5). In contrast, although some mild white pulp necrosis was observed in chickens infected with the wecB::Cm mutant on 5 days after infection, no lesions were observed on 3 and 7 days post-infection.

To further analyze the immune responses in the chickens infected with wecB::Cm mutant, we determined the expression of selected cytokine and chemokine genes of IL-1β, IL-6, TNF-α, IFN-γ, IL-12, and CXCLi1 in the liver and spleen of chickens after infection with wild-type or wecB::Cm mutant strains, respectively. Results showed that the expression of TNF-α was significantly induced in the liver of chickens infected with the wild-type strain at 3 and 5 days post-infection. The expressions of IL-1β, IL-6, TNF-α, IFN-γ, IL-12, and CXCLi1 were also markedly increased in the livers of wild-type infected chickens on 5 days post-infection. In contrast, the expression of IL-1β, TNF-α, and CXCLi1 in the livers of chickens infected with wecB::Cm mutant was significantly lower than that of the chickens infected with the wild-type strain (Figure 6A). The expression levels of the cytokines were almost the same as those of the uninfected control chickens. In the spleen, neither wild-type nor wecB::Cm mutant infections significantly expressed any tested pro-inflammatory cytokine and chemokine genes. There were no significant differences between the chickens infected with wild-type and wecB::Cm mutant strains (Figure 6B).

To determine whether the loss of virulence was due to the inability of wecB::Cm mutant to grow in the host, the numbers of bacteria in the livers and spleens of chickens infected with the mutant were monitored for up to 45 days post-infection (Figure 7A). On 5 days post-infection, a few bacteria, ~2 ×10⁴ CFU/g in the livers and 1 ×10³ CFU/g in the spleens, were recovered from the chickens infected with the wecB::Cm mutant compared with the wild-type strain. Starting from the 5th day after infection and continuing to 25 days after infection, wecB::Cm bacteria were reduced and eliminated from the chickens, and no bacteria were recovered from the organs 35 days after infection. In addition, we further determined whether wecB::Cm-inoculated chickens induced anti-S. Gallinarum antibody production. The results showed that all the chickens significantly produced antibodies compared with the uninfected controls (Figure 7B). Furthermore, the chickens with high antibodies and rechallenged with 10⁸ CFU of wild-type S. Gallinarum showed significantly higher survival rates than the control chickens that were not initially inoculated with the wecB::Cm mutant and did not produce antibodies against S. Gallinarum (Figure 7C).