Plantaricin BM-1 was prepared according to the method reported in our previous study (Zhang et al., 2013). In brief, Lactiplantibacillus plantarum BM-1 was cultured in MRS broth at 37°C for 20 h. The supernatant of the fermentation broth was collected by centrifugation, and plantaricin BM-1 was purified by dialysis, desalting, and cation exchange. The purified plantaricin BM-1 was freeze-dried and stored at −80°C.

The bacterial strains used in this study are listed in Table 1. E. coli strains were cultured in Luria-Bertani (LB) broth at 37°C with aeration at 180 rpm. Lactobacillus plantarum BM-1 was cultured in de Man, Rogosa, and Sharpe (MRS) broths at 37°C with aeration at 180 rpm.

The concentration of the purified plantaricin BM-1 was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, MA, United States). Then, double dilution solutions (55.32, 27.66, 13.83, 6.915, 3.4575, 1.72875, 0.864385, 0.4321875, and 0.21609375 mg/mL) were prepared using sterile water under sterile conditions. Equal amounts of the diluted solutions were added to the wells of 96-well plates (100 μL per well) according to the dilution gradient, and the same amount of sterile water was used as the negative control. E. coli at the logarithmic growth phase was collected and used to prepare a 10⁴ CFU/mL bacterial suspension. Then, 100 μl of the E. coli suspension was added to each well. After mixing, the plates were incubated at 37°C for 12 h, and the optical density (OD) at 600 nm (OD₆₀₀) was determined using an ELISA plate reader (ELX808; BioTek, VT, United States). Each experiment was performed in triplicate. Based on the OD₆₀₀ values, the E. coli-inhibitory rate of each sample was calculated. Then, Graphpad Prism 7.00 was used to calculate the IC₅₀.

basS complemented strain (E. coli ReJW4073) and basR complemented strain (E. coli ReJW4074) were constructed using the lambda Red homologous recombination method (Juhas and Ajioka, 2016). In brief, the pKD46 plasmid was transformed into competent mutant cells prepared with cold 0.1 mol/mL CaCl₂, and the expression of the homologous recombinase in pKD46 was induced by adding 0.5 mg/mL L-arabinose to the LB broth and incubating at 30 °C. Then, competent mutant cells carrying the pKD46 plasmid were obtained. basS gene fragments were amplified from E. coli K12 using the primers, BasS-F (5′-3′): AGCGTGCTGGTGGTCAGCAGCTTTCTTTATATCTGGTTT GCCACGTACTGA and BasS-R (5′-3′): CTTACTCCTTT TGATTAACTTAGACATGCATTTTCTGCGCCGACCAATAT (homology underlined), while basR gene fragments were amplified from E. coli K12 using the primers, BasR-F (5′-3′): CGGCGCAGAAAATGCATCAGATTCAATTAGTTTTCCTCA TTCGCGACCAG and BasR-R (5′-3′): CGTTTGAACGTC CTCTCACTCACTTTGAAAATTCTGATTGTTGAAGACGA (homology underlined). Then, these fragments were transfected into the prepared competent E. coli JW4073 and E. coli JW4074 cells. Next, 900 μL of LB broth was added to the cells and incubated at 37°C for 1 h. Then, the cells were diluted with physiological saline, spread on LB agar, and incubated at 37°C for 12 h. A single colony was selected and verified using the BasS-F/R and BasR-F/R primers.

Wild-type E. coli K12, E. coli JW4073, E. coli JW4074, E. coli ReJW4073, and E. coli ReJW4074 were cultured in LB broth at an initial concentration of 4.0 log₁₀ CFU/mL with or without plantaricin BM-1 (0.5 × IC₅₀ of E. coli K12) at 37 °C for 12 h. Samples of the bacterial solution were collected 2-hourly and transferred onto a plate for cell counting, and the mean values of the results of three experiments were plotted. All experiments were performed in triplicate.

Quantitative proteomic analysis of wild-type E. coli K12 and mutant strains was carried out by Tandem mass tags (TMT) to screen for differentially expressed proteins between the three strains, and bioinformatic analysis was performed to compare differentially expressed proteins between the different groups. These analyses were performed by Shanghai Meiji Biotechnology Co., Ltd., and the specific steps were as follows:

E. coli K12, E. coli JW4073, and E. coli JW4074 strains were cultured in LB broth (at a final concentration of 10⁴ CFU/mL) at 37 °C for 12 h without plantaricin BM-1. After centrifugation, the pellet was collected and treated with protein lysis buffer (8 M urea + 1% sodium dodecyl sulfate, protease inhibitor) to obtain total proteins. The concentration of the extracted proteins was determined using the Pierce BCA protein assay kit (Thermo Fisher Scientific, MA, United States). Demethylation was carried out by the addition of 100 mM (2-carboxyethyl) phosphine and 40 mM iodoacetamide into the total protein extract. Then, the proteins were hydrolyzed using trypsin at a 1:50 ratio. Hydrolytic peptides were labeled using a TMT labeling kit (Thermo Fisher Scientific, MA, United States), and then subjected to liquid chromatography-tandem mass spectrometry (LC-MS/MS). Three biological replicates were prepared for each sample.

High-pH liquid-phase TMT-labeled peptide separation was performed using a reversed phase liquid chromatographic system (Thermo Scientific Vanquish Flex, Thermo Fisher Scientific, MA, United States) equipped with a reversed-phase C18 column (ACQUITY UPLC BEH C18 Column, 1.7 μm, 2.1 mm × 150 mm, Waters, United States). Peptide elution was monitored at 214 nm; after 5 min, the eluted peptides were collected every minute, pooled into 10 fractions, and then lyophilized. The dried fractions obtained from the high-pH reverse-phase separation process were run on a Q Exactive mass spectrometer (Thermo Fisher Scientific, MA, United States) equipped with a C18 column (75 μm × 25 cm, Thermo Fisher Scientific, MA, United States) for their identification and quantification using previously reported identification parameters.

Liquid chromatography-tandem mass spectrometry data were matched using the Proteome Discoverer TM version 2.2 software, and searched on the uniprot-E. coli (strain K12) [83333]-4353s-20190412 database, with a ≤0.01 peptide false discovery rate. Only proteins containing at least one unique peptide were quantified. Subsequently, differentially expressed proteins were identified based on fold-change >1.2 or <0.83 between treatments and p < 0.05. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis¹ was used to identify the functional subclasses and metabolic pathways of the differentially expressed proteins.

Wild-type E. coli K12 and mutant E. coli JW4073 and E. coli JW4074 strains were cultured in liquid LB broth at 37°C for 12 h at an initial concentration of 4.0 log₁₀ CFU/mL. Total bacterial RNA was extracted using a bacterial RNA extraction kit (Vazyme Biotech, Nanjing, China). Then, Real time quantitative PCR (RT-qPCR) was performed using a Hiscript II One Step qRT-PCR SYBR Green kit (Vazyme Biotech, Nanjing, China). Using 1 μg RNA as a template, 10 μL of 2 × One step SYBR Green mixture, 1 μL of one-step SYBR Green enzyme mixture, 0.4 μL of 50 × Rox reference dye, 0.4 μL of gene specific primer forward (10 μM), and 0.4 μL gene specific primer reverse (10 μM) were added to a ribonuclease-free centrifuge tube, and RNase free ddH₂O was added to make up the volume to 20 μL. The RT-qPCR reaction cycling conditions were as follows; 50°C for 15 min, 95°C for 30 s, 95°C for 10 s, 60°C for 30 s, and 40 cycles. The primers shown in Table 2 were used for the PCR reaction. Using the wild-type E. coli K12 gene expression level as the internal reference factor, relative gene expression in mutant E. coli JW4073 and E. coli JW4074 was calculated by the 2^–ΔΔCT method.

E. coli JW3923, E. coli JW4084, E. coli JW0616, E. coli JW1604, E. coli JW2235, E. coli JW2236, and E. coli JW2237 strains were cultured in LB broth at 37 °C for 12 h at an initial concentration of 4.0 log₁₀ CFU/mL, with or without plantaricin BM-1 (1 × IC₅₀ of E. coli K12). Samples of the bacterial suspension were collected every 2 h and transferred onto a plate for cell quantification, and the mean values of the results of three experiments were plotted. All experiments were performed in triplicate.

All experiments were performed in triplicate, and data are presented as the mean ± SD. Analysis of variance was used to compare viable cell counts between the growth curves of E. coli treated with and without plantaricin BM-1 at a significance level of 0.05.

After culturing the bacterial strains in various plantaricin BM-1 concentrations at 37°C for 12 h, the OD₆₀₀ of each bacterial suspension was determined. The IC₅₀ of plantaricin BM-1 in E. coli K12, E. coli JW4073, and E. coli JW4074 strains were determined to be 10.85, 8.94, and 7.62 mg/mL, respectively.

The 1,092 bp basS gene fragment and the 669 bp basR gene were amplified from the E. coli K12 genome by PCR using the BasS-F/R and BasR-F/R primer pairs, and were subsequently used to replace the kanamycin resistance gene in E. coli JW4073 and E. coli JW4074 via red homologous recombination. Genomic DNA was extracted from E. coli and its corresponding complement strain, and PCR was performed on both genomes using the BasS-F/R and BasR-F/R primer pairs to confirm successful mutant construction.

A 1,092 bp product was amplified from the complemented E. coli ReJW4073 strain, but no amplified band was detected for E. coli JW4073; in addition, a 669 bp product was amplified from the complemented E. coli ReJW4074 strain, but no amplified band was detected for E. coli JW4074 (Figure 1). Sequencing results showed that the sequences of the amplified gene fragments from E. coli ReJW4073 and E. coli ReJW4074 were the same as those of the basS and basR gene fragments of E. coli K12, respectively, indicating that E. coli ReJW4073 and E. coli ReJW4074 were successfully constructed.

The effects of plantaricin BM-1 on the growth of E. coli K12, E. coli JW4073, E. coli JW4074 E. coli ReJW4073, and E. coli ReJWW4074 strains were assessed through the generation of standard growth curves (Figure 2). In the absence of plantaricin BM-1, all three strains showed similar exponential growth. E. coli K12, E. coli JW4073, and E. coli JW4074 cell counts at 12 h were 9.3, 9.5, and 9.6 log₁₀ CFU/mL, respectively. E. coli JW4073 and E. coli JW4074 had similar growth conditions, and their curves almost overlapped, probably due to the fact that mutations in BasS and BasR induce similar effects. Although the three strains eventually reached a similar peak growth level at 12 h, E. coli K12 multiplied faster before 8 h.

In the presence of plantaricin BM-1, wild-type E. coli K12 grew slowly over the 12 h period, and the concentration of viable bacteria cells at 12 h was found to be 7.9 log₁₀ CFU/mL, indicating that wild-type E. coli K12 was moderately sensitive to plantaricin BM-1. In contrast, E. coli JW4073 and E. coli JW4074 grew slowly from 0 to 4 h, with almost no increase in the number of viable bacterial cells. The number of viable E. coli JW4073 and E. coli JW4074 bacterial cells at 12 h were 6.4 log₁₀ CFU/mL and 5.8 log₁₀ CFU/mL, respectively, and these values were significantly (P < 0.05) lower than that obtained for wild-type E. coli K12. Our results indicated that mutations in BasS and BasR increased the sensitivity of E. coli K12 to plantaricin BM-1.

In the presence of plantaricin BM-1, the growth curves of the supplementary strains (E. coli ReJW4073 and E. coli ReJW4074) were similar to that of wild-type E. coli K12, indicating that the sensitivity of the supplementary strains increased to the same level as that of the wild-type strain. This further indicated that the BasS/BasR TCS regulates the sensitivity of E. coli to plantaricin BM-1.

To determine the mechanism by which the BasS/BasR TCS affects the sensitivity of E. coli K12 to plantaricin BM-1, a TMT proteomic analysis was performed on E. coli K12, E. coli JW4073, and E. coli JW4074. A total of 2,752 proteins were identified, with a 1.2-fold change in threshold differential expression (upregulated Fold change >1.2, downregulated Fold change <0.83), and a statistically tested Student’s t-test P-value < 0.05 considered as the significance threshold for biological information in the differential protein scientific analysis. As shown in Figure 3A, the expression levels of 162 of these proteins changed in the E. coli JW4073/E. coli K12 comparison group, i.e., 100 upregulated and 62 downregulated proteins (p < 0.05). As shown in Figure 3B, in the E. coli JW4074/E. coli K12 comparison group, the expression levels of 84 proteins changed, i.e., 26 upregulated and 58 downregulated proteins (p < 0.05).

Based on the analysis of the subcellular location of the differentially expressed proteins in the two comparison groups, we found that proteins which showed significant changes in their expression levels were mainly concentrated in the cytoplasm in both E. coli JW4073 and E. coli JW4074 strains, accounting for 87.65 and 95.64% of the total differential proteins, respectively. The other proteins were distributed in the plasma membrane and the extracellular milieu. There were relatively greater changes in plasma membrane protein levels in E. coli JW4074 than in E. coli JW4073, accounting for 10.49% of all differentially expressed proteins (Data not shown).

Gene ontology (GO) describes the role of eukaryotic genes and proteins in cells through the establishment of a controlled vocabulary set in a dynamic form, so as to fully describe the properties of genes and gene products in organisms. KEGG functional annotation analysis was performed on the proteins to verify the functional classification of the pathway or the role of the protein at the functional level. Fisher’s exact test was used to compare categorical data. At corrected P-values (P adjust) < 0.05, the KEGG pathway function was considered to be significantly enriched.

In the E. coli JW4073/E. coli K12 group, among the 162 differentially expressed proteins, 131 were labeled as biological process (BP), and their content in relation to cellular and metabolic process-related proteins were 50.38 and 28.24%, respectively (Figure 4A). In the E. coli JW4074/E. coli K12 group, among the 84 differentially expressed proteins, 73 proteins were labeled as biological process (BP), and their content in relation to cellular and metabolic process-related proteins were 76.71 and 69.86%, respectively (Figure 4B).

In the E. coli JW4073/E. coli K12 group, upregulated proteins were mainly involved in five pathways, i.e., the flagella assembly (eco02040) pathway, the bacterial chemotaxis pathway (eco02030), the arginine and proline metabolic pathway (eco00330), the lysine degradation pathway (eco00310), and the ABC transport pathway (eco02010) (Figure 5A). The downregulated protein enrichment pathways included the TCS pathway (eco02020), the nitrotoluene degradation pathway (eco00633), and microbial metabolism in different environments (eco01120) (Figure 5B). In the E. coli JW4074/E. coli K12 group, only the purine metabolic pathway (eco00230) was significantly enriched in the 26 upregulated proteins (Figure 5C). The arginine and proline metabolic pathways (eco00330), as well as the glyoxylate and dicarboxylate metabolic pathways (eco00660), were significantly enriched in 58 downregulated proteins (Figure 5D).

As compared to the wild-type E. coli K12 strain, in E. coli JW4073 and E. coli JW4074 strains, there were 15 proteins with the same differential expression trend, including 1 up-regulated protein and 14 down-regulated proteins (Table 3). These proteins were found to be mainly involved in biological processes and cellular component and molecular functions. The only upregulated protein common to this protein was YmgA, which is a TCS-related protein. As concerns the 14 downregulated proteins, the glycerophospholipid metabolic pathway (eco00564), in which three different proteins (GlpA, GlpB, and GlpC) are involved, was significantly enriched. The expression levels of GlpA, GlpB, and GlpC were downregulated 1. 54-, 1. 41-, and 1.64-folds, respectively, in E. coli JW4073, and 1. 75-, 1. 50-, and 2.01-folds, respectively, in E. coli JW4074. These proteins are important components of the simple ATP-generation electron transport pathway used by E. coli during growth in anaerobic conditions. Of the 14 downregulated proteins, 8 proteins, including pyruvate formate lyase (PflD), citrate lyase (CitF), dicarboxylate transporters (DcuB, DcuC), fumarate synthase (FumA), and anaerobic glycerol-3-phosphate dehydrogenase (GlpABC), were found to be related to the TCA cycle (Table 3).

RT-qPCR findings (Figure 6) showed a significant decrease in the transcriptional levels of glpA, glpB, and glpC in mutant strains (p < 0.05). Their expression levels were downregulated 0.67-, 0.36-, and 0.63-folds, respectively, in E. coli JW4073, and downregulated 0.03-, 0.02-, and 0.02-folds, respectively, in E. coli JW4074. These results were consistent with the findings of the proteomic analysis.

The effects of plantaricin BM-1 on the growth of pflD, dcuB, dcuC, fumA, glpA, glpB, and glpC E. coli mutants were assessed by generating standard growth curves (Figure 7). In the absence of plantaricin BM-1, all the mutant strains showed similar exponential growth. Related gene mutations did not affect the normal growth ability of E. coli. In the presence of plantaricin BM-1, mutant E. coli strains grew slowly over the 12 h period, with approximately no increase in the number of viable bacterial cells, and their counts were significantly (P < 0.05) lower than that of the wild-type E. coli K12 strain. We found that the BasS/BasR TCS affected the sensitivity of E. coli to plantaricin BM-1 by regulating PflD, DcuB, DcuC, FumA, GlpA, GlpB, and GlpC expression.