Pathogens were isolated from naturally infected Shengzhou nane fruit obtained from an orchard in Shengzhou city, Zhejiang Province, China, and were immediately transported to the laboratory for experiments. The naturally infected tissues were collected at the junction of the diseased and healthy parts of the fruit when they decayed with typical diseases. The samples were sterilized with 75% alcohol for 1 min, soaked with 1.0% NaClO for 5 min, and rinsed with sterile water 3 times. Subsequently, the tissues were transferred to potato dextrose agar (PDA) medium and cultured at 30°C in the dark until mycelia appeared. Morphological traits, namely, color, shape, growth rate of the colony, and size of the spore, were measured using a microscope, and a total of more than 50 conidia were randomly selected for further length and width measurement.

The nuclear ribosomal internal transcribed spacer region (ITS) gene was amplified using the following universal primers: ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS4 R (TCCTCCGCTTAT TGATATGC) (Hashem et al., 2019). The translation elongation factor-1 (EF-1) gene was amplified with EF1-728F and EF1-986R primers (Carbone and Kohn, 1999). Using tweezers, 0.10 g of mycelium was collected from A. niger colonies cultured in PDA for 5 days. Samples were rapidly frozen in liquid nitrogen and homogenized to a powder, and the total genomic DNA was extracted using a DNeasy Kit (Beijing Solarbio Science and Technology Co., Ltd., China) following the manufacturer’s instructions. PCR was performed in a 25 μl volume containing a 1.0 μl DNA template, 1.0 μl of each primer (10 μmol/L), 12.5 μl 2 × PCR Taq Master Mix (Tiangen Biotech, China), and 10.5 μl ddH₂O. The amplification conditions were performed in a thermal cycle as follows: 95°C for 4 min, followed by 34 cycles of 95°C for 30 s, 56.5°C for 30 s, 72°C for 1 min, and 72°C for 10 min. The PCR products were sequenced by Sangon Biotech, Shanghai, China. The ITS and EF-1 sequences were used for BLAST searches in the GenBank database, and the obtained results were compared with those of similar sequences deposited in the National Center for Biotechnology Information (NCBI)¹ databank. A phylogenetic tree was constructed using MEGA7.0 software. To fulfill Koch’s postulates, 10 healthy Shengzhou nane fruits were inoculated with a pathogen spore suspension (15 μL, 1 × 10⁵ spores/mL) from isolates collected from rotted fruit after surface sterilization, and sterilized water injection was used as the control. All samples were kept in sealed plastic boxes at 30°C with 90% relative humidity for 4 days.

A pathogenicity test was carried out according to the methods described by Hashem et al. (2019) and Huang et al. (2021). Healthy fruit including Shengzhou nane, yellow peach (Prunus persica), flat peach (Prunus persica “Compressa”), nectarine (Prunus persica var. nectarine), snow pear (Pyrus spp.), sand pear (Pyrus pyrifolia), apple (Malus domestica), carmine plum (Prunus salicina), red plum (Prunus persica), black plum (Prunus persica), cherry (Prunus avium L.), jujube (Ziziphus jujuba Mill.), tomato (Solanum lycopersicum), and grape (Vitis vinifera L.), which are the main fruits cultivated in the local area and easily decayed by fungi, were obtained from local orchards without apparent damage or disease on the surface. Six fruits were soaked in 1.0% NaClO for 2 min, washed with sterile water, air dried, and wounded using a sterilized steel rod. Fifteen microliters of the spore suspension (1 × 10⁵ spores/mL) was used to inoculate each healthy fruit (three replicates), while another three healthy fruits were inoculated with sterilized water as the control. All inoculated fruit was kept in sealed plastic boxes at 25°C with 90% relative humidity. The results were observed after 3 days of incubation.

To understand its epidemic properties, the biological characteristics of the pathogen, including optimal temperature, pH, carbon (C) source, and nitrogen (N) source for pathogen growth, were evaluated. The isolate was incubated on the PDA medium at 15, 20, 25, 30, 35, and 40°C and at pH 6.0 in the dark for 4 days. Furthermore, four lethal temperatures of 50–75°C were evaluated in a hot water bath for mycelia growth. Meanwhile, the isolate was inoculated on PDA at a pH of 4, 5, 6, 7, 8, 9, 10, and 11 at 30°C in the dark for 4 days. The pH of the medium was adjusted to 1.0 mol/L HCl or NaOH.

To determine the optimal C and N source, according to the formula of Czapek-Dox agar medium (3.0 g/L NaNO₃, 1.0 g/L KH₂PO₄, 0.5 g/L MgSO₄·7H₂O, 0.5 g/L KCl, 0.01 g FeSO₄, 30.0 g/L sucrose, 20 g/L agar, 1,000 mL H₂O, pH 7.0), 31.58 g/L glucose, 31.93 g/L sorbitol, 31.93 g/L maltose, 31.58 g/L fructose, 28.42 g/L starch, 31.58 g/L galactose or 28.42 g/L xylose instead of 30.0 g/L sucrose as a C source, and 10.58 g/L beef extract, 8.08 g/L peptone, 2.65 g/L glycine, 5.82 g/L phenylalanine, 1.54 g/L arginine, 1.41 g/L N_aNO₃, or 1.06 g/L urea instead of 3.0 g/L NaNO₃ as an N source were used. A control without a C or N source was used for each experiment. The isolate was incubated at pH 6.0 and 30°C in the dark for 4 days. The colony diameter was measured daily in all treatments using the decussation method.

Based on the antifungal activities of SBC and NT (Sigma Aldrich), the effect of SBC and NT on the mycelia growth of the pathogen was measured following protocols described by Zhou et al. (2018) and Xu et al. (2021). In brief, SBC was added to sterilized PDA to generate media with final concentrations of 0.0, 2.0, 4.0, 6.0, 8.0, 10.0, and 12.0 g/L; meanwhile, NT was added to sterilized PDA to generate media with final concentrations of 0.0, 2.5, 5.0, 10.0, 15.0, 20.0, and 25.0 mg/L. In addition, SBC and NT were both added to sterilized PDA to generate media with final concentrations of 6.0 g/L SBC + 2.5 mg/L NT and 6.0 g/L SBC + 5.0 mg/L NT according to the pretest results. The medium was poured into glass Petri dishes, and a 10 μL spore suspension (1 × 10⁵ spores/mL) of the pathogen was used to inoculate the PDA at 4 different points. Then, the Petri dishes were incubated at 30°C for 4 days, and the colony diameter was measured daily using the decussation method. The antifungal effect of the chemistry was evaluated according to Fadda et al. (2021). In brief, the antifungal effect of the plant extract was evaluated when the control colonies completely covered the plate surface. The results were expressed as a percentage of growth inhibition, calculated as follows:

where GI is the growth inhibition, G is the growth (cm) of the control without extract, and g is the growth of the colony in the media with extracts. The experiment was repeated three times.

Spore germination was very sensitive to chemistry culture; thus, several lower concentrations of SBC and NT were applied to evaluate the antifungal efficacy of SBC and NT against spore germination, based on our pretest results. The effects of SBC and NT on the spore germination of A. niger in vitro were assessed according to Jiao et al. (2020). Briefly, the solutions of 6.0 g/L SBC, 2.5 mg/L NT, 5.0 mg/L NT, and the combinations of 6.0 g/L SBC + 2.5 mg/L NT and 6.0 g/L SBC + 5.0 mg/L NT were prepared in 20 mL sterile potato dextrose broth (PDB) medium containing an A. niger suspension (1 × 10⁵ spores/mL). The samples in cotton-plugged glass tubes were cultivated at 30°C. After incubation for 24 h, the conidia were washed at least two times with phosphate-buffered saline (PBS, pH 7.0) and resuspended with sterile water. Subsequently, 20 μL of the spore suspension was added to a concave slide with a sterile pipette. From each slide, 200 spores were counted at random using an optical microscope. A spore was considered germinated when the length of the germinal tubule reached two times that of the total spore diameter. The inhibition percentage of spore germination was determined with respect to the control. The percentage of germinating spores among all spores detected was determined using a light microscope at a magnification of 1,000×. The average of the data obtained from the three replications is presented (Figures 1, 2).

Propidium iodide (PI) staining, following the methods described by Zhou et al. (2018) and Kong et al. (2019) with some modifications, was used to test the membrane integrity of the pathogen mycelia and spores. According to our pretest results, 6.0 g/L or higher SBC, 10.0 mg/L or higher NT, and lower concentrations of the combined SBC and NT treatments destroyed the cell structure. Mycelia and spores treated with 6.0 g/L SBC, 10.0 mg/L NT, and 4.0 g/L SBC + 2.5 mg/L NT were cultured for 4 days. Mycelia were collected from A. niger colonies cultured in PDA for 5 days using tweezers. Spores were collected from 5-day-old cultures of fungi growing in a PDA medium. The spores were collected from the plates, rinsed with 5 mL sterile distilled water containing 0.1% Tween-80, filtered through five layers of sterile cheesecloth to remove hyphae, counted by a hemocytometer, and used in the next test. The collected mycelia and spores were incubated with PI at a final concentration of 10.0 μg/mL and kept in the dark at 37°C for 30 min. The mycelia and spores were then collected and washed three times with 50 mmol/L PBS (pH 7.2). Samples were observed with a fluorescence microscope.

Membrane integrity was also assayed using a flow cytometer, following the method described by Wang et al. (2015) and Li et al. (2017), with some modifications. In brief, a 100 μL spore suspension of A. niger (1 × 10⁵ spores/mL) was added to 5 mL of 50 mmol/L PBS (pH 7.2) with 2% (w/v) D-glucose containing 0 (control), 6.0 g/L SBC, 10.0 mg/L NT, or 4.0 g/L SBC + 2.5 mg/L NT. They were incubated on a rotary shaker (120 r/min) for 24 h at 30°C. The spore suspension was then centrifuged at 5,000 × g for 10 min at 4°C, washed two times with PBS, and filtered two times through a 400 mesh screen to remove cell debris and aggregates. Subsequently, the spores were resuspended in 500 μL of 100 mmol/L PBS (pH 7.2) and stained with PI (10.0 μg/mL) for 30 min at 30°C in the dark. The mixture was centrifuged at 5,000 × g for 5 min at 4°C; the precipitate was washed two times with PBS to remove the residual dye, and then resuspended in 500 μL of PBS. Unstained spore suspension was used as an auto-fluorescence control. The spores were detected using a CytoFLEX flow cytometer (BD Biosciences). Fluorescence intensity upon stimulation with an argon-ion laser at 488 nm was measured using the PMT4 channel (625DL filter) and plotted against the cell number. From each sample, 20,000 spores were sorted and analyzed. The percentage of fluorescent spores in the population was calculated. Three replicates of each treatment were performed, and the entire experiment was performed three times.

Aspergillus niger treated with 6.0 g/L SBC, 10.0 mg/L NT, and 4.0 g/L SBC + 2.5 mg/L NT were cultured for 4 days. Collected mycelia and spores were used to determine the mitochondrial activity, the enzyme activities involved in the tricarboxylic acid (TCA) cycle, MMP, ATP, and ergosterol contents, as shown below.

Rhodamine 123 and a mitochondrial red fluorescence probe were used to test the mitochondrial activity. Mycelia and spores were incubated with Rhodamine 123 (50.0 μg/L) for 30 min and the mitochondrial red fluorescence probe (1.0 μg L⁻¹) for 1.0 h in the dark at 37°C. Mycelia and spores were collected and washed three times with 50 mmol/L PBS (pH 7.2). Samples with different stained proportions were observed with a fluorescence microscope to evaluate the mitochondrial activity.

To prepare mitochondria, 2.0 g of mycelia was added to a mortar with a small amount of liquid nitrogen and ground to break up whole cells. Broken cells were suspended with a five-fold volume of mitochondrial extract buffer. The mitochondrial extract buffer was composed of 50 mM potassium phosphate buffer (pH 8.0), 0.3 M mannitol, 0.5% (w/v) bovine serum albumin (BSA), 0.5% (w/v) polyvinylpyrrolidone-40 (PVP-40), 2 mM EGTA, and 20 mM cysteine. The homogenate was squeezed through a 40 × 40 μm mesh nylon cloth and centrifuged at 2,000 × g for 15 min. The supernatant was centrifuged at 12,000 × g for 15 min. The precipitate was suspended in wash medium buffer [0.3 M mannitol, 0.1% (w/v) BSA and 10 mM TES (pH 7.5)] and centrifuged again at 12,000 × g for 15 min. The final precipitate was washed once with wash medium and suspended in a small volume of the washing medium (mitochondrial fraction). The precipitate was used to determine enzyme activity and MMP.

Citrate synthetase (CS), isocitrate dehydrogenase (IDH), α-ketoglutarate dehydrogenase (α-KGDH), succinate dehydrogenase (SDH), and malate dehydrogenase (MDH) reagent kits were purchased from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China). CS, MDH, SDH, IDH, and α-KGDH activities in the mitochondria of the pathogen were determined spectrophotometrically. The reagent kits were used following the manufacturer’s instructions. MDH, SDH, and IDH activities were estimated at 340 nm in terms of redox reactions. α-KGDH and CS activities were determined at 600 and 412 nm, respectively (Kong et al., 2021).

Mitochondrial membrane potential, as a key indicator of mitochondrial function, can reflect the cellular health status (Li et al., 2020). The MMP Detection Kit (JC-1; Jiancheng Bioengineering Institute, Nanjing, China) was used as a fluorescent probe, as it is a rapid and sensitive kit for assessing changes in MMP in cells. It can be used for the early detection of cell apoptosis. First, a working solution of JC-1 was prepared. A positive control was then set up, and the experiment was carried out. Staining was observed using laser confocal microscopy. The JC-1 monomer (green fluorescence) was determined at an excitation wavelength of 490 nm and an emission wavelength of 530 nm. The JC-1 polymer (red fluorescence) was determined at an excitation wavelength of 525 nm and an emission wavelength of 590 nm.

ATP extraction from mycelia was carried out according to the methods reported by Mo et al. (2013). Typically, fresh mycelia (1.5 g) were rapidly frozen in liquid nitrogen and homogenized to powder. ATP was extracted from the powder with 6.0 mL of 0.6 mol/L perchloric acid in an ice bath for 5 min. The extraction mixture was centrifuged at 8,000 g (Heraeus Multifuge X1R, United States) for 15 min at 4°C. The supernatant was then collected and quickly neutralized to pH 6.5–6.8 with 1.0 mol/L NaOH solution. The neutralized supernatant was placed in an ice bath for 40 min to precipitate most of the potassium perchlorate and subjected to filtration paper to remove potassium perchlorate. The filtrate solution was filtered through a 0.45 μm filter. The samples were analyzed with an LC-20 AD HPLC system (Japan) equipped with an LC-20 AD pump system and an SPD-20 AD diode array detector. The column effluent was monitored by absorbance at 259 nm. Ten microliter samples were applied to an Ultrasphere ODS EC 250 × 4.60 mm column (CTO-10AS VP Japan). The materials were eluted with the mobile phase (pH 6.8, 50.0 mmol/L NaH₂PO₄) at 1.0 mL/min. The entire running time was about 20 min for the full separation and determination of ATP. ATP in mycelium samples was identified by comparison with the retention time of the standards. Standard ATP (Sigma, United States) was used for quantitative detection, and its concentration was determined using the external standard method.

Ergosterol was extracted as described by Wang et al. (2018). Mycelia were centrifuged at 8,000 × g for 10 min and washed two times with distilled water. Then, mycelia (1.5 g) were rapidly frozen in liquid nitrogen and homogenized to powder. A quantity of 15 ml KOH-C₂H₅OH solution (30%, w/w) was added to each pellet and vortexed. The mixture was incubated at 85°C for 4 h. After the tubes were cooled to room temperature, 10 mL of ether was added and vortexed. The ergosterol of the upper phase was sampled and quantified using the LC-20 AD HPLC system (Japan). Sterol extracts were separated on a C-18 packed column (245 × 4.6 mm) with methanol at a flow rate of 1 mL/min, and the eluate was continuously monitored using a UV spectrophotometer at 280 nm. Standard ergosterol (Sigma, United States) was used for quantitative detection. The ergosterol content was quantified as milligrams of ergosterol per gram of dry weight (mg/g).

The effects of SBC and NT on controlling postharvest disease in vivo were determined following the method described by He et al. (2019). Shengzhou nane was wounded with a sterile nail at the equator before inoculation. Then, the fruit was inoculated with a 10 μl spore suspension (1 × 10⁵ spores/mL) on each wound. After the fruit was air dried for 3 h, 10 μl SBC₁ (2.0 g/L SBC), SBC₂ (4.0 g/L SBC), SBC₃ (6.0 g/L SBC), NT₁ (25.0 mg/L NT), NT₂ (50.0 mg/L NT), NT₃ (100.0 mg/L NT), NT₄ (200.0 mg/L NT), NT₅ (400.0 mg/L NT), (SBC + NT)₁ (4.0 g/L SBC + 25.0 mg/L NT), (SBC + NT)₂ (4.0 g/L SBC + 50.0 mg/L NT), (SBC + NT)₃ (4.0 g/L SBC + 100.0 mg/L NT), or (SBC + NT)₄ (4.0 g/L SBC + 150.0 mg/L NT) were added to the wound sites. In addition, water-treated fruit was used as the control. Treated fruit was placed in a plastic box, and each tray was enclosed with a polyethylene bag to maintain high humidity (95%). The lesion diameter and decay rate of the fruit were used to determine disease severity 4 and 6 days after treatment. Each treatment contained three replicates, with 18 fruits per replicate.

All experiments were carried out with at least three replicates. Data were analyzed using one-way ANOVA in SPSS 23 software (SPSS Inc., Chicago, IL, United States). Statistical significance was followed by Tukey’s HSD test at p < 0.05 to examine differences between treatments.

The surface of the healthy Shengzhou nane fruit was smooth, with bright skin (Figure 3A). However, the peel became pale, and the fruit started to go rotten after being infected by the pathogen; then, black mold appeared (Figures 3B, C). The pathogen from a typical decay Shengzhou nane fruit was isolated and purified by growth on PDA (Figure 3E). After culturing at 30°C in the dark for 4 days, round and aerial hyphae were observed from the colony appearance (Figure 3F). Furthermore, the colony was white in the initial stage, then became dark and extended outward in a strip with no marginal or adherent growth (Figure 3F). Colonies grew with a mean hyphae growth rate of 9.42 ± 0.28 mm per day on PDA in the dark at 30°C. Mycelia were characterized by transverse septa and branches. The spore shape was round, and the size was 3.27 ± 0.13 μm (n = 50). The outside surface was uneven due to its sporulation with a single bottle-stem type, while many irregular protrusions were observed on the spore surface (Figures 3G, H).

A DNA-ITS sequence of about 681 bp was extracted from the isolated DNA (Figure 4A). The ITS regions of the fungal genes were sequenced and aligned to entries in the NCBI sequence database. The Blastn results indicated that ITS sequences shared 99% similarity with A. niger. Phylogenetic analysis was conducted using MEGA7.0 software, and the results showed that the isolated colony was clustered with the MT 430878.1 A. niger clade (Figure 4B).

The translation elongation factor-1 (EF-1) gene sequence was also amplified with EF1-728F and EF1-986R primer pairs (Figure 5A). The representative sequence was submitted to GenBank. The Blastn results indicated that the EF-1 sequence shared 100% similarity with a strain of A. niger (Accession Nos. MT318312.1 and MT318310.1). The isolated colony was clustered with the A. niger clade (Figure 5B). Therefore, the isolate was identified as A. niger (TXL-1).

In Koch’s postulate experiment, 10 healthy Shengzhou nane fruits were inoculated with isolated A. niger. The inoculated fruit became infected, and the same symptoms were found in naturally infected fruits, while those in the control group remained symptomless after 4 days of culture (Figure 3D).

The pathogenicity test of A. niger was determined on the fruits of yellow peach, flat peach, nectarine, snow pear, sand pear, apple, carmine plum, red plum, black plum, cherry, jujube, tomato, and grape. The typical round lesions appeared on all fruit surfaces 3 days after inoculation with A. niger, which was consistent with the symptoms in those of naturally infected Shengzhou nane fruit. The pathogen was re-isolated from symptomatic rotten fruit. As a result, it was identified as A. niger based on its morphological characteristics and gene sequences. Moreover, the pathogenicity of A. niger varied in different fruits. For example, mycelium was observed in peach and tomato, but the decay in grapes was not serious (Figure 6).

The biochemical tests showed that A. niger grew in a temperature range of 15–40°C. The greatest colony diameter was observed at 30°C (40.83 mm), followed by 25°C (32.93 mm) after 4 days of culture. However, mycelial growth was significantly inhibited at 40°C (Figure 7A). Thus, the optimal culture temperature for A. niger growth was 30°C.

To clarify the endurance temperature, the spores were treated with a hot water bath from 50 to 75°C for 10 min. Complete inactivation of the spore occurred at 75°C. However, there was no significant difference in colony diameter between treatments below 75°C (Figure 7B). These results suggest that the lethal temperature for A. niger is 75°C for 10 min.

Aspergillus niger grew in a pH range of 4.0–11.0. The greatest colony diameter was observed at pH 5.0 and 6.0 but decreased at pH values higher than 8.0 (Figure 7C).

Fructose as a C source in the medium produced the greatest colony diameter, recorded as 33.88 mm after 4 days of culture, followed by sucrose, maltobiose, xylose, and glucose. However, a very thin mycelial density and lower diameter were observed in the galactose media (Figure 7D). Mycelia did not grow in a starch- or carbon-free medium. The results indicated that the optimal C source for A. niger growth was fructose.

Peptone and beef paste as N sources in the medium produced the largest colony diameters, recorded as 41.94 and 40.98 mm, respectively, after 4 days of culture, followed by glycine, phenylalanine, sodium nitrate, and arginine. The smallest colony diameters were observed in the urea medium and the control (Figure 7E). The optimal N sources for A. niger growth were peptone and beef paste. Interestingly, unlike the C-free medium, the colony grew slowly in the N-free culture, indicating that some other substances could replace the N sources needed for A. niger growth.

Sodium bicarbonate or natamycin caused a significant decrease in the mycelial growth rate in proportion to the concentration (Figures 1A, B). Compared to the control, 6.0 g/L SBC induced mycelial growth inhibition by 40.73% (p < 0.05) after inoculation for 4 days, while it increased to 96.48 and 100% at 10.0 and 12.0 g/L SBC, respectively. Mycelial growth was significantly inhibited by all concentrations of NT tested in this experiment, and 25.0 mg/L NT inhibited mycelial growth by 100.0%. Moreover, the combination of SBC and NT induced a higher inhibition efficacy compared with the single chemistry treatments. For example, 4.0 g/L SBC, 2.5 mg/L NT, and 5.0 mg/L NT induced mycelial growth inhibition by 30.55, 10.56, and 33.58%, respectively, whereas the mycelial growth inhibition was 60.93 and 100% under treatments of 4.0 g/L SBC + 2.5 mg/L NT and 4.0 g/L SBC + 5.0 mg/L NT, respectively (Figure 1C).

Spore germination is the key process required to initiate vegetative growth. The germination rate of the spores, as well as the germination time of A. niger, differed by treatment. After 24 h incubation in control conditions, 91.28% of spores germinated, whereas the germination rates decreased and were recorded as 35.55, 30.72, 14.23, 5.22, and 0.0% in 6.0 g/L SBC, 2.5 mg/L NT, 5.0 mg/L NT, 4.0 g/L SBC + 2.5 mg/L NT, and 4.0 g/L SBC + 5.0 mg/L NT treatments, respectively (Figure 1D). The spores swelled and were enlarged, and the mycelia grew quickly with many granular inclusions formed in the mycelium after 24 h of culture in the control group during germination. However, only a few spores swelled, but no germination was observed in the SBC or NT treatments. Therefore, spore swelling may be the premise of spore germination. In addition, the 4.0 g/L SBC + 5.0 mg/L NT treatment completely inhibited spore germination (Figure 2).

Propidium iodide (PI), a fluorescent molecule, is membrane impermeable and can bind to DNA by intercalating between the bases with less or no sequence preference, which causes the nucleus to be stained with red fluorescence. Therefore, cells stained by PI can be used to identify the extent of cell damage (Jiao et al., 2020). In this study, the PI staining results showed that the mycelia and spores treated with 6.0 g/L SBC, 10.0 mg/L NT, or 4.0 g/L SBC + 2.5 mg/L NT were stained deeply compared to the control (Figure 8), indicating that SBC and NT destroyed the cell membrane integrity of A. niger cells and induced mycelia and spore death.

The membrane integrity of A. niger was also determined using flow cytometry after being stained with PI and was presented in two-dimensional dot plots. As shown in Figure 9, a homogenous population of undamaged cells was dominant in the control, while various cell sizes (forward scatter, FSC) and variations in complexity (side scatter, SSC) were observed on a scattergram of A. niger spores after 24 h of incubation in SBC and NT. Furthermore, a histogram plot was obtained by counting PI-labeled spores. In the control, the PI-stained spores accounted for only 3.39% of total spores (Figures 9B, b). In treatments of 6.0 g/L SBC (Figures 9C, c), 10.0 mg/L NT (Figures 9D, d), and 4.0 g/L SBC + 2.5 mg/L NT (Figures 9E, e), the percentage of PI-stained spores increased to 53.75, 63.65, and 75.03% (Figure 9F) (p < 0.05), respectively, indicating a loss in integrity and heavy damage to the cell membrane of the pathogen.

The mitochondrial red fluorescence probe bound the active mitochondria and emitted red fluorescence at different intensities, according to the MMP of living cells. The spores and mycelia of A. niger treated with 6.0 g/L SBC, 10.0 mg/L NT, and 4.0 g/L SBC + 2.5 mg/L NT showed a less stained proportion by mitochondrial red fluorescence compared with the control group (Figure 10).

Rhodamine 123 (Rh-123) is a specific probe used for evaluating changes in MMP since it can accumulate in normal mitochondria and be released to the outside of the mitochondria with a loss of MMP, leading to a stronger green fluorescence signal (Su et al., 2014). As shown in Figure 11, the fluorescence intensity of Rh-123 in the groups treated with 6.0 g/L SBC, 10.0 mg/L NT, and 4.0 g/L SBC + 2.5 mg/L NT was higher than that of the control group. Combined with the fluorescence staining results, it revealed that suitable concentrations of SBC and NT could destroy the cell structure, leading to the hyperpolarization of MMP and causing mitochondrial dysfunction in A. niger cells.

Compared with the control, the activity of the key enzymes involved in the TCA cycle, such as CS, IDH, α-KGDH, SDH, and MDH, in the mitochondria of A. niger cells decreased significantly (p < 0.05) under the treatments of 6.0 g/L SBC, 10.0 mg/L NT, and 4.0 g/L SBC + 2.5 mg/L NT (Figures 12A–E), especially α-KGDH activity. The significant decreases in the activities of these key enzymes indicated that mitochondrial function was destroyed by SBC and NT treatments.

The effects of the SBC and NT treatments on the ATP content of A. niger are presented in Figure 13A. Compared with the control, 6.0 g/L SBC, 10.0 mg/L NT, and 4.0 g/L SBC + 2.5 mg/L NT decreased the ATP content by 31.50, 50.51, and 63.68%, respectively (p < 0.05). Meanwhile, MMP decreased significantly in A. niger cells under the treatments of 6.0 g/L SBC, 10.0 mg/L NT, and 4.0 g/L SBC + 2.5 mg/L NT and was recorded as 30.03, 41.51, and 59.51% of the control, respectively (p < 0.05) (Figure 13B).

The effects of SBC and NT on the ergosterol content in the plasma membranes of A. niger mycelia are shown in Figure 14. After incubating with SBC or NT, the total ergosterol content decreased significantly. In detail, the ergosterol content decreased by 18.17, 39.42, and 58.09% (p < 0.05) of the control under the treatments of 6.0 g/L SBC, 10.0 mg/L NT, and 4.0 g/L SBC + 2.5 mg/L NT, respectively.

Rot lesions were significantly alleviated in Shenzhou nane fruit treated with different concentrations of SBC and NT 4 days after inoculation with A. niger spores (Figures 15A–C). The rot lesion diameter in the control fruit reached 13.67 mm. In contrast, it was reduced by 29.33, 43.76, 57.57, 34.79, 52.69, 61.96, 83.02, 100.00, 63.42, 68.30, 100.00, and 100.00% of the control (p < 0.05) in fruit treated with SBC₁ (2.0 g/L SBC), SBC₂ (4.0 g/L SBC), SBC₃ (6.0 g/L SBC), NT₁ (25.0 mg/L NT), NT₂ (50.0 mg/L NT), NT₃ (100.0 mg/L NT), NT₄ (200.0 mg/L NT), NT₅ (400.0 mg/L NT), (SBC + NT)₁ (4.0 g/L SBC + 25.0 mg/L NT), (SBC + NT)₂ (4.0 g/L SBC + 50.0 mg/L NT), (SBC + NT)₃ (4.0 g/L SBC + 100.0 mg/L NT), or (SBC + NT)₄ (4.0 g/L SBC + 150.0 mg/L NT), respectively (Figure 15D). Disease occurrence was completely restricted by the treatments NT₅, (SBC + NT)₃, and (SBC + NT)₄ (Figures 15B, C). Six days after inoculation, the fruit became soft, and the rot lesion diameters increased in all treatments. Moreover, the difference in the rot lesion diameters between the control and treatments SBC, NT, and SBC + NT was more marked. For instance, the rot lesion diameter was only 9.17% of the control in the fruit treated with (SBC + NT)₄. Meanwhile, after inoculation with A. niger spores, the decay rate of the fruit treated with NT₅ and SBC + NT was significantly reduced during storage compared with the control. The decay rate of the control group was 97.0%, while it was 2.66, 9.33, 3.67, 0.0, and 0.0% in the fruit treated with NT₅, (SBC + NT)₁, (SBC + NT)₂, (SBC + NT)₃, and (SBC + NT)₄, respectively, on the 6th day of storage (Figure 15E). The results indicated that SBC + NT was effective against A. niger in Shengzhou nane fruit.