<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Microbiol.</journal-id>
<journal-title>Frontiers in Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">1664-302X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fmicb.2021.782363</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>AzuR From the SmtB/ArsR Family of Transcriptional Repressors Regulates Metallothionein in <italic>Anabaena</italic> sp. Strain PCC 7120</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Divya</surname> <given-names>T. V.</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/1541599/overview"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Acharya</surname> <given-names>Celin</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>&#x002A;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/768258/overview"/>
</contrib>
</contrib-group>
<aff id="aff1"><sup>1</sup><institution>Molecular Biology Division, Bhabha Atomic Research Centre</institution>, <addr-line>Mumbai</addr-line>, <country>India</country></aff>
<aff id="aff2"><sup>2</sup><institution>Homi Bhabha National Institute</institution>, <addr-line>Mumbai</addr-line>, <country>India</country></aff>
<author-notes>
<fn fn-type="edited-by"><p>Edited by: Rob Van Houdt, Belgian Nuclear Research Centre, Belgium</p></fn>
<fn fn-type="edited-by"><p>Reviewed by: Vicente Mariscal, Institute of Plant Biochemistry and Photosynthesis, Spanish National Research Council (CSIC), Spain; Andr&#x00E9;s Gonz&#x00E1;lez, Arag&#x00F3;n Institute for Health Research (IIS Arag&#x00F3;n), Spain</p></fn>
<corresp id="c001">&#x002A;Correspondence: Celin Acharya, <email>celin@barc.gov.in</email></corresp>
<fn fn-type="other" id="fn004"><p>This article was submitted to Antimicrobials, Resistance and Chemotherapy, a section of the journal Frontiers in Microbiology</p></fn>
</author-notes>
<pub-date pub-type="epub">
<day>12</day>
<month>01</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2021</year>
</pub-date>
<volume>12</volume>
<elocation-id>782363</elocation-id>
<history>
<date date-type="received">
<day>24</day>
<month>09</month>
<year>2021</year>
</date>
<date date-type="accepted">
<day>30</day>
<month>11</month>
<year>2021</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#x00A9; 2022 Divya and Acharya.</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Divya and Acharya</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/"><p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p></license>
</permissions>
<abstract>
<p>Metallothioneins (MTs) are cysteine-rich, metal-sequestering cytosolic proteins that play a key role in maintaining metal homeostasis and detoxification. We had previously characterized NmtA, a MT from the heterocystous, nitrogen-fixing cyanobacterium <italic>Anabaena</italic> sp. strain PCC 7120 and demonstrated its role in providing protection against cadmium toxicity. In this study, we illustrate the regulation of <italic>Anabaena</italic> NmtA by AzuR (Alr0831) belonging to the SmtB/ArsR family of transcriptional repressors. There is currently no experimental evidence for any functional role of AzuR. It is observed that <italic>azuR</italic> is located within the <italic>znuABC</italic> operon but in the opposite orientation and remotely away from the <italic>nmtA</italic> locus. Sequence analysis of AzuR revealed a high degree of sequence identity with <italic>Synechococcus</italic> SmtB and a distinct &#x03B1;5 metal binding site similar to that of SmtB. In order to characterize AzuR, we overexpressed it in <italic>Escherichia coli</italic> and purified it by chitin affinity chromatography. Far-UV circular dichroism spectroscopy indicated that the recombinant AzuR protein possessed a properly folded structure. Glutaraldehyde cross-linking and size-exclusion chromatography revealed that AzuR exists as a dimer of &#x223C;28 kDa in solution. Analysis of its putative promoter region [100 bp upstream of <italic>nmtA</italic> open reading frame (ORF)] identified the presence of a 12&#x2013;2&#x2013;12 imperfect inverted repeat as the <italic>cis</italic>-acting element important for repressor binding. Electrophoretic mobility shift assays (EMSAs) showed concentration-dependent binding of recombinant dimeric AzuR with the promoter indicating that NmtA is indeed a regulatory target of AzuR. Binding of AzuR to DNA was disrupted in the presence of metal ions like Zn<sup>2+</sup>, Cd<sup>2+</sup>, Cu<sup>2+</sup>, Co<sup>2+</sup>, Ni<sup>2+</sup>, Pb<sup>2+</sup>, and Mn<sup>2+</sup>. The metal-dependent dissociation of protein&#x2013;DNA complexes suggested the negative regulation of metal-inducible <italic>nmtA</italic> expression by AzuR. Overexpression of <italic>azuR</italic> in its native strain <italic>Anabaena</italic> 7120 enhanced the susceptibility to cadmium stress significantly. Overall, we propose a negative regulation of <italic>Anabaena</italic> MT by an &#x03B1;5 SmtB/ArsR metalloregulator AzuR.</p>
</abstract>
<kwd-group>
<kwd><italic>Anabaena</italic> 7120</kwd>
<kwd>AzuR</kwd>
<kwd>regulation</kwd>
<kwd>metallothionein</kwd>
<kwd>cadmium stress</kwd>
</kwd-group>
<counts>
<fig-count count="7"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="50"/>
<page-count count="14"/>
<word-count count="9594"/>
</counts>
</article-meta>
</front>
<body>
<sec id="S1" sec-type="intro">
<title>Introduction</title>
<p>Trace metal ions are crucial for nearly all aspects of metabolism in the prokaryotic cells. These are involved in various biological processes like enzymatic reactions that require metal ions as cofactors, for folding and structural stabilization of the proteins or for the maintenance of the metal-sensing regulatory factors (<xref ref-type="bibr" rid="B32">Rees, 2002</xref>; <xref ref-type="bibr" rid="B3">Bertini et al., 2007</xref>; <xref ref-type="bibr" rid="B10">Chandrangsu et al., 2017</xref>). Although the essential metal ions are indispensable, these are toxic in excess amounts (<xref ref-type="bibr" rid="B10">Chandrangsu et al., 2017</xref>). As a result, the microorganisms have developed mechanisms to regulate the homeostasis of the essential metal ions. Metal homeostasis is mediated by balancing the uptake, storage, transfer, and efflux of the metals so that the cellular requirements are fulfilled and the right metal is introduced into the right macromolecule in the cells for various biological processes (<xref ref-type="bibr" rid="B39">Tottey et al., 2005</xref>; <xref ref-type="bibr" rid="B45">Waldron and Robinson, 2009</xref>).</p>
<p>Metallothioneins (MTs) are cysteine-rich, low-molecular-weight, metal-sequestering proteins that are known to bind metal ions via metal&#x2013;thiolate clusters and are involved in maintaining homeostasis of physiologically important metals like zinc (Zn<sup>2+</sup>) and copper (Cu<sup>2+</sup>) (<xref ref-type="bibr" rid="B20">Klaassen et al., 1999</xref>; <xref ref-type="bibr" rid="B5">Blindauer, 2011</xref>). Apart from binding to the essential metals, MTs are implicated in the detoxification of toxic metals including cadmium (Cd<sup>2+</sup>) and mercury (Hg<sup>2+</sup>) from the cells (<xref ref-type="bibr" rid="B20">Klaassen et al., 1999</xref>). MTs are induced in the presence of ionic species of various metals like Cd, Zn, Cu, Hg, Au, Ag, Co, Bi, Pb, Ni, and Cr (<xref ref-type="bibr" rid="B29">Palmiter, 1987</xref>; <xref ref-type="bibr" rid="B19">Huckle et al., 1993</xref>) as well as oxidative stress (<xref ref-type="bibr" rid="B2">Andrews, 2000</xref>). MT expression is strictly regulated owing to its role in maintaining metal homeostasis. While eukaryotic MT gene expression has been shown to be under positive regulation (<xref ref-type="bibr" rid="B20">Klaassen et al., 1999</xref>), prokaryotic MT expression is proposed to be negatively regulated (<xref ref-type="bibr" rid="B42">Turner and Robinson, 1995</xref>). The first characterized prokaryotic MT is <italic>Synechococcus</italic> sp. SmtA (<xref ref-type="bibr" rid="B6">Blindauer and Leszczyszyn, 2010</xref>). The <italic>smtA</italic> gene expression is negatively regulated by a zinc responsive transcriptional repressor SmtB (<xref ref-type="bibr" rid="B14">Erbe et al., 1995</xref>; <xref ref-type="bibr" rid="B41">Turner et al., 1996</xref>) of the SmtB/ArsR family of transcriptional regulatory proteins. The SmtB/ArsR family of proteins bind to specific regulatory sequences present upstream of the gene. Derepression of transcription by such regulators results from direct binding of the metal to the repressor, which inhibits its binding to the operator/promoter (O/P) region of the gene under regulation (<xref ref-type="bibr" rid="B9">Busenlehner et al., 2003</xref>; <xref ref-type="bibr" rid="B28">Osman and Cavet, 2010</xref>).</p>
<p>Analysis of the genome sequence of <italic>Anabaena</italic> PCC 7120 (hereby referred as <italic>Anabaena</italic> 7120) revealed two SmtB-like repressors of the SmtB/ArsR family, namely, (a) AztR (All7621) and (b) AzuR (Alr0831) (<xref ref-type="bibr" rid="B23">Liu et al., 2005</xref>). AztR has been identified as a Zn<sup>2+</sup>/Pb<sup>2+</sup>/Cd<sup>2+</sup>-responsive metalloregulator constituting a Zn<sup>2+</sup>/Pb<sup>2+</sup>/Cd<sup>2+</sup> efflux operon (<italic>aztAR</italic> operon) regulating AztA, a Zn<sup>2+</sup>-translocating CPx-ATPase (<xref ref-type="bibr" rid="B23">Liu et al., 2005</xref>, <xref ref-type="bibr" rid="B22">2008</xref>). However, presently, there is no experimental evidence toward the functionality and regulation of the other repressor, AzuR in <italic>Anabaena</italic> 7120, that shares 60% identity with SmtB (<xref ref-type="fig" rid="F1">Figure 1A</xref>). Previously, we had identified and characterized a MT from the heterocystous, filamentous cyanobacterium <italic>Anabaena</italic> 7120 (also belonging to the BmtA family) referred to as NmtA. Overexpression of NmtA in its native strain conferred tolerance to cadmium stress (<xref ref-type="bibr" rid="B12">Divya et al., 2018</xref>). We had observed increased abundance of the <italic>nmtA</italic> transcripts in the presence of elevated concentrations of metal ions like Zn<sup>2+</sup>, Cu<sup>2+</sup>, and Cd<sup>2+</sup> (<xref ref-type="bibr" rid="B12">Divya et al., 2018</xref>), indicating transcriptional regulation of <italic>nmtA</italic> expression. It is proposed that the expression of the proteins associated with metal homeostasis is largely regulated at the transcriptional level in bacteria (<xref ref-type="bibr" rid="B15">Finney and O&#x2019;Halloran, 2003</xref>). It is, therefore, worthwhile to explore whether AzuR, which is an SmtB-like repressor, has any role in the regulation of NmtA expression in <italic>Anabaena</italic> 7120.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption><p>Sequence analysis, structural modeling, phylogeny, and genomic organization of AzuR. <bold>(A)</bold> Multiple sequence alignment of AzuR with representative SmtB/ArsR family transcriptional repressors, SmtB (P30340), AztR (Q8ZS91), ZiaR (P9WMI4), BxmR (Q55940), CzrA (O85142), and CadC (P20047). The metal-sensing amino acids present in the &#x03B1;5 site are highlighted in purple, and the residues present in the &#x03B1;3N site are indicated in orange. <bold>(B)</bold> Structure of AzuR. (i) The tertiary structure model of AzuR was generated by using SmtB as the template by I-TASSER with the overlap of SmtB (PDB ID: 1R23) shown as traces in purple. Ligand (Zn<sup>2+</sup>) binding residues predicted by I-TASSER with (ii) <italic>Staphylococcus aureus</italic> CadC (PDB ID: 1U2W) and (iii) <italic>Synechococcus</italic> PCC 7942 SmtB (PDB ID: 1R22). Zn<sup>2+</sup> is shown in neon green and the metal-binding residues are indicated in blue. <bold>(C)</bold> Phylogenetic tree generated with representative sequences aligned by Clustal Omega using MEGA X software with 500 bootstrap replicates. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. <bold>(D)</bold> Schematic representation of the genetic locus of <italic>azuR</italic> ORF with respect to <italic>nmtA</italic> ORF in the <italic>Anabaena</italic> genome.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-12-782363-g001.tif"/>
</fig>
<p>The present study provides a comprehensive characterization of <italic>Anabaena</italic> AzuR (Alr0831). We show here that AzuR indeed binds to the upstream region of the <italic>nmtA</italic> open reading frame (ORF). DNA binding was repressed in the presence of various divalent metal ions, indicating a negative regulation of <italic>nmtA</italic> expression by AzuR. Our results showed that overexpression of <italic>azuR</italic> in <italic>Anabaena</italic> enhanced the susceptibility of the recombinant strain to cadmium stress significantly. The present investigation advances our understanding of the mechanisms of metal-regulated gene expression in the nitrogen-fixing cyanobacterium <italic>Anabaena</italic> 7120.</p>
</sec>
<sec id="S2" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec id="S2.SS1">
<title>Organism and Growth Conditions</title>
<p><italic>Anabaena</italic> 7120 cultures were grown in BG-11 liquid medium, pH 7.2, with combined nitrogen (17 mM NaNO<sub>3</sub>) under continuous illumination (30 &#x03BC;Em<sup>&#x2013;2</sup> s<sup>&#x2013;1</sup>) without or with shaking (100 rpm) at 27&#x00B0;C &#x00B1; 2&#x00B0;C (<xref ref-type="bibr" rid="B1">Allen, 1968</xref>). <italic>Escherichia coli</italic> cultures were grown in Luria&#x2013;Bertani (LB) medium at 37&#x00B0;C (DH5&#x03B1;, HB101) or 30&#x00B0;C (SHuffle) with shaking at 120 rpm. The neomycin antibiotic was used for recombinant <italic>Anabaena</italic> cultures in BG-11 liquid medium (15 &#x03BC;g ml<sup>&#x2013;1</sup>) or BG-11 agar plates (25 &#x03BC;g ml<sup>&#x2013;1</sup>), whereas chloramphenicol (34 &#x03BC;g ml<sup>&#x2013;1</sup>) or carbenicillin (100 &#x03BC;g ml<sup>&#x2013;1</sup>) was used for <italic>E. coli</italic> cultures. Primers, plasmids, <italic>E. coli</italic>, and <italic>Anabaena</italic> strains used in this study are listed in <xref ref-type="table" rid="T1">Table 1</xref>.</p>
<table-wrap position="float" id="T1">
<label>TABLE 1</label>
<caption><p>Primers, plasmids, and strains used in the study.</p></caption>
<table cellspacing="5" cellpadding="5" frame="hsides" rules="groups">
<thead>
<tr>
<td valign="top" align="left">Primer</td>
<td valign="top" align="left">Description</td>
<td valign="top" align="center">References</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left"><italic>nmtA</italic> Rev</td>
<td valign="top" align="left">CGCGGATCCTTAACAGCCACAGCCATTATG</td>
<td valign="top" align="center"><xref ref-type="bibr" rid="B12">Divya et al., 2018</xref></td>
</tr>
<tr>
<td valign="top" align="left"><italic>azuR_</italic>pTwinC Fwd</td>
<td valign="top" align="left">GGTGGTCATATGATTAAAAATCACACAAATTGTAC</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left"><italic>azuR_</italic>pTwinC Rev</td>
<td valign="top" align="left">GGTTGCTCTTCCGCAATCTTTTTCGTCCAAATG</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left"><italic>azuR_Nde</italic>I Fwd</td>
<td valign="top" align="left">GGAATTCCATATGATTAAAAATCACACAAATTG</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left"><italic>azuR_Bam</italic>HI Rev</td>
<td valign="top" align="left">CGGGATCCCTAATCTTTTTCGTCCAAATG</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">Prom_Fwd</td>
<td valign="top" align="left">ATTATTTCCTCCGTTTTCACTTGTG</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">Prom_Rev</td>
<td valign="top" align="left">AAACGTATTATATAACCTAATTGTTAC</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">Oligo(dT) anchor primer</td>
<td valign="top" align="left">GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTT</td>
<td valign="top" align="center">5&#x2032;3&#x2032; RACE kit, Roche</td>
</tr>
<tr>
<td valign="top" align="left">16S Fwd</td>
<td valign="top" align="left">CACACTGGGACTGAGACAC</td>
<td valign="top" align="center"><xref ref-type="bibr" rid="B31">Pinto et al. (2012)</xref></td>
</tr>
<tr>
<td valign="top" align="left">16S Rev</td>
<td valign="top" align="left">CTGCTGGCACGGAGTTAG</td>
<td valign="top" align="left"/></tr>
<tr>
<td valign="top" align="left"><bold>Plasmid</bold></td>
<td valign="top" align="left"/><td valign="top" align="left"/></tr>
<tr>
<td valign="top" align="left">pTwin1</td>
<td valign="top" align="left">Expression vector resulting in protein fusion with CBD and cleavable intein tag, Cb<sup>R</sup></td>
<td valign="top" align="center">NEB</td>
</tr>
<tr>
<td valign="top" align="left">pTwin<italic>azuR</italic></td>
<td valign="top" align="left">360 bp <italic>azuR</italic> fragment cloned in pTwin1 vector</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">pFPN</td>
<td valign="top" align="left">Cb<sup>R</sup>, Kan<sup>R</sup>, integrative expression vector</td>
<td valign="top" align="center"><xref ref-type="bibr" rid="B11">Chaurasia et al., 2008</xref></td>
</tr>
<tr>
<td valign="top" align="left">pAM1956</td>
<td valign="top" align="left">Kan<sup>R</sup>, promoterless gfpmutII reporter gene</td>
<td valign="top" align="center"><xref ref-type="bibr" rid="B49">Yoon and Golden, 1998</xref></td>
</tr>
<tr>
<td valign="top" align="left">pFPN<italic>azuR</italic></td>
<td valign="top" align="left">363 bp <italic>azuR</italic> fragment cloned in pFPN</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">pAM<italic>psbA</italic></td>
<td valign="top" align="left"><italic>Xma</italic>I-<italic>Sal</italic>I fragment from pFPN cloned in pAM1956 vector</td>
<td valign="top" align="left"/></tr>
<tr>
<td valign="top" align="left">pAM<italic>azuR</italic></td>
<td valign="top" align="left"><italic>Xma</italic>I-<italic>Sal</italic>I fragment from pFPN<italic>azuR</italic> cloned in pAM1956</td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">pAM<italic>nmtA</italic></td>
<td valign="top" align="left"><italic>Xma</italic>I-<italic>Sal</italic>I fragment from pFPN<italic>nmtA</italic> cloned in pAM1956 vector</td>
<td valign="top" align="center"><xref ref-type="bibr" rid="B12">Divya et al., 2018</xref></td>
</tr>
<tr>
<td valign="top" align="left"><bold><italic>E. coli</italic> strain</bold></td>
<td valign="top" align="left"/><td valign="top" align="left"/></tr>
<tr>
<td valign="top" align="left">DH5&#x03B1;</td>
<td valign="top" align="left">F<sup>&#x2013;</sup> <italic>recA41 endA1 gyrA96 thi-1 hsdR17 (r<italic><sup>k&#x2013;</sup></italic> m<italic><sup>k&#x2013;</sup></italic>) supE44 relA</italic>&#x03BB; <italic>lacU169</italic></td>
<td valign="top" align="center">Lab collection</td>
</tr>
<tr>
<td valign="top" align="left">BL21(DE3)pLysS</td>
<td valign="top" align="left">F<sup>&#x2013;</sup> <italic>ompT gal dcm lon hsdS<sub><italic>B</italic></sub></italic> (r<sub><italic>B</italic></sub><sup>&#x2013;</sup> m<sub><italic>B</italic></sub><sup>&#x2013;</sup>) &#x03BB;(DE3)<break/> pLysS (Cm<italic><sup>R</sup></italic>)</td>
<td valign="top" align="center">Lab collection</td>
</tr>
<tr>
<td valign="top" align="left">HB101</td>
<td valign="top" align="left">F<sup>&#x2013;</sup> <italic>mcrB mrr hsdS20 (r<sub>B</sub><sup>&#x2013;</sup> m<sub><italic>B</italic></sub><sup>&#x2013;</sup>) recA13leuB6 ara-14 proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20</italic> (Sm<sup><italic>R</italic></sup>) <italic>lnV44</italic> &#x03BB;<sup>&#x2013;</sup></td>
<td valign="top" align="center">Lab collection</td>
</tr>
<tr>
<td valign="top" align="left">HB101R2</td>
<td valign="top" align="left">Donor strain carrying pRL623 (encoding methylase) and pRL443 (conjugal plasmid)</td>
<td valign="top" align="center"><xref ref-type="bibr" rid="B13">Elhai et al., 1997</xref></td>
</tr>
<tr>
<td valign="top" align="left">SHuffle T7 Express lysY</td>
<td valign="top" align="left">MiniF lysY (CamR)/fhuA2 lacZ:T7 gene1 [lon] ompT ahpC gal &#x03BB;att:pNEB3-r1-cDsbC (SpecR, lacIq) &#x0394;trxB sulA11<break/>R(mcr-73:miniTn10&#x2013;TetS)2 [dcm] R(zgb-210:Tn10 &#x2013;TetS) endA1 &#x0394;gor &#x0394;n114:IS10</td>
<td valign="top" align="center">NEB</td>
</tr>
<tr>
<td valign="top" align="left"><bold><italic>Anabaena</italic> strain</bold></td>
<td valign="top" align="left"/><td valign="top" align="left"/></tr>
<tr>
<td valign="top" align="left"><italic>Anabaena</italic> PCC 7120</td>
<td valign="top" align="left">Wild-type strain</td>
<td valign="top" align="center">Lab collection</td>
</tr>
<tr>
<td valign="top" align="left">An<italic>psbA</italic><sup>+</sup></td>
<td valign="top" align="left"><italic>Anabaena</italic> 7120 harboring light inducible promoter <italic>psbA</italic> from PFPN, Nm<sup>R</sup></td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">An<italic>azuR</italic><sup>+</sup></td>
<td valign="top" align="left"><italic>Anabaena</italic> 7120 harboring pAM<italic>azuR</italic>, Nm<sup>R</sup></td>
<td valign="top" align="center">This study</td>
</tr>
<tr>
<td valign="top" align="left">An<italic>nmtA</italic><sup>+</sup></td>
<td valign="top" align="left"><italic>Anabaena</italic> 7120 harboring pAM<italic>nmtA</italic>, Nm<sup>R</sup></td>
<td valign="top" align="center">This study</td>
</tr>
</tbody>
</table></table-wrap>
</sec>
<sec id="S2.SS2">
<title>Bioinformatic Analysis</title>
<p>Alignment of DNA and protein sequences was determined using ClustalW (<xref ref-type="bibr" rid="B37">Thompson et al., 1994</xref>) and Clustal Omega (<xref ref-type="bibr" rid="B25">Madeira et al., 2019</xref>), respectively. Jalview was used to visualize and edit aligned protein sequences (<xref ref-type="bibr" rid="B46">Waterhouse et al., 2009</xref>). A phylogenetic tree was constructed using MEGA version X (<xref ref-type="bibr" rid="B21">Kumar et al., 2018</xref>) by the maximum likelihood method. The I-TASSER software was used to predict the tertiary structure of AzuR and metal-binding residues (<xref ref-type="bibr" rid="B50">Zhang, 2008</xref>; <xref ref-type="bibr" rid="B33">Roy et al., 2010</xref>; <xref ref-type="bibr" rid="B48">Yang et al., 2015</xref>). Pattern search analysis of conserved sequences was carried out using the online tool Pattern Locator (<xref ref-type="bibr" rid="B26">Mr&#x00E1;zek and Xie, 2006</xref>). The &#x2212;10 and &#x2212;35 boxes of the upstream region of <italic>nmtA</italic> were predicted from BPROM (<xref ref-type="bibr" rid="B35">Salamov and Solovyevand, 2011</xref>).</p>
</sec>
<sec id="S2.SS3">
<title>Cloning, Expression, and Purification of AzuR</title>
<p>The <italic>azuR</italic> ORF (363 bp) was PCR amplified from <italic>Anabaena</italic> 7120 genomic DNA and cloned into pTwin1 vector at <italic>Nde</italic>I&#x2013;<italic>Sap</italic>I sites. The resulting construct pTwin<italic>azuR</italic> was confirmed by sequencing and transformed into an <italic>E. coli</italic> SHuffle strain. Overexpression of chitin-binding domain (CBD)-tagged AzuR was induced by the addition of 0.5 mM IPTG. The protein purification was carried out by chitin affinity chromatography as per the manufacturer&#x2019;s protocol (New England Biolabs). The protein was cleaved from its tag and eluted following incubation with 40 mM DTT at 4&#x00B0;C for 3 days. CBD was also eluted as the contaminating protein. This eluate was loaded onto the fresh chitin resin after DTT removal. The flow-through was collected, which contained purified <italic>Anabaena</italic> AzuR without CBD. The purified protein band following electrophoresis on 15% SDS-PAGE was excised and processed for LC-MS/MS analysis (Q Exactive Plus BioPharma High-Resolution Orbitrap MS system, Thermo Fischer Scientific) at the Sophisticated Analytical Instrument Facility (SAIF), IIT Bombay, India. Spectrum was acquired in positive ion mode in a mass range from 350 to 2,000 m/z. The resultant spectrum was used for peptide identification using the <italic>Anabaena</italic> 7120 protein database available at UniProt.</p>
</sec>
<sec id="S2.SS4">
<title>Structural Characterization of AzuR</title>
<p>Determination of the oligomeric status of AzuR was done by glutaraldehyde cross-linking of protein in the native state. Purified AzuR was incubated with 10 mM glutaraldehyde at room temperature (RT) for 10&#x2013;15 min in 10 mM Tris, pH 7.5. To this, a cracking buffer without or with DTT (50 mM) was added. The resulting cross-linked protein was analyzed by 15% SDS-PAGE. The native molecular mass of AzuR was determined by size-exclusion chromatography (AKTA FPLC system, GE Healthcare) using the GE Superdex 75 column equilibrated with 20 mM Tris, 100 mM NaCl, pH 7.5 at 25&#x00B0;C at a flow rate of 0.5 ml min<sup>&#x2013;1</sup>. The column was previously calibrated using a set of gel filtration markers [bovine serum albumin (66 kDa), ovalbumin (44 kDa), carbonic anhydrase (44.3 kDa), and cytochrome c (29 kDa)] (GE Healthcare).</p>
<p>Analysis of the secondary structure of AzuR was performed by circular dichroism (CD) spectroscopy (MOS-500 Biologic CD spectrometer equipped with a Peltier-type thermostatic cell holder) at 25&#x00B0;C. The CD spectrum was recorded in the wavelength range of 200&#x2013;260 nm using a cuvette with a path length cell of 0.1 mm. The samples were prepared in 10 mM Tris buffer, pH 7.5. The alpha helical content was calculated using the online tool K2D2 (<xref ref-type="bibr" rid="B30">Perez-Iratxeta and Andrade-Navarro, 2008</xref>). CD spectra were also recorded for titrations of AzuR with increasing concentrations of zinc (molar equivalents ranging from 1 to 10).</p>
</sec>
<sec id="S2.SS5">
<title>Rapid Amplification of cDNA Ends</title>
<p>Total RNA was isolated from <italic>Anabaena</italic> 7120 treated with 10 &#x03BC;M cadmium for 1 h as described earlier (<xref ref-type="bibr" rid="B12">Divya et al., 2018</xref>). cDNA was synthesized with 0.5 &#x03BC;g of total RNA using ReadyScript cDNA Synthesis Mix (Sigma-Aldrich). Following dA tailing of cDNA by terminal transferase (Roche), PCR was performed with the oligo(dT)-anchor primer and <italic>nmtA</italic> primer as listed in <xref ref-type="table" rid="T1">Table 1</xref>. The PCR product was then sequenced.</p>
</sec>
<sec id="S2.SS6">
<title>Electrophoretic Mobility Shift Assay</title>
<p>The putative promoter region (100 bp DNA sequence upstream of <italic>nmtA</italic> ORF) was PCR amplified (primers listed in <xref ref-type="table" rid="T1">Table 1</xref>) and end-labeled with DIG-ddUTP as per manufacturer&#x2019;s instructions (Roche). Two nanograms of a DIG-labeled probe (P<italic><sub><italic>nmtA</italic></sub></italic>) was incubated with various concentrations of AzuR protein in a total reaction volume of 20 &#x03BC;l containing 20 mM Tris&#x2013;Cl (pH 7.5) and 1 mM EDTA at RT for 30 min. The DNA&#x2013;protein complexes were resolved on 10% native PAGE in 0.5&#x00D7; TBE. Separated complexes were electroblotted onto a nylon membrane, cross-linked with UV, and stored at 4&#x00B0;C. It was probed with an anti-DIG antibody and developed using a colorimetric substrate, NBT-BCIP, according to the manufacturer&#x2019;s protocol (DIG High Prime DNA Labeling and Detection Starter Kit I, Roche). The bands were quantified by the ImageJ software, and the data were fitted to Hill&#x2019;s equation. Each experiment was repeated three times. In order to evaluate the specificity of interaction of the DNA-AzuR protein binding, electrophoretic mobility shift assay (EMSA) was performed with 100 ng of AzuR (360 nM) with either 20 ng of P<italic><sub><italic>nmtA</italic></sub></italic> or 20 ng of non-specific DNA (<italic>nmtA</italic> gene). For protein specificity, 20 ng of P<italic><sub><italic>nmtA</italic></sub></italic> with non-specific proteins like AnLexA, BSA, or NmtA, each at 360 nM concentration, was taken for EMSA. The DNA&#x2013;protein complexes were resolved on 10% native PAGE and visualized by ethidium bromide staining. To evaluate whether different divalent metal ions affect the binding of AzuR to the target 100 bp DNA, EMSAs were carried out in the presence of 100 &#x03BC;M of various metals. The metal salts used in the study were ZnSO<sub>4</sub>.7H<sub>2</sub>O, CdCl<sub>2</sub>.1/2H<sub>2</sub>O, CuSO<sub>4</sub>.5H<sub>2</sub>O, Co(NO<sub>3</sub>)<sub>2</sub>.6H<sub>2</sub>O, NiSO<sub>4</sub>.7H<sub>2</sub>O, MnCl<sub>2</sub>.4H<sub>2</sub>O, and Pb(NO<sub>3</sub>)<sub>2</sub>. EMSAs were also carried out in the presence of 1 mM DTT (<xref ref-type="bibr" rid="B14">Erbe et al., 1995</xref>) for reactions containing all the aforesaid metals.</p>
</sec>
<sec id="S2.SS7">
<title>Overexpression of AzuR in <italic>Anabaena</italic> 7120</title>
<p>Overexpression of <italic>azuR</italic> gene in its native strain was achieved by triparental conjugation (<xref ref-type="bibr" rid="B12">Divya et al., 2018</xref>). The <italic>azuR</italic> gene was cloned downstream to the light-inducible <italic>psbA</italic>1 promoter in the pFPN vector at <italic>Nde</italic>I and <italic>Bam</italic>HI sites. A <italic>Sal</italic>I&#x2013;<italic>Xma</italic>I fragment from pFPN<italic>azuR</italic> was excised and cloned into the <italic>E. coli</italic>/<italic>Anabaena</italic> shuttle vector pAM1956 upstream of the promoterless <italic>gfpmut2</italic> gene. pAM<italic>azuR</italic> was then transferred into <italic>Anabaena</italic> 7120. The recombinant <italic>Anabaena</italic> strain was designated as An<italic>azuR</italic><sup>+</sup>. In a similar way, An<italic>nmtA</italic><sup>+</sup> (<italic>Anabaena</italic> strain overexpressing NmtA) was also generated. An<italic>psbA</italic><sup>+</sup> (<italic>Anabaena</italic> harboring pAM1956 with constitutive expression of GFP) was generated by excising the P<sub><italic>psbA</italic>1</sub> fragment from the pFPN vector and cloning it into the vector pAM1956 upstream of the promoterless <italic>gfpmut2</italic> gene and transferred conjugally into <italic>Anabaena</italic> 7120. The recombinant <italic>Anabaena</italic> strains were repeatedly subcultured and maintained under the selective pressure of neomycin (Nm<sup>15</sup>). Visualization of GFP fluorescence in the recombinant cells confirmed the expression of the <italic>azuR</italic> gene placed upstream of the <italic>gfpmut2</italic> gene.</p>
</sec>
<sec id="S2.SS8">
<title>Transcript Analysis by RT-PCR</title>
<p>For RT-PCR, 1 &#x03BC;g RNA was used for cDNA synthesis (ReadyScript cDNA Synthesis Mix, Sigma-Aldrich). RT-PCR was carried out with <italic>azuR</italic>-specific primers (<xref ref-type="table" rid="T1">Table 1</xref>) with 16S rRNA serving as the internal control. RT-PCR products were resolved by electrophoresis on 1% agarose gel and detected by staining with ethidium bromide. For quantification of <italic>nmtA</italic> transcripts, real-time PCR was performed with <italic>nmtA</italic>-specific primers in Qiagen rotor-Gene Q real-time PCR cycler. 16S rRNA was used as the internal control.</p>
</sec>
<sec id="S2.SS9">
<title>Cadmium Exposure Studies</title>
<p>Exponential phase cultures (3-day-old cultures) of An<italic>psbA</italic><sup>+</sup>, An<italic>nmtA</italic><sup>+</sup>, and An<italic>azuR</italic><sup>+</sup> were inoculated in BG-11 N<sup>+</sup> (Nm<sup>15</sup>) liquid medium at a chlorophyll <italic>a</italic> (Chl<italic>a</italic>) density of &#x223C;4 &#x03BC;g ml<sup>&#x2013;1</sup> and incubated for 10 days under illumination without or with cadmium at 10 and 20 &#x03BC;M concentrations. Growth was assessed by measuring Chl<italic>a</italic> content at regular intervals. For spot assays, exponentially growing cultures of An<italic>psbA</italic><sup>+</sup>, An<italic>nmtA</italic><sup>+</sup>, and An<italic>azuR</italic><sup>+</sup> were spotted onto BG-11 N<sup>+</sup> (Nm<sup>25</sup>) agar plates without or with cadmium (10, 20, and 40 &#x03BC;M) at the chlorophyll density mentioned in the figure and incubated under continuous illumination for 7 days.</p>
</sec>
<sec id="S2.SS10">
<title>Microscopy of <italic>Anabaena</italic> Strains</title>
<p>Bright-light and fluorescence microscopy (FM) images were taken at &#x00D7;600/&#x00D7;1,500 magnification on a Carl Zeiss Axioscope 40 microscope with a charge coupled device (CCD) AxioCam MRc camera (Zeiss). Green fluorescence of GFP was visualized using a Hg-arc lamp (excitation BP: 450&#x2013;490 nm, emission LP: 515 nm). Chl<italic>a</italic> fluorescence of <italic>Anabaena</italic> was visualized with green light excitation (excitation BP: 546/12, emission LP: 590 nm). It should be noted here that the microscopic settings for GFP fluorescence used the emission filter (&#x03BB;<sub>emission</sub>: 515 nm) that could detect both GFP and Chl<italic>a</italic> fluorescence. For scanning electron microscopy (SEM), exponential-phase cells of WT, An<italic>psbA</italic><sup>+</sup>, An<italic>nmtA</italic><sup>+</sup>, and An<italic>azuR</italic><sup>+</sup> were harvested by centrifugation, and the resulting cell pellets were washed with 0.9% NaCl and fixed with 2.5% glutaraldehyde at 4&#x00B0;C for 1&#x2013;2 h. Post fixation, the cells were serially dehydrated in 20, 30, 50, 70, 90, and 100% ethanol. The dehydrated sample was then gold coated with a sputtering device (Q 150R ES, Quorum) and visualized using SEM (EVO 18 Research, Carl Zeiss, United Kingdom).</p>
</sec>
<sec id="S2.SS11">
<title>Statistical Analysis</title>
<p>Growth experiments were repeated three times. Average values with standard deviations are shown for a representative experiment. For determination of cell size, data are represented as average values &#x00B1; standard deviation. One-way ANOVA was employed for calculating the significance of the difference in cell size between WT, An<italic>psbA</italic><sup>+</sup>, An<italic>nmtA</italic><sup>+</sup>, and An<italic>azuR</italic><sup>+</sup> cultures.</p>
</sec>
</sec>
<sec id="S3" sec-type="results|discussion">
<title>Results and Discussion</title>
<sec id="S3.SS1">
<title>Sequence Analysis and Genomic Context of AzuR (Alr0831)</title>
<p>The genome of <italic>Anabaena</italic> PCC 7120 harbors two proteins belonging to the ArsR-SmtB family of proteins, All7621 and Alr0831. The ArsR-SmtB family of transcriptional metalloregulators represses the expression of genes/operons involved in maintaining metal homeostasis or toxic metal detoxification (<xref ref-type="bibr" rid="B28">Osman and Cavet, 2010</xref>). Among the 15 characterized metal binding motifs (<xref ref-type="bibr" rid="B34">Saha et al., 2017</xref>), the metal-sensing members of the regulators include two structurally diverse metal-binding sites, namely, &#x03B1;3N, and &#x03B1;5 (<xref ref-type="bibr" rid="B9">Busenlehner et al., 2003</xref>). All7621 in <italic>Anabaena</italic> 7120 encodes for AztR, a regulator of AztA [Zn(II)/Pb(II) CPx-ATPase efflux pump] (<xref ref-type="bibr" rid="B23">Liu et al., 2005</xref>), and belongs to the &#x03B1;3N group of proteins. The &#x03B1;3N site consists of cysteine thiolate ligands&#x2014;two from the &#x03B1;3 helix with signature motifs Cx<sub>1&#x2013;2</sub>C or Cx<sub>2</sub>CD and one or two cysteine ligands derived from the amino-terminus (<xref ref-type="bibr" rid="B34">Saha et al., 2017</xref>). The sequence analysis of the yet-uncharacterized Alr0831 (AzuR) revealed the absence of a functional &#x03B1;3N site in AzuR as it contained only one cysteine residue each in the &#x03B1;3 helix and at the amino-terminus (<xref ref-type="fig" rid="F1">Figure 1A</xref>). Protein sequence alignment of AzuR with the <italic>Synechococcus</italic> transcriptional repressor SmtB showed 60% sequence identity, and the key amino acids in the &#x03B1;5 site important for metal sensing, i.e., His, Glu, and Asp in SmtB (<xref ref-type="bibr" rid="B44">VanZile et al., 2000</xref>, <xref ref-type="bibr" rid="B43">2002</xref>), were found to be conserved in AzuR (<xref ref-type="fig" rid="F1">Figure 1A</xref>). It is likely that the function of AzuR is similar to that of SmtB owing to the high degree of sequence identity. Tertiary structure prediction of AzuR using the software I-TASSER showed the presence of all the secondary structural folds (&#x03B1;1&#x2013;&#x03B1;5, &#x03B2;1, and &#x03B2;2) similar to that of SmtB (<xref ref-type="fig" rid="F1">Figure 1B</xref>, i). Structural modeling predicted zinc-binding residues Asp102 and His104 (<xref ref-type="fig" rid="F1">Figure 1B</xref>, ii) of AzuR comparable to that of <italic>Staphylococcus aureus</italic> CadC as well as His115 and Glu118 (<xref ref-type="fig" rid="F1">Figure 1B</xref>, iii) similar to that of <italic>Synechococcus</italic> SmtB. Hence, AzuR could possibly be grouped into &#x03B1;5 SmtB/ArsR metalloregulators with the signature motif DxHx<sub>10</sub>Hx<sub>2</sub>E present in the &#x03B1;5 helix (<xref ref-type="fig" rid="F1">Figure 1A</xref>). Phylogenetic analysis of representative sequences from SmtB/ArsR family members showed that AzuR shared maximum identity to BxmR (67%), which contain both &#x03B1;3N and &#x03B1;5 sites (<xref ref-type="fig" rid="F1">Figure 1C</xref>). It also showed that SmtB (&#x03B1;5) and proteins belonging to different groups&#x2014;ZiaR (&#x03B1;3N, &#x03B1;5), AztR (&#x03B1;3N), BxmR (&#x03B1;3N, &#x03B1;5), and AzuR (&#x03B1;5)&#x2014;evolved independently but were linked to a common ancestor (<xref ref-type="fig" rid="F1">Figure 1C</xref>).</p>
<p>Several metal-responsive proteins and their repressors of SmtB/ArsR family members have been shown to exist as operons. For example, BmtA (MT of <italic>Oscillatoria brevis</italic>) and its repressor BxmR (<xref ref-type="bibr" rid="B24">Liu et al., 2004</xref>), ZiaA (Zn efflux protein of <italic>Synechocystis</italic> PCC 6803) and its repressor ZiaR (<xref ref-type="bibr" rid="B36">Thelwell et al., 1998</xref>), and AztA (Zn<sup>2+</sup>-translocating CPx-ATPase) and its repressor AztR (<xref ref-type="bibr" rid="B23">Liu et al., 2005</xref>) are organized in operons. In <italic>Synechococcus</italic> PCC 7942, the <italic>smtB</italic> gene and <italic>smtA</italic> gene are separated by 100 bp, forming a divergon (<xref ref-type="bibr" rid="B19">Huckle et al., 1993</xref>). However, there is a deviation in the genetic organization of <italic>Anabaena</italic> MT, which is not organized in an operon. The <italic>nmtA</italic> ORF (located between positions 3938083 and 3937925) is present within a larger ORF of an unknown protein, asr3266, but in the opposite orientation (<xref ref-type="bibr" rid="B7">Bose et al., 2006</xref>). Similarly, the putative regulator <italic>azuR</italic> is not placed adjacent to the <italic>nmtA</italic> locus but is present within the ZnuABC operon (<xref ref-type="fig" rid="F1">Figure 1D</xref>). Alr0831 is positioned at 956795&#x2192;957157 between alr0830 (ZnuC, ABC transporter permease protein) and alr0832 (ZnuA, ABC transporter ATP binding protein) in the opposite orientation. Similar to AzuR, the SmtB ortholog has been identified within an operon with an ABC-type transporter system in other cyanobacteria like <italic>Nodularia</italic> and <italic>Anabaena variabilis</italic> (<xref ref-type="bibr" rid="B4">Blindauer, 2008</xref>). Analysis of the genomic organization of other prokaryotic MTs like <italic>Pseudomonas</italic> MT also revealed an absence of regulatory protein adjacent to the <italic>Pseudomonas fluorescens</italic> Q2-87 MT locus. Also, the genes adjacent to the <italic>Pseudomonas</italic> MT gene code for proteins of unknown function (<xref ref-type="bibr" rid="B17">Habjani&#x010D; et al., 2020</xref>). Genomic arrangement of MT and its regulator as operons apparently is not mandatory as such regulators function as <italic>trans</italic>-acting factors on <italic>cis-</italic>regulatory elements.</p>
</sec>
<sec id="S3.SS2">
<title>Overexpression, Purification, and Structural Characterization of AzuR</title>
<p>To characterize the regulatory role of AzuR, the corresponding gene (<italic>alr0831</italic>) was cloned in the pTwin1 vector. The resulting construct pTwin<italic>azuR</italic> was expressed in the <italic>E. coli</italic> SHuffle strain. Induction with IPTG expressed a &#x223C;42 kDa protein corresponding to CBD-tagged AzuR (<xref ref-type="fig" rid="F2">Figure 2A</xref>). The cloning at <italic>Nde</italic>I&#x2013;<italic>Sap</italic>I sites ensured that no extra amino acids were incorporated in the purified protein following removal of the tag. AzuR was purified by chitin affinity chromatography, and the removal of the CBD tag was achieved by thiol-induced cleavage with 40 mM DTT at 4&#x00B0;C. The purified AzuR was visualized on SDS-PAGE as a monomer under reducing conditions with a molecular weight of &#x223C;13.9 kDa (<xref ref-type="fig" rid="F2">Figure 2B</xref>), which was further confirmed with LC-MS/MS analysis. The MS analysis identified six unique peptides, showing 77% coverage of the <italic>Anabaena</italic> AzuR protein sequence.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption><p>Overexpression and purification of AzuR. <bold>(A)</bold> Overexpression of AzuR. Whole-cell protein extracts (30 &#x03BC;g) of uninduced (UI) and induced (I) with 0.5 mM IPTG from <italic>E. coli</italic> SHuffle (pTwin<italic>azuR</italic>) cells were resolved on 15% SDS-PAGE, followed by visualization with Coomassie Brilliant Blue (CBB) staining. The lane marked as M is the protein molecular weight marker (NEB P7712). <bold>(B)</bold> Purification of AzuR (Alr0831). AzuR was purified by chitin affinity chromatography followed by thiol-mediated removal of the CBD tag. The purified AzuR protein corresponding to the monomer under reducing conditions on 15% SDS-PAGE is indicated by the arrow. The molecular mass in kDa is indicated on the left-hand side. The lane marked as M is the protein molecular weight marker (NEB P7712). <bold>(C)</bold> Cross-linking of AzuR with glutaraldehyde. The purified AzuR (5 &#x03BC;g) was cross-linked with glutaraldehyde (Glh) without or with the addition of DTT (50 mM) in the Laemmli buffer. The proteins were separated on 15% SDS-PAGE followed by staining with Coomassie Brilliant Blue. <bold>(D)</bold> Size-exclusion chromatography profile of the purified AzuR protein using Superdex 75. The calibration curve of standard proteins is shown in the inset. The calibration equation, <italic>y</italic> = &#x2013;0.195x + 7.0463 (<italic>R</italic><sup>2</sup> = 0.992), was used for the molecular weight calculation of AzuR. <bold>(E)</bold> CD spectrum of purified AzuR showing 67.5% &#x03B1; helical content. Gray circles represent elution volume corresponding to different fractions and blue circles represent the standard molecular weight markers used.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-12-782363-g002.tif"/>
</fig>
<p>The SmtB/ArsR family of proteins binds to the regulatory DNA sequences as homodimers (<xref ref-type="bibr" rid="B28">Osman and Cavet, 2010</xref>). To ascertain the native form of AzuR, the oligomeric status of AzuR was evaluated by glutaraldehyde cross-linking. The protein was predominantly found to be present in the dimeric state as observed by glutaraldehyde cross-linking (<xref ref-type="fig" rid="F2">Figure 2C</xref>). The dimeric state was also confirmed with size-exclusion chromatography (<xref ref-type="fig" rid="F2">Figure 2D</xref>). This is in agreement with the previously characterized SmtB/ArsR family of prokaryotic metalloregulatory transcriptional repressors that existed as stable dimers in solution (<xref ref-type="bibr" rid="B8">Busenlehner et al., 2001</xref>; <xref ref-type="bibr" rid="B23">Liu et al., 2005</xref>, <xref ref-type="bibr" rid="B22">2008</xref>). It was observed that AzuR existed as a monomer under reducing conditions and dimer under non-reducing conditions (<xref ref-type="fig" rid="F2">Figure 2C</xref>). These observations suggested the involvement of cysteine residues in AzuR dimerization. Secondary structure analysis by CD showed that AzuR is composed of 67.5% &#x03B1; helical content (<xref ref-type="fig" rid="F2">Figure 2E</xref>), suggesting that the purified recombinant AzuR protein was properly folded. This is in agreement with the theoretical secondary structure prediction of AzuR using the SOPMA software, which projected 67% &#x03B1; helical content followed by 17% random coil and 11% extended strand.</p>
</sec>
<sec id="S3.SS3">
<title>Mapping and Characterization of AzuR-DNA Binding Sequence</title>
<p>The SmtB/ArsR family of transcriptional regulators binds to 12&#x2013;2&#x2013;12 inverted repeats present upstream or within the genes that they regulate (<xref ref-type="bibr" rid="B14">Erbe et al., 1995</xref>; <xref ref-type="bibr" rid="B41">Turner et al., 1996</xref>). RACE analysis with total RNA isolated from the cadmium-treated (IC<sub>50</sub> 10 &#x03BC;M) <italic>Anabaena</italic> 7120 showed an &#x223C;200 bp cDNA product (<xref ref-type="fig" rid="F3">Figure 3A</xref>). Sequence analysis of the product identified the transcriptional start site (TSS) to be at 23 nt upstream of the translational start of the <italic>nmtA</italic> ORF (<xref ref-type="fig" rid="F3">Figure 3B</xref>). The palindromic sequence (12&#x2013;2&#x2013;12 imperfect inverted repeat), corresponding to the consensus of the &#x03B1;3N and &#x03B1;5 groups of SmtB/ArsR-binding sites (<xref ref-type="bibr" rid="B34">Saha et al., 2017</xref>), was found to be located 36 nt upstream of the <italic>nmtA</italic> translation start site (<xref ref-type="fig" rid="F3">Figure 3B</xref>). Its position overlaps with the theoretical prediction of the &#x2212;35 element of the promoter. It is shown that the <italic>cis</italic>-regulatory element of metal-inducible operons is composed of one or two inverted 12&#x2013;2&#x2013;12 repeats present in the vicinity or overlapping the transcriptional start site of the gene under regulation. For example, one of the two such inverted 12&#x2013;2&#x2013;12 repeats found in <italic>Synechococcus</italic> 7942 was essential for the regulation of <italic>smtA</italic> expression by its repressor, SmtB (<xref ref-type="bibr" rid="B41">Turner et al., 1996</xref>). Similarly, the <italic>Synechocystis zia</italic> O/P region has a single 12&#x2013;2&#x2013;12 inverted repeat between the &#x2212;10 box and the translational start site of <italic>ziaA</italic>, which is regulated by a divergently transcribed repressor, <italic>ziaR</italic> (<xref ref-type="bibr" rid="B36">Thelwell et al., 1998</xref>). Pattern search analysis was performed with the conserved bases in the 12&#x2013;2&#x2013;12 imperfect repeat along the entire <italic>Anabaena</italic> 7120 genome. Similar repeats were found at sites upstream and within other genes that include <italic>all1178</italic>, which codes for a two-component hybrid sensor and regulator, <italic>alr7622</italic> (also designated as <italic>aztA</italic>), encoding for cation-transporting ATPase and other hypothetical proteins (<xref ref-type="table" rid="T2">Table 2</xref>). The conserved 12&#x2013;2&#x2013;12 inverted repeat of SmtB/ArsR-regulated O/Ps are shown in <xref ref-type="fig" rid="F3">Figure 3C</xref>. Although <italic>nmtA</italic> and its putative regulator <italic>azuR</italic> do not constitute an operon in <italic>Anabaena</italic> 7120, the inverted 12&#x2013;2&#x2013;12 imperfect repeat could be located at the appropriate upstream distance from the <italic>nmtA</italic> translation start site. Although the <italic>azuR</italic> ORF is present within the <italic>znuABC</italic> operon, a detailed search for conserved bases in the 12&#x2013;2&#x2013;12 imperfect repeat following global search analysis by PATLOC in the close vicinity of the <italic>znuABC</italic> operon (corresponding to the 500 bp upstream region to 500 bp downstream of the operon) and within the operon did not show any such repeat sequence in the entire analyzed region. The regulation of the <italic>znuABC</italic> operon by the <italic>zur</italic> (<italic>all2473</italic>)/<italic>furB</italic> regulator has been demonstrated previously in <italic>Anabaena</italic> 7120 (<xref ref-type="bibr" rid="B27">Napolitano et al., 2012</xref>). Zur (zinc uptake regulator), known to be the master regulator for zinc homeostasis in <italic>Anabaena</italic> 7120, regulated the expression of genes involved in zinc homeostasis like <italic>alr0830</italic> (ZnuC), <italic>alr0833</italic> (ZnuA), and <italic>all7621</italic> (AztR). On analysis, we did not find <italic>zur</italic>-binding sequences upstream of the <italic>azuR</italic> ORF, indicating that the global regulator of zinc homeostasis, Zur, did not regulate <italic>azuR</italic> expression.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption><p>Mapping of transcriptional start site and inverted repeats. <bold>(A)</bold> Mapping of transcriptional start site by RACE was performed with RNA isolated from <italic>Anabaena</italic> cells treated with cadmium. The RACE product is indicated by an arrow. M, 100 bp DNA ladder (NEB). <bold>(B)</bold> Sequence analysis of the <italic>nmtA</italic> ORF and upstream region. The inverted repeat sequence is highlighted in green; the red A is the transcriptional start site (TSS); the sequences highlighted in pink and blue represent the &#x2013;10-like box and &#x2013;35 box, respectively; and the start codon ATG is highlighted in brown. <bold>(C)</bold> Sequence alignment of inverted repeat present upstream of the <italic>nmtA</italic> ORF with other characterized repeats essential for repressor binding by ClustalW. An asterisk (<sup>&#x2217;</sup>) indicates the conserved bases across all sequences.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-12-782363-g003.tif"/>
</fig>
<table-wrap position="float" id="T2">
<label>TABLE 2</label>
<caption><p><italic>Anabaena</italic> genes possessing conserved sequences in the 12&#x2013;2&#x2013;12 inverted repeat identified by PATLOC.</p></caption>
<table cellspacing="5" cellpadding="5" frame="hsides" rules="groups">
<thead>
<tr>
<td valign="top" align="left">S. No.</td>
<td valign="top" align="left">Inverted repeat</td>
<td valign="top" align="left">Position</td>
<td valign="top" align="left">Gene and distance</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left"><bold>Chromosome</bold></td>
</tr>
<tr>
<td valign="top" align="left">1. <xref ref-type="table-fn" rid="t2fns1">&#x002A;</xref></td>
<td valign="top" align="left">AATACTTGAGTA-AT-TTATCAAGTTCT</td>
<td valign="top" align="left">1386159&#x2013;1386184</td>
<td valign="top" align="left"><italic>all1178</italic> (two-component hybrid sensor and regulator) (&#x003C;-); 314&#x2013;2429</td>
</tr>
<tr>
<td valign="top" align="left">2.</td>
<td valign="top" align="left">AATACCTGAACA-GA-TGTTCAAGTATT</td>
<td valign="top" align="left">3938119&#x2013;3938144</td>
<td valign="top" align="left"><italic>asr3266</italic> (hypothetical protein) (-&#x003E;); 10<break/> <italic>all3267</italic> (hypothetical protein) (&#x003C;-); 56</td>
</tr>
<tr>
<td valign="top" align="left">3. <xref ref-type="table-fn" rid="t2fns1">&#x002A;</xref></td>
<td valign="top" align="left">CACAATTGATGA-TA-TCTTCACCTGGG</td>
<td valign="top" align="left">4556777&#x2013;4556802</td>
<td valign="top" align="left"><italic>alr3769</italic> (hypothetical protein) (-&#x003E;); 314&#x2013;383</td>
</tr>
<tr>
<td valign="top" align="left">4.</td>
<td valign="top" align="left">TAAATGTGATGA-TA-TCATCACATTTA</td>
<td valign="top" align="left">5585215&#x2013;5585240</td>
<td valign="top" align="left"><italic>alr4684</italic> (hypothetical protein) (-&#x003E;); 291<break/> <italic>alr4685</italic> (hypothetical protein) (-&#x003E;); 849</td>
</tr>
<tr>
<td valign="top" align="left"><bold>Alpha plasmid</bold></td>
</tr>
<tr>
<td valign="top" align="left">5.</td>
<td valign="top" align="left">GAAAACTGAGTA-AT-TTATCAATTGCT</td>
<td valign="top" align="left">40552&#x2013;40577</td>
<td valign="top" align="left"><italic>asr7047</italic> (hypothetical protein) (-&#x003E;); &#x2212;12<break/> <italic>alr7048</italic> (hypothetical protein) (-&#x003E;); 66</td>
</tr>
<tr>
<td valign="top" align="left"><bold>Beta plasmid</bold></td>
</tr>
<tr>
<td valign="top" align="left">6.<xref ref-type="table-fn" rid="t2fns1">&#x002A;</xref></td>
<td valign="top" align="left">TACAATTGAATA-GT-TGTTCAATTGTT</td>
<td valign="top" align="left">114477&#x2013;114502</td>
<td valign="top" align="left"><italic>alr7622</italic> (cation-transporting ATPase) (-&#x003E;); 13&#x2013;2601</td>
</tr>
<tr>
<td valign="top" align="left">7.<xref ref-type="table-fn" rid="t2fns1">&#x002A;</xref></td>
<td valign="top" align="left">GAAATTTGAAAA-CT-TCCTCACCTCAA</td>
<td valign="top" align="left">153412&#x2013;153437</td>
<td valign="top" align="left"><italic>alr7649</italic> (hypothetical protein) (-&#x003E;); 5492&#x2013;2228</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="t2fns1"><p><italic>&#x002A;Denotes repeat sequence present within the gene.</italic></p></fn>
<fn><p><italic>Arrows represent transcription direction.</italic></p></fn>
</table-wrap-foot>
</table-wrap>
<p><italic>Anabaena</italic> 7120 AztA is transcriptionally regulated by AztR (belonging to the SmtB/ArsR family) by recognizing and binding to the inverted 12&#x2013;2&#x2013;12 imperfect repeat region. EMSA studies done with AztR and the <italic>nmtA/bmtA</italic> upstream region showed its binding <italic>in vitro</italic> (<xref ref-type="bibr" rid="B40">Tottey et al., 2007</xref>). Similar inverted repeat sequences identified by AztR and AzuR indicate that AztR and AzuR might be sharing the function of regulating AztA and NmtA. As described above, AztR belongs to the &#x03B1;3N group and AzuR to the &#x03B1;5 group of the SmtB/ArsR family. The &#x03B1;5 group members sense physiologically important metals like Zn<sup>2+</sup>, Cu<sup>2+</sup>, Co<sup>2+</sup>, and Ni<sup>2+</sup>, while the &#x03B1;3N group prefers larger, more thiophilic metal ions like Cd<sup>2+</sup> or Pb<sup>2+</sup> (<xref ref-type="bibr" rid="B9">Busenlehner et al., 2003</xref>). It is possible that AzuR and AztR preferred different groups of metal ions but could regulate both MT and efflux proteins, thus enabling the cell to respond to a wide range of metal ions.</p>
</sec>
<sec id="S3.SS4">
<title>AzuR Binds to the Upstream Sequence of <italic>nmtA</italic> Open Reading Frame</title>
<p>Electrophoretic mobility shift assays (EMSAs) were done in order to identify the AzuR-DNA binding site using a 100 bp fragment (P<italic><sub><italic>nmtA</italic></sub></italic>) upstream of the <italic>nmtA</italic> gene (probe) containing the 12&#x2013;2&#x2013;12 inverted repeat sequence. The results showed that AzuR could bind and form complexes with P<italic><sub><italic>nmtA</italic></sub></italic> in a concentration-dependent manner (<xref ref-type="fig" rid="F4">Figure 4A</xref>). The Hill coefficient of AzuR binding to DNA was calculated to be 2.48 &#x00B1; 1.14 (&#x003E;1) (<xref ref-type="fig" rid="F4">Figure 4B</xref>), which indicated positive cooperative binding (<xref ref-type="bibr" rid="B18">Hill, 1910</xref>). SmtB has been shown to bind to the <italic>smt</italic> O/P in a multimeric state (<xref ref-type="bibr" rid="B14">Erbe et al., 1995</xref>). The positive cooperative binding suggested that AzuR bound to the target DNA as an oligomer similar to that of SmtB. The specificity of DNA&#x2013;protein binding was confirmed by using the <italic>nmtA</italic> gene or DNA-binding protein LexA from <italic>Anabaena</italic> 7120 (AnLexA) or other proteins like BSA and NmtA. No retardation in the mobility of P<italic><sub><italic>nmtA</italic></sub></italic> was observed in the presence of AnLexA. Also, AzuR could not bind to the <italic>nmtA</italic> gene sequence, confirming that AzuR regulated <italic>nmtA</italic> expression by binding to the upstream sequence and not to its internal region (<xref ref-type="fig" rid="F4">Figure 4C</xref>). Our results established the specific binding of P<italic><sub><italic>nmtA</italic></sub></italic> with the AzuR protein.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption><p>Binding of AzuR to the upstream region of <italic>nmtA</italic>. <bold>(A)</bold> Electrophoretic mobility shift assay (EMSA) of DIG-labeled 100 bp DNA sequence upstream of <italic>nmtA</italic> (2 ng) with purified AzuR. Different concentrations of AzuR protein were incubated with DIG-labeled DNA, and the assay mixtures were resolved on 10% native PAGE in 0.5&#x00D7; TBE. Detection with the DIG-labeled probe was carried out as per manufacturer&#x2019;s protocol (Roche) using NBT-BCIP. Lane 1 contains 2 ng of P<italic><sub><italic>nmtA</italic></sub></italic>. Lanes 2&#x2013;8 contain increasing concentrations of AzuR as indicated. Representative data from three independent experiments are shown. <bold>(B)</bold> Representative plot showing the percentage of bound complex against the concentration of AzuR protein fitted to the Hill equation. <bold>(C)</bold> EMSA for evaluation of non-specific interaction of DNA&#x2013;protein binding. Lane 1: 100 bp DNA ladder. Lane 2: 20 ng of 100 bp P<italic><sub><italic>nmtA</italic></sub></italic> only or with 360 nM (100 ng) AzuR (lane 3) or 360 nM (478 ng) BSA (lane 4) or 360 nM (41 ng) NmtA (lane 5) or 360 nM (158 ng) AnLexA (lane 6). Lane 7 contains 20 ng of the <italic>nmtA</italic> gene only or with 360 nM (100 ng) AzuR (lane 8). The DNA&#x2013;protein complexes were resolved on 10% native PAGE and visualized by ethidium bromide staining. <bold>(D)</bold> The CD spectrum of AzuR was recorded with increasing molar equivalents of zinc, which was an average of three scans. <bold>(E)</bold> EMSA of P<italic><sub><italic>nmtA</italic></sub></italic> with AzuR in the presence of Zn<sup>2+</sup>. Lane 1 contains 2 ng of P<italic><sub><italic>nmtA</italic></sub></italic>. Lanes 2&#x2013;7 contain DNA with 100 ng of AzuR in the presence of increasing concentrations of Zn<sup>2+</sup> as indicated. EMSA of P<sub><italic>nmtA</italic></sub> with AzuR protein with Zn<sup>2+</sup> and Cd<sup>2+</sup> in the absence of DTT <bold>(F)</bold> or in the presence of 1 mM DTT <bold>(G)</bold>. Lane 1 contains 2 ng of probe only. Lanes 2&#x2013;8 contain P<italic><sub><italic>nmtA</italic></sub></italic> with 100 ng of AzuR, lanes 3&#x2013;5 with increasing concentrations of Zn<sup>2+</sup>, and lanes 6&#x2013;8 with increasing concentrations of Cd<sup>2+</sup> as indicated in <bold>(F,G)</bold>. <bold>(H)</bold> EMSA of DNA probe with 70 ng of AzuR with 100 &#x03BC;M of divalent cations as indicated in the figure. All the reactions were performed in the absence of DTT.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-12-782363-g004.tif"/>
</fig>
<p>SmtB senses metal ions through the &#x03B1;5 site. Zinc binding to residues present in this site allosterically regulates the DNA binding activity of SmtB to the <italic>smtA</italic> O/P region (<xref ref-type="bibr" rid="B43">VanZile et al., 2002</xref>) similar to other reported SmtB/ArsR repressors (<xref ref-type="bibr" rid="B9">Busenlehner et al., 2003</xref>). The bound Zn<sup>2+</sup> changes the conformation of the protein, which inhibits the DNA binding. Since AzuR contains a similar &#x03B1;5 site, the conformational changes in AzuR as a result of metal binding was assessed by CD spectra of the protein in the presence of various concentrations of zinc (<xref ref-type="fig" rid="F4">Figure 4D</xref>). The degree of the alpha helical region progressively decreased with increasing concentrations of zinc, indicating the changes in the secondary structure of AzuR in the presence of zinc. To further confirm whether zinc or other metal ions interfered with the AzuR DNA binding ability, EMSA was carried out in the presence of various metal ions. Dissociation of the DNA&#x2013;AzuR complex was clearly evident with increasing concentrations of Zn<sup>2+</sup> (<xref ref-type="fig" rid="F4">Figures 4E,F</xref>). The interaction of Cd<sup>2+</sup> with AzuR also disrupted the binding with P<italic><sub><italic>nmtA</italic></sub></italic> (<xref ref-type="fig" rid="F4">Figure 4F</xref>); however, the disruption was more prominent in the presence of DTT (<xref ref-type="fig" rid="F4">Figure 4G</xref>), emphasizing the requirement of free sulfhydryls for Cd<sup>2+</sup> binding to AzuR <italic>in vitro</italic>. It was interesting to see the reversal of AzuR binding to P<italic><sub><italic>nmtA</italic></sub></italic> in the presence of other divalent metal ions like Cu<sup>2+</sup>, Co<sup>2+</sup>, Ni<sup>2+</sup>, Pb<sup>2+</sup>, and Mn<sup>2+</sup> (<xref ref-type="fig" rid="F4">Figure 4H</xref>), suggesting that AzuR not only senses toxic metal ions like Cd<sup>2+</sup> and Pb<sup>2+</sup> but also is capable of sensing essential metal ions like Zn<sup>2+</sup>, Cu<sup>2+</sup>, Co<sup>2+</sup>, Ni<sup>2+</sup>, and Mn<sup>2+</sup>. EMSAs attempted with metals other than Zn<sup>2+</sup> and Cd<sup>2+</sup> in the presence of DTT showed visible precipitates in the binding reaction and hence were not included here.</p>
<p>We have previously observed the induction of <italic>nmtA</italic> in the presence of Cd<sup>2+</sup>, Zn<sup>2+</sup>, and Cu<sup>2+</sup> (<xref ref-type="bibr" rid="B12">Divya et al., 2018</xref>). AzuR, therefore, can be proposed as a negative regulator of <italic>nmtA</italic> as it binds to regulatory DNA sequence in the absence of the metals and the repression is relieved in the presence of metal ions. In view of our results, it can be suggested that AzuR might have a larger role in the metal resistance system of <italic>Anabaena</italic> 7120.</p>
</sec>
<sec id="S3.SS5">
<title>Overexpression of <italic>Anabaena</italic> AzuR (Alr0831) and the Alterations in the Cell Morphology</title>
<p>Overexpression of transcriptional regulators has been previously studied in <italic>Anabaena</italic> sp. (<xref ref-type="bibr" rid="B47">Wu et al., 2007</xref>). To gain insights into the effect of AzuR on various characteristics or phenotype of <italic>Anabaena</italic> 7120, we constructed a recombinant strain of <italic>Anabaena</italic> 7120 that overexpressed AzuR. The <italic>azuR</italic> gene was cloned and overexpressed constitutively in <italic>Anabaena</italic> 7120 from a strong light-inducible promoter, P<italic><sub><italic>psbA</italic></sub></italic>. GFP fluorescence of the downstream reporter gene was the first indication of successful <italic>azuR</italic> gene expression (<xref ref-type="fig" rid="F5">Figure 5A</xref>). GFP fluorescence was visualized in <italic>Anabaena</italic> harboring an empty vector with P<italic><sub><italic>psbA</italic></sub></italic> upstream of the <italic>gfpmut2</italic> gene, An<italic>psbA</italic><sup>+</sup> and <italic>Anabaena</italic> overexpressing <italic>nmtA</italic>, and An<italic>nmtA</italic><sup>+</sup> (<xref ref-type="fig" rid="F5">Figure 5A</xref>). WT cells did not show any such GFP fluorescence (<xref ref-type="fig" rid="F5">Figure 5A</xref>). The observation of few cells appearing red in the filaments of recombinant cells under FM and blue-light excitation (BLE) conditions could be due to partial or reduced GFP expression (<xref ref-type="fig" rid="F5">Figure 5A</xref>). The filament length in An<italic>azuR</italic><sup>+</sup>, An<italic>psbA</italic><sup>+</sup>, and An<italic>nmtA</italic><sup>+</sup> was comparable to that of WT <italic>Anabaena</italic> cells. The uniformity of the cell stacking in An<italic>azuR</italic><sup>+</sup> filaments appeared to be compromised as compared to those in the filaments of WT, An<italic>psbA</italic><sup>+</sup>, and An<italic>nmtA</italic><sup>+</sup>. However, the Chl<italic>a</italic> fluorescence in An<italic>azuR</italic><sup>+</sup> cells was intact and equivalent to that observed for WT, An<italic>psbA</italic><sup>+</sup>, or An<italic>nmtA</italic><sup>+</sup> cells (<xref ref-type="fig" rid="F5">Figure 5A</xref>). A substantial increase in <italic>azuR</italic> transcript level was seen in RT-PCR performed with RNA isolated from An<italic>azuR</italic><sup>+</sup> as compared to An<italic>psbA</italic><sup>+</sup> and An<italic>nmtA</italic><sup>+</sup>, thus confirming the overexpression of the regulator <italic>in vivo</italic> (<xref ref-type="fig" rid="F5">Figure 5B</xref>).</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption><p>Overexpression of AzuR in <italic>Anabaena</italic> 7120. <bold>(A)</bold> Effect of AzuR overexpression on the morphology of <italic>Anabaena</italic> 7120. Bright-field (BF) and FM photomicrographs under blue light excitation (BLE) (excitation 470 nm, emission 508 nm) and green light excitation (GLE) (excitation 520 nm, emission 680 nm) at &#x00D7;1,500 magnification and scanning electron micrographs (SEMs) at &#x00D7;100,000 magnification of WT, An<italic>psbA</italic><sup>+</sup>, An<italic>nmtA</italic><sup>+</sup>, and An<italic>azuR</italic><sup>+</sup>. Non-uniformity of cell stacking in An<italic>azuR</italic><sup>+</sup> filament is indicated by red arrows in BF micrographs. <bold>(B)</bold> Confirmation of overexpression of <italic>azuR</italic> transcripts by RT-PCR. Total RNA of 1 &#x03BC;g was used for cDNA synthesis, which served as a template for PCR performed with <italic>azuR</italic>-specific primers. The amplified products were resolved on 1% agarose gel and visualized by ethidium bromide staining. The lower panel represents the products of 16S rRNA used as control. <bold>(C)</bold> Plot of average cell size of WT, An<italic>psbA</italic><sup>+</sup>, An<italic>nmtA</italic><sup>+</sup>, and An<italic>azuR</italic><sup>+</sup> as analyzed by SEM is presented. One-way ANOVA was employed for calculating significance of the difference. Data shown here represent mean &#x00B1; standard deviation (<italic>n</italic> = 13), ns, non-significant.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-12-782363-g005.tif"/>
</fig>
<p>Scanning electron microscopy (SEM) analysis of exponential-phase cells of An<italic>azuR</italic><sup>+</sup> revealed a significant decrease in cell size with the cells showing spherical and globular morphology in contrast to An<italic>psbA</italic><sup>+</sup>, An<italic>nmtA</italic><sup>+</sup>, and WT cells (<xref ref-type="fig" rid="F5">Figure 5A</xref>). The average cell size of An<italic>azuR</italic><sup>+</sup> cells was found to be 2.70 &#x00B1; 0.26 &#x03BC;m as compared to 3.92 &#x00B1; 0.50 &#x03BC;m for An<italic>psbA</italic><sup>+</sup> and 3.67 &#x00B1; 0.34 &#x03BC;m for An<italic>nmtA</italic><sup>+</sup>. The cell size of An<italic>azuR</italic><sup>+</sup> was lesser than the WT cells (3.214 &#x00B1; 0.34 &#x03BC;m) (<xref ref-type="fig" rid="F5">Figure 5C</xref>). Similar morphological changes regarding cell stacking and cell size were observed following overexpression of the global transcriptional regulator FurA in <italic>Anabaena</italic> 7120 (<xref ref-type="bibr" rid="B16">Gonz&#x00E1;lez et al., 2010</xref>). The elongated cell phenotype seen in An<italic>psbA</italic><sup>+</sup> and An<italic>nmtA</italic><sup>+</sup> cells could be because of stress owing to neomycin and heterologous GFP overexpression. The gross morphological changes in An<italic>azuR</italic><sup>+</sup> as compared to the empty vector An<italic>psbA</italic><sup>+</sup> indicate the possible involvement of AzuR in the regulation of genes involved in functions other than metal homeostasis. Chromatin immunoprecipitation (ChIP) studies need to be done in the future to identify direct binding of targets of AzuR in the <italic>Anabaena</italic> genome.</p>
</sec>
<sec id="S3.SS6">
<title>AzuR Overexpression Renders <italic>Anabaena</italic> 7120 Sensitive to Cadmium Stress</title>
<p>DNA binding studies by EMSA showed that AzuR bound to the upstream region of the <italic>nmtA</italic> ORF <italic>in vitro</italic>. Evaluation of <italic>nmtA</italic> expression levels in An<italic>azuR</italic><sup>+</sup> by qRT-PCR with 16S rRNA as internal control showed the downregulation of <italic>nmtA</italic> expression in An<italic>azuR</italic><sup>+</sup> by &#x223C;32-fold as compared to its empty vector An<italic>psbA</italic><sup>+</sup>. These results are in agreement with the negative regulation of <italic>nmtA</italic> transcription by AzuR <italic>in vivo</italic>.</p>
<p>Previously, overexpression of NmtA in <italic>Anabaena</italic> 7120 had conferred tolerance to cadmium stress (<xref ref-type="bibr" rid="B12">Divya et al., 2018</xref>). Since the negative regulation of <italic>nmtA</italic> transcription by AzuR was observed here, we were interested to see the effect of the overexpression of AzuR on the cadmium tolerance ability of <italic>Anabaena</italic> 7120. We compared the response of cadmium stress in An<italic>azuR</italic><sup>+</sup>, An<italic>psbA</italic><sup>+</sup>, and Ann<italic>mtA</italic><sup>+</sup> cultures. Spot assays showed increased sensitivity of An<italic>azuR</italic><sup>+</sup> cells to cadmium stress following 7 days of exposure (<xref ref-type="fig" rid="F6">Figure 6A</xref>). Growth of An<italic>azuR</italic><sup>+</sup> assessed in terms of Chl<italic>a</italic> content showed a substantial decrease even at concentrations of 10 &#x03BC;M cadmium as compared to An<italic>psbA</italic><sup>+</sup> (<xref ref-type="fig" rid="F6">Figure 6B</xref>). Growth kinetics studies in the presence of 20 &#x03BC;M cadmium resulted in almost complete bleaching of cultures of both An<italic>psbA</italic><sup>+</sup> and An<italic>azuR</italic><sup>+</sup> after 10 days of exposure to the stress (<xref ref-type="fig" rid="F6">Figure 6C</xref>) including extensive cell lysis in An<italic>azuR</italic><sup>+</sup> culture (<xref ref-type="fig" rid="F6">Figure 6D</xref>). In contrast, filaments of An<italic>nmtA</italic><sup>+</sup> appeared intact, long, and healthy on exposure to cadmium (<xref ref-type="fig" rid="F6">Figure 6D</xref>). The spot assays and growth studies assessed in terms of Chl<italic>a</italic> contents (<xref ref-type="fig" rid="F6">Figures 6A&#x2013;C</xref>) of An<italic>nmtA</italic><sup>+</sup> also supported the microscopy observations, which are in agreement with our previous results showing superior tolerance of An<italic>nmtA</italic><sup>+</sup> against cadmium stress (<xref ref-type="bibr" rid="B12">Divya et al., 2018</xref>). The GFP and Chl<italic>a</italic> fluorescence were found to be unaffected in An<italic>nmtA</italic><sup>+</sup> similar to An<italic>azuR</italic><sup>+</sup> and An<italic>psbA</italic><sup>+</sup> in the presence of cadmium (<xref ref-type="fig" rid="F6">Figure 6D</xref>). The toxic effects of cadmium on the photosynthetic machinery have been studied extensively in <italic>Synechocystis</italic> PCC 6803 (<xref ref-type="bibr" rid="B38">T&#x00F3;th et al., 2012</xref>). The major proteins involved in photosynthetic machinery include zinc-containing enzymes like carbonic anhydrase and sulfhydryl groups in ribulose-5-phosphate kinase among others that lose their activity by replacement with cadmium (<xref ref-type="bibr" rid="B38">T&#x00F3;th et al., 2012</xref>). MTs play a key role in metal detoxification by directly binding to the toxic metal, which results in lesser bioavailability (<xref ref-type="bibr" rid="B20">Klaassen et al., 1999</xref>). This protects the essential metalloproteins from the toxic metal. Since AzuR overexpression leads to a decrease in basal <italic>nmtA</italic> expression, the protective role of NmtA in imparting cadmium tolerance could be obliterated, resulting in the susceptibility of An<italic>azuR</italic><sup>+</sup> to cadmium stress, which was evident from its decreased growth and increased cell lysis. The susceptibility of Ana<italic>zuR</italic><sup>+</sup> to cadmium stress confirms the negative regulation of <italic>nmtA</italic> expression at the physiological level in <italic>Anabaena</italic>.</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption><p>Effect of AzuR overexpression on cadmium exposure. <bold>(A)</bold> Spot assays of An<italic>psbA</italic><sup>+</sup>, An<italic>nmtA</italic><sup>+</sup>, and An<italic>azuR</italic><sup>+</sup> following exposure to cadmium stress for 7 days. The cell densities are indicated in terms of Chl<italic>a</italic> content (&#x03BC;g). <bold>(B)</bold> Growth kinetics of An<italic>psbA</italic><sup>+</sup>, An<italic>nmtA</italic><sup>+</sup>, and An<italic>azuR</italic><sup>+</sup> as assessed by contents of Chl<italic>a</italic>. <bold>(C)</bold> The recombinant cultures were exposed to 10 or 20 &#x03BC;M cadmium for 10 days, and subsequently, the cultures were transferred to 12-well microtiter plate and photographed. <bold>(D)</bold> BF and FM microphotographs under BLE (excitation 470 nm, emission 508 nm) and GLE (excitation 520 nm, emission 680 nm) at &#x00D7;600 magnification of An<italic>psbA</italic><sup>+</sup>, An<italic>nmtA</italic><sup>+</sup>, and An<italic>azuR</italic><sup>+</sup> cells after 10 days of cadmium exposure.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-12-782363-g006.tif"/>
</fig>
</sec>
</sec>
<sec id="S4" sec-type="conclusion">
<title>Conclusion</title>
<p>We have characterized the role of AzuR belonging to the SmtB/ArsR family of metalloregulators in the regulation of <italic>Anabaena</italic> MT NmtA. The sequence analysis of AzuR (Alr0831) identified a distinct &#x03B1;5 metal binding site similar to that of SmtB. Although the <italic>azuR</italic> gene locus was found to be situated remotely away from the <italic>nmtA</italic> locus, analysis of the region upstream of the <italic>nmtA</italic> ORF identified the presence of 12&#x2013;2&#x2013;12 imperfect inverted repeats, which are reportedly important for binding of metalloregulators belonging to the SmtB/ArsR family of proteins. EMSAs showed AzuR binding with putative P<italic><sub><italic>nmtA</italic></sub></italic>, indicating that NmtA is a regulatory target of AzuR. Dissociation of the protein&#x2013;DNA complex was observed not only in the presence of toxic metal ions like Cd<sup>2+</sup> and Pb<sup>2+</sup> but also in the presence of essential metal ions like Zn<sup>2+</sup>, Cu<sup>2+</sup>, Co<sup>2+</sup>, Ni<sup>2+</sup>, and Mn<sup>2+</sup>, which suggested negative regulation of metal-inducible <italic>nmtA</italic> expression by AzuR. On the basis of our findings, we propose a model for <italic>Anabaena</italic> NmtA regulation by AzuR (<xref ref-type="fig" rid="F7">Figure 7</xref>). In the absence of metals or basal conditions, the binding of AzuR to the upstream region of the <italic>nmtA</italic> ORF blocks the binding site for the RNA polymerase transcription initiation complex, resulting in the repression of <italic>nmtA</italic>. At elevated concentrations of the metals, the binding of AzuR to DNA is disrupted as a result of conformational changes in the protein resulting from metal binding. This leads to the induction of <italic>nmtA</italic> transcription in the presence of metals as seen earlier in our studies (<xref ref-type="bibr" rid="B12">Divya et al., 2018</xref>). The sensing of a large number of metal ions implies a greater role of AzuR in the modulation of metal ions in the intracellular environment in <italic>Anabaena</italic> 7120.</p>
<fig id="F7" position="float">
<label>FIGURE 7</label>
<caption><p>Schematic representation of <italic>Anabaena</italic> NmtA regulation by AzuR. In the absence of metals, binding of AzuR to the upstream region of the <italic>nmtA</italic> ORF blocks the binding site for the RNA polymerase transcription initiation complex, resulting in repression of <italic>nmtA</italic>. At elevated concentrations of the metals, the binding of AzuR to DNA is disrupted as a result of structural changes in the protein due to metal binding. This leads to the induction of <italic>nmtA</italic> transcription in the presence of metals.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmicb-12-782363-g007.tif"/>
</fig>
<p>Although we have largely focused on the role of AzuR in MT regulation, the presence of <italic>cis</italic>-regulatory elements important for repressor binding at several locations in the <italic>Anabaena</italic> 7120 genome indicates that AzuR might act as a global transcriptional regulator. It will be interesting to study the role of AzuR beyond metal homeostasis. The similar inverted repeats recognized by AztR (repressor of CPx-ATPase) and AzuR (repressor of MT) suggest that these two repressors could share regulation of their respective effector genes <italic>in vivo</italic>. The direct interaction between the two regulators and possibly the cross-talk between the two processes of metal sequestration and efflux would help us to understand the regulation of the metal homeostasis system in <italic>Anabaena</italic>.</p>
</sec>
<sec id="S5" sec-type="data-availability">
<title>Data Availability Statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="S6">
<title>Author Contributions</title>
<p>CA conceived, designed, and supervised the research. TVD performed the experiments. CA and TVD analyzed the data, wrote the draft of the manuscript, and revised the manuscript. Both authors approved the submitted version.</p>
</sec>
<sec id="conf1" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="pudiscl1" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<ack>
<p>We wish to acknowledge SAIF, IIT Bombay, for protein identification by O-HRLC-MS. We are grateful to Arvind Kumar, MBD, BARC, for <italic>Anabaena</italic> LexA protein. We thank Manisha Banerjee, MBD, BARC, for extending help in CD spectroscopy and Gagan Deep Gupta and Hiral Mistry, RB &#x0026; HSD, BARC, for help in size-exclusion chromatography. We gratefully acknowledge H. S. Misra, MBD, BARC, for the support and encouragement during the course of this study.</p>
</ack>
<ref-list>
<title>References</title>
<ref id="B1"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Allen</surname> <given-names>M. M.</given-names></name></person-group> (<year>1968</year>). <article-title>Simple conditions for growth of unicellular blue-green algae on plates.</article-title> <source><italic>J. Phycol.</italic></source> <volume>4</volume> <fpage>1</fpage>&#x2013;<lpage>4</lpage>. <pub-id pub-id-type="doi">10.1111/j.1529-8817.1968.tb04667.x</pub-id> <pub-id pub-id-type="pmid">27067764</pub-id></citation></ref>
<ref id="B2"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Andrews</surname> <given-names>G. K.</given-names></name></person-group> (<year>2000</year>). <article-title>Regulation of metallothionein gene expression by oxidative stress and metal ions.</article-title> <source><italic>Biochem. Pharmacol.</italic></source> <volume>59</volume> <fpage>95</fpage>&#x2013;<lpage>104</lpage>. <pub-id pub-id-type="doi">10.1016/S0006-2952(99)00301-9</pub-id></citation></ref>
<ref id="B3"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bertini</surname> <given-names>G.</given-names></name> <name><surname>Gray</surname> <given-names>H. B.</given-names></name> <name><surname>Gray</surname> <given-names>H.</given-names></name> <name><surname>Valentine</surname> <given-names>J. S.</given-names></name> <name><surname>Stiefel</surname> <given-names>E. I.</given-names></name> <name><surname>Stiefel</surname> <given-names>E.</given-names></name></person-group> (<year>2007</year>). <source><italic>Biological Inorganic Chemistry: Structure and Reactivity.</italic></source> <publisher-loc>Melville, NY</publisher-loc>: <publisher-name>University Science Books</publisher-name>.</citation></ref>
<ref id="B4"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Blindauer</surname> <given-names>C. A.</given-names></name></person-group> (<year>2008</year>). <article-title>Zinc-handling in cyanobacteria: an update.</article-title> <source><italic>Chem. Biodivers.</italic></source> <volume>5</volume> <fpage>1990</fpage>&#x2013;<lpage>2013</lpage>. <pub-id pub-id-type="doi">10.1002/cbdv.200890183</pub-id> <pub-id pub-id-type="pmid">18972521</pub-id></citation></ref>
<ref id="B5"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Blindauer</surname> <given-names>C. A.</given-names></name></person-group> (<year>2011</year>). <article-title>Bacterial metallothioneins: past, present, and questions for the future.</article-title> <source><italic>J. Biol. Inorg. Chem.</italic></source> <volume>16</volume> <fpage>1011</fpage>&#x2013;<lpage>1024</lpage>. <pub-id pub-id-type="doi">10.1007/s00775-011-0790-y</pub-id> <pub-id pub-id-type="pmid">21594652</pub-id></citation></ref>
<ref id="B6"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Blindauer</surname> <given-names>C. A.</given-names></name> <name><surname>Leszczyszyn</surname> <given-names>O. I.</given-names></name></person-group> (<year>2010</year>). <article-title>Metallothioneins: unparalleled diversity in structures and functions for metal ion homeostasis and more.</article-title> <source><italic>Nat. Prod. Rep.</italic></source> <volume>27</volume> <fpage>720</fpage>&#x2013;<lpage>741</lpage>. <pub-id pub-id-type="doi">10.1039/B906685N</pub-id> <pub-id pub-id-type="pmid">20442962</pub-id></citation></ref>
<ref id="B7"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bose</surname> <given-names>M.</given-names></name> <name><surname>Slick</surname> <given-names>D.</given-names></name> <name><surname>Sarto</surname> <given-names>M. J.</given-names></name> <name><surname>Murphy</surname> <given-names>P.</given-names></name> <name><surname>Roberts</surname> <given-names>D.</given-names></name> <name><surname>Roberts</surname> <given-names>J.</given-names></name><etal/></person-group> (<year>2006</year>). <article-title>Identification of SmtB/ArsR cis elements and proteins in archaea using the prokaryotic intergenic exploration database (PIGED).</article-title> <source><italic>Archaea</italic></source> <volume>2</volume> <fpage>39</fpage>&#x2013;<lpage>49</lpage>. <pub-id pub-id-type="doi">10.1155/2006/837139</pub-id> <pub-id pub-id-type="pmid">16877320</pub-id></citation></ref>
<ref id="B8"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Busenlehner</surname> <given-names>L. S.</given-names></name> <name><surname>Cosper</surname> <given-names>N. J.</given-names></name> <name><surname>Scott</surname> <given-names>R. A.</given-names></name> <name><surname>Rosen</surname> <given-names>B. P.</given-names></name> <name><surname>Wong</surname> <given-names>M. D.</given-names></name> <name><surname>Giedroc</surname> <given-names>D. P.</given-names></name></person-group> (<year>2001</year>). <article-title>Spectroscopic properties of the metalloregulatory Cd (II) and Pb (II) sites of S. aureus pI258 CadC.</article-title> <source><italic>Biochemistry</italic></source> <volume>40</volume> <fpage>4426</fpage>&#x2013;<lpage>4436</lpage>. <pub-id pub-id-type="doi">10.1021/bi010006g</pub-id> <pub-id pub-id-type="pmid">11284699</pub-id></citation></ref>
<ref id="B9"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Busenlehner</surname> <given-names>L. S.</given-names></name> <name><surname>Pennella</surname> <given-names>M. A.</given-names></name> <name><surname>Giedroc</surname> <given-names>D. P.</given-names></name></person-group> (<year>2003</year>). <article-title>The SmtB/ArsR family of metalloregulatory transcriptional repressors: structural insights into prokaryotic metal resistance.</article-title> <source><italic>FEMS Microbiol. Rev.</italic></source> <volume>27</volume> <fpage>131</fpage>&#x2013;<lpage>143</lpage>. <pub-id pub-id-type="doi">10.1016/S0168-6445(03)00054-8</pub-id></citation></ref>
<ref id="B10"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Chandrangsu</surname> <given-names>P.</given-names></name> <name><surname>Rensing</surname> <given-names>C.</given-names></name> <name><surname>Helmann</surname> <given-names>J. D.</given-names></name></person-group> (<year>2017</year>). <article-title>Metal homeostasis and resistance in bacteria.</article-title> <source><italic>Nat. Rev. Microbiol.</italic></source> <volume>15</volume> <fpage>338</fpage>&#x2013;<lpage>350</lpage>. <pub-id pub-id-type="doi">10.1038/nrmicro.2017.15</pub-id> <pub-id pub-id-type="pmid">28344348</pub-id></citation></ref>
<ref id="B11"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Chaurasia</surname> <given-names>A. K.</given-names></name> <name><surname>Parasnis</surname> <given-names>A.</given-names></name> <name><surname>Apte</surname> <given-names>S. K.</given-names></name></person-group> (<year>2008</year>). <article-title>An integrative expression vector for strain improvement and environmental applications of the nitrogen fixing cyanobacterium, <italic>Anabaena</italic> sp. strain PCC7120.</article-title> <source><italic>J. Microbiol. Methods</italic></source> <volume>73</volume> <fpage>133</fpage>&#x2013;<lpage>141</lpage>. <pub-id pub-id-type="doi">10.1016/j.mimet.2008.01.013</pub-id> <pub-id pub-id-type="pmid">18367274</pub-id></citation></ref>
<ref id="B12"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Divya</surname> <given-names>T. V.</given-names></name> <name><surname>Chandwadkar</surname> <given-names>P.</given-names></name> <name><surname>Acharya</surname> <given-names>C.</given-names></name></person-group> (<year>2018</year>). <article-title>NmtA, a novel metallothionein of <italic>Anabaena</italic> sp. strain PCC 7120 imparts protection against cadmium stress but not oxidative stress.</article-title> <source><italic>Aquat. Toxicol.</italic></source> <volume>199</volume> <fpage>152</fpage>&#x2013;<lpage>161</lpage>. <pub-id pub-id-type="doi">10.1016/j.aquatox.2018.03.035</pub-id> <pub-id pub-id-type="pmid">29626757</pub-id></citation></ref>
<ref id="B13"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Elhai</surname> <given-names>J.</given-names></name> <name><surname>Vepritskiy</surname> <given-names>A.</given-names></name> <name><surname>Muro-Pastor</surname> <given-names>A. M.</given-names></name> <name><surname>Flores</surname> <given-names>E.</given-names></name> <name><surname>Wolk</surname> <given-names>C. P.</given-names></name></person-group> (<year>1997</year>). <article-title>Reduction of conjugal transfer efficiency by three restriction activities of <italic>Anabaena</italic> sp. strain PCC 7120.</article-title> <source><italic>J. Bacteriol.</italic></source> <volume>179</volume> <fpage>1998</fpage>&#x2013;<lpage>2005</lpage>. <pub-id pub-id-type="doi">10.1128/jb.179.6.1998-2005.1997</pub-id> <pub-id pub-id-type="pmid">9068647</pub-id></citation></ref>
<ref id="B14"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Erbe</surname> <given-names>J. L.</given-names></name> <name><surname>Taylor</surname> <given-names>K. B.</given-names></name> <name><surname>Hall</surname> <given-names>L. M.</given-names></name></person-group> (<year>1995</year>). <article-title>Metalloregulation of the cyanobacterial smt locus: indentification of SmtB binding sites and direct interaction with metals.</article-title> <source><italic>Nucleic Acids Res.</italic></source> <volume>23</volume> <fpage>2472</fpage>&#x2013;<lpage>2478</lpage>. <pub-id pub-id-type="doi">10.1093/nar/23.13.2472</pub-id> <pub-id pub-id-type="pmid">7630724</pub-id></citation></ref>
<ref id="B15"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Finney</surname> <given-names>L. A.</given-names></name> <name><surname>O&#x2019;Halloran</surname> <given-names>T. V.</given-names></name></person-group> (<year>2003</year>). <article-title>Transition metal speciation in the cell: insights from the chemistry of metal ion receptors.</article-title> <source><italic>Science</italic></source> <volume>300</volume> <fpage>931</fpage>&#x2013;<lpage>936</lpage>. <pub-id pub-id-type="doi">10.1126/science.1085049</pub-id> <pub-id pub-id-type="pmid">12738850</pub-id></citation></ref>
<ref id="B16"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Gonz&#x00E1;lez</surname> <given-names>A.</given-names></name> <name><surname>Bes</surname> <given-names>M. T.</given-names></name> <name><surname>Barja</surname> <given-names>F.</given-names></name> <name><surname>Peleato</surname> <given-names>M. L.</given-names></name> <name><surname>Fillat</surname> <given-names>M. F.</given-names></name></person-group> (<year>2010</year>). <article-title>Overexpression of FurA in <italic>Anabaena</italic> sp. PCC 7120 reveals new targets for this regulator involved in photosynthesis, iron uptake and cellular morphology.</article-title> <source><italic>Plant Cell Physiol.</italic></source> <volume>51</volume> <fpage>1900</fpage>&#x2013;<lpage>1914</lpage>. <pub-id pub-id-type="doi">10.1093/pcp/pcq148</pub-id> <pub-id pub-id-type="pmid">20926415</pub-id></citation></ref>
<ref id="B17"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Habjani&#x010D;</surname> <given-names>J.</given-names></name> <name><surname>Mathew</surname> <given-names>A.</given-names></name> <name><surname>Eberl</surname> <given-names>L.</given-names></name> <name><surname>Freisinger</surname> <given-names>E.</given-names></name></person-group> (<year>2020</year>). <article-title>Deciphering the enigmatic function of <italic>Pseudomonas</italic> metallothioneins.</article-title> <source><italic>Front. Microbiol.</italic></source> <volume>11</volume>:<fpage>1709</fpage>. <pub-id pub-id-type="doi">10.3389/fmicb.2020.01709</pub-id> <pub-id pub-id-type="pmid">32793167</pub-id></citation></ref>
<ref id="B18"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hill</surname> <given-names>A. V.</given-names></name></person-group> (<year>1910</year>). <article-title>The possible effects of the aggregation of the molecules of haemoglobin on its dissociation curves.</article-title> <source><italic>J. Physiol.</italic></source> <volume>40</volume> <fpage>4</fpage>&#x2013;<lpage>7</lpage>.</citation></ref>
<ref id="B19"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Huckle</surname> <given-names>J. W.</given-names></name> <name><surname>Morby</surname> <given-names>A. P.</given-names></name> <name><surname>Turner</surname> <given-names>J. S.</given-names></name> <name><surname>Robinson</surname> <given-names>N. J.</given-names></name></person-group> (<year>1993</year>). <article-title>Isolation of a prokaryotic metallothionein locus and analysis of transcriptional control by trace metal ions.</article-title> <source><italic>Mol. Microbiol.</italic></source> <volume>7</volume> <fpage>177</fpage>&#x2013;<lpage>187</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2958.1993.tb01109.x</pub-id> <pub-id pub-id-type="pmid">8446025</pub-id></citation></ref>
<ref id="B20"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Klaassen</surname> <given-names>C. D.</given-names></name> <name><surname>Liu</surname> <given-names>J.</given-names></name> <name><surname>Choudhuri</surname> <given-names>S.</given-names></name></person-group> (<year>1999</year>). <article-title>Metallothionein: an intracellular protein to protect against cadmium toxicity.</article-title> <source><italic>Annu. Rev. Pharmacool. Toxicol</italic>.</source> <volume>39</volume> <fpage>267</fpage>&#x2013;<lpage>294</lpage>. <pub-id pub-id-type="doi">10.1146/annurev.pharmtox.39.1.267</pub-id> <pub-id pub-id-type="pmid">10331085</pub-id></citation></ref>
<ref id="B21"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kumar</surname> <given-names>S.</given-names></name> <name><surname>Stecher</surname> <given-names>G.</given-names></name> <name><surname>Li</surname> <given-names>M.</given-names></name> <name><surname>Knyaz</surname> <given-names>C.</given-names></name> <name><surname>Tamura</surname> <given-names>K.</given-names></name></person-group> (<year>2018</year>). <article-title>MEGA X: molecular evolutionary genetics analysis across computing platforms.</article-title> <source><italic>Mol. Biol. Evol.</italic></source> <volume>35</volume>:<fpage>1547</fpage>. <pub-id pub-id-type="doi">10.1093/molbev/msy096</pub-id> <pub-id pub-id-type="pmid">29722887</pub-id></citation></ref>
<ref id="B22"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname> <given-names>T.</given-names></name> <name><surname>Chen</surname> <given-names>X.</given-names></name> <name><surname>Ma</surname> <given-names>Z.</given-names></name> <name><surname>Shokes</surname> <given-names>J.</given-names></name> <name><surname>Hemmingsen</surname> <given-names>L.</given-names></name> <name><surname>Scott</surname> <given-names>R. A.</given-names></name><etal/></person-group> (<year>2008</year>). <article-title>A Cu(I)-sensing ArsR family metal sensor protein with a relaxed metal selectivity profile.</article-title> <source><italic>Biochemistry</italic></source> <volume>47</volume> <fpage>10564</fpage>&#x2013;<lpage>10575</lpage>. <pub-id pub-id-type="doi">10.1021/bi801313y</pub-id> <pub-id pub-id-type="pmid">18795800</pub-id></citation></ref>
<ref id="B23"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname> <given-names>T.</given-names></name> <name><surname>Golden</surname> <given-names>J. W.</given-names></name> <name><surname>Giedroc</surname> <given-names>D. P.</given-names></name></person-group> (<year>2005</year>). <article-title>A zinc (II)/lead (II)/cadmium (II)-inducible operon from the cyanobacterium <italic>Anabaena</italic> is regulated by AztR, an &#x03B1;3N SmtB/ArsR metalloregulator.</article-title> <source><italic>Biochemistry</italic></source> <volume>44</volume> <fpage>8673</fpage>&#x2013;<lpage>8683</lpage>. <pub-id pub-id-type="doi">10.1021/bi050450+</pub-id> <pub-id pub-id-type="pmid">15952774</pub-id></citation></ref>
<ref id="B24"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname> <given-names>T.</given-names></name> <name><surname>Nakashima</surname> <given-names>S.</given-names></name> <name><surname>Hirose</surname> <given-names>K.</given-names></name> <name><surname>Shibasaka</surname> <given-names>M.</given-names></name> <name><surname>Katsuhara</surname> <given-names>M.</given-names></name> <name><surname>Ezaki</surname> <given-names>B.</given-names></name><etal/></person-group> (<year>2004</year>). <article-title>A novel cyanobacterial SmtB/ArsR family repressor regulates the expression of a CPx-ATPase and a metallothionein in response to both Cu (I)/Ag (I) and Zn (II)/Cd (II).</article-title> <source><italic>J. Biol. Chem.</italic></source> <volume>279</volume> <fpage>17810</fpage>&#x2013;<lpage>17818</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.M310560200</pub-id> <pub-id pub-id-type="pmid">14960585</pub-id></citation></ref>
<ref id="B25"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Madeira</surname> <given-names>F.</given-names></name> <name><surname>Park</surname> <given-names>Y. M.</given-names></name> <name><surname>Lee</surname> <given-names>J.</given-names></name> <name><surname>Buso</surname> <given-names>N.</given-names></name> <name><surname>Gur</surname> <given-names>T.</given-names></name> <name><surname>Madhusoodanan</surname> <given-names>N.</given-names></name><etal/></person-group> (<year>2019</year>). <article-title>The EMBL-EBI search and sequence analysis tools APIs in 2019.</article-title> <source><italic>Nucleic Acids Res.</italic></source> <volume>47</volume> <fpage>W636</fpage>&#x2013;<lpage>W641</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkz268</pub-id> <pub-id pub-id-type="pmid">30976793</pub-id></citation></ref>
<ref id="B26"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Mr&#x00E1;zek</surname> <given-names>J.</given-names></name> <name><surname>Xie</surname> <given-names>S.</given-names></name></person-group> (<year>2006</year>). <article-title>Pattern locator: a new tool for finding local sequence patterns in genomic DNA sequences.</article-title> <source><italic>Bioinformatics</italic></source> <volume>22</volume> <fpage>3099</fpage>&#x2013;<lpage>3100</lpage>. <pub-id pub-id-type="doi">10.1093/bioinformatics/btl551</pub-id> <pub-id pub-id-type="pmid">17095514</pub-id></citation></ref>
<ref id="B27"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Napolitano</surname> <given-names>M.</given-names></name> <name><surname>Rubio</surname> <given-names>M. &#x00C1;.</given-names></name> <name><surname>Santamaria-Gomez</surname> <given-names>J.</given-names></name> <name><surname>Olmedo-Verd</surname> <given-names>E.</given-names></name> <name><surname>Robinson</surname> <given-names>N. J.</given-names></name> <name><surname>Luque</surname> <given-names>I.</given-names></name></person-group> (<year>2012</year>). <article-title>Characterization of the response to zinc deficiency in the cyanobacterium <italic>Anabaena</italic> sp. strain PCC 7120.</article-title> <source><italic>J. Bacteriol.</italic></source> <volume>194</volume> <fpage>2426</fpage>&#x2013;<lpage>2436</lpage>. <pub-id pub-id-type="doi">10.1128/JB.00090-12</pub-id> <pub-id pub-id-type="pmid">22389488</pub-id></citation></ref>
<ref id="B28"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Osman</surname> <given-names>D.</given-names></name> <name><surname>Cavet</surname> <given-names>J. S.</given-names></name></person-group> (<year>2010</year>). <article-title>Bacterial metal-sensing proteins exemplified by ArsR-SmtB family repressors.</article-title> <source><italic>Nat. Prod. Rep.</italic></source> <volume>27</volume> <fpage>668</fpage>&#x2013;<lpage>680</lpage>. <pub-id pub-id-type="doi">10.1039/B906682A</pub-id> <pub-id pub-id-type="pmid">20442958</pub-id></citation></ref>
<ref id="B29"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Palmiter</surname> <given-names>R. D.</given-names></name></person-group> (<year>1987</year>). &#x201C;<article-title>Molecular biology of metallothionein gene expression</article-title>,&#x201D; in <source><italic>Metallothionein II. Experientia Supplementum</italic></source>, <volume>Vol. 52</volume> <role>eds</role> <person-group person-group-type="editor"><name><surname>K&#x00E4;gi</surname> <given-names>J. H. R.</given-names></name> <name><surname>Kojima</surname> <given-names>Y.</given-names></name></person-group> (<publisher-loc>Basel</publisher-loc>: <publisher-name>Birkh&#x00E4;user</publisher-name>), <pub-id pub-id-type="doi">10.1007/978-3-0348-6784-9_4</pub-id></citation></ref>
<ref id="B30"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Perez-Iratxeta</surname> <given-names>C.</given-names></name> <name><surname>Andrade-Navarro</surname> <given-names>M. A.</given-names></name></person-group> (<year>2008</year>). <article-title>K2D2: estimation of protein secondary structure from circular dichroism spectra.</article-title> <source><italic>BMC Struct. Biol.</italic></source> <volume>8</volume>:<fpage>25</fpage>. <pub-id pub-id-type="doi">10.1186/1472-6807-8-25</pub-id> <pub-id pub-id-type="pmid">18477405</pub-id></citation></ref>
<ref id="B31"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Pinto</surname> <given-names>F.</given-names></name> <name><surname>Pacheco</surname> <given-names>C. C.</given-names></name> <name><surname>Ferreira</surname> <given-names>D.</given-names></name> <name><surname>Moradas-Ferreira</surname> <given-names>P.</given-names></name> <name><surname>Tamagnini</surname> <given-names>P.</given-names></name></person-group> (<year>2012</year>). <article-title>Selection of suitable reference genes for RT-qPCR analyses in cyanobacteria.</article-title> <source><italic>PLoS One</italic></source> <volume>7</volume>:<fpage>e34983</fpage>. <pub-id pub-id-type="doi">10.1371/journal.pone.0034983</pub-id> <pub-id pub-id-type="pmid">22496882</pub-id></citation></ref>
<ref id="B32"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Rees</surname> <given-names>D. C.</given-names></name></person-group> (<year>2002</year>). <article-title>Great metalloclusters in enzymology.</article-title> <source><italic>Annu. Rev. Biochem.</italic></source> <volume>71</volume> <fpage>221</fpage>&#x2013;<lpage>246</lpage>. <pub-id pub-id-type="doi">10.1146/annurev.biochem.71.110601.135406</pub-id> <pub-id pub-id-type="pmid">12045096</pub-id></citation></ref>
<ref id="B33"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Roy</surname> <given-names>A.</given-names></name> <name><surname>Kucukural</surname> <given-names>A.</given-names></name> <name><surname>Zhang</surname> <given-names>Y.</given-names></name></person-group> (<year>2010</year>). <article-title>I-TASSER: a unified platform for automated protein structure and function prediction.</article-title> <source><italic>Nat. Protoc.</italic></source> <volume>5</volume> <fpage>725</fpage>&#x2013;<lpage>738</lpage>. <pub-id pub-id-type="doi">10.1038/nprot.2010.5</pub-id> <pub-id pub-id-type="pmid">20360767</pub-id></citation></ref>
<ref id="B34"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Saha</surname> <given-names>R. P.</given-names></name> <name><surname>Samanta</surname> <given-names>S.</given-names></name> <name><surname>Patra</surname> <given-names>S.</given-names></name> <name><surname>Sarkar</surname> <given-names>D.</given-names></name> <name><surname>Saha</surname> <given-names>A.</given-names></name> <name><surname>Singh</surname> <given-names>M. K.</given-names></name></person-group> (<year>2017</year>). <article-title>Metal homeostasis in bacteria: the role of ArsR&#x2013;SmtB family of transcriptional repressors in combating varying metal concentrations in the environment.</article-title> <source><italic>Biometals</italic></source> <volume>30</volume> <fpage>459</fpage>&#x2013;<lpage>503</lpage>. <pub-id pub-id-type="doi">10.1007/s10534-017-0020-3</pub-id> <pub-id pub-id-type="pmid">28512703</pub-id></citation></ref>
<ref id="B35"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Salamov</surname> <given-names>V. S. A.</given-names></name> <name><surname>Solovyevand</surname> <given-names>A.</given-names></name></person-group> (<year>2011</year>). &#x201C;<article-title>Automatic annotation of microbial genomes and metagenomic sequences</article-title>,&#x201D; in <source><italic>Metagenomics and Its Applications in Agriculture, Biomedicine and Environmental Studies</italic></source>, <role>ed.</role> <person-group person-group-type="editor"><name><surname>Li</surname> <given-names>R. W.</given-names></name></person-group> (<publisher-loc>Hauppauge, NY</publisher-loc>: <publisher-name>Nova Science Publishers</publisher-name>), <fpage>61</fpage>&#x2013;<lpage>78</lpage>.</citation></ref>
<ref id="B36"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Thelwell</surname> <given-names>C.</given-names></name> <name><surname>Robinson</surname> <given-names>N. J.</given-names></name> <name><surname>Turner-Cavet</surname> <given-names>J. S.</given-names></name></person-group> (<year>1998</year>). <article-title>An SmtB-like repressor from <italic>Synechocystis</italic> PCC 6803 regulates a zinc exporter.</article-title> <source><italic>Proc. Natl. Acad. Sci. U.S.A.</italic></source> <volume>95</volume> <fpage>10728</fpage>&#x2013;<lpage>10733</lpage>.</citation></ref>
<ref id="B37"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Thompson</surname> <given-names>J. D.</given-names></name> <name><surname>Higgins</surname> <given-names>D. G.</given-names></name> <name><surname>Gibson</surname> <given-names>T. J.</given-names></name></person-group> (<year>1994</year>). <article-title>CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.</article-title> <source><italic>Nucleic Acids Res.</italic></source> <volume>22</volume> <fpage>4673</fpage>&#x2013;<lpage>4680</lpage>. <pub-id pub-id-type="doi">10.1093/nar/22.22.4673</pub-id> <pub-id pub-id-type="pmid">7984417</pub-id></citation></ref>
<ref id="B38"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>T&#x00F3;th</surname> <given-names>T.</given-names></name> <name><surname>Zsiros</surname> <given-names>O.</given-names></name> <name><surname>Kis</surname> <given-names>M.</given-names></name> <name><surname>Garab</surname> <given-names>G.</given-names></name> <name><surname>Kovacs</surname> <given-names>L.</given-names></name></person-group> (<year>2012</year>). <article-title>Cadmium exerts its toxic effects on photosynthesis via a cascade mechanism in the cyanobacterium, <italic>Synechocystis</italic> PCC 6803.</article-title> <source><italic>Plant Cell Environ.</italic></source> <volume>35</volume> <fpage>2075</fpage>&#x2013;<lpage>2086</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-3040.2012.02537.x</pub-id> <pub-id pub-id-type="pmid">22583050</pub-id></citation></ref>
<ref id="B39"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Tottey</surname> <given-names>S.</given-names></name> <name><surname>Harvie</surname> <given-names>D. R.</given-names></name> <name><surname>Robinson</surname> <given-names>N. J.</given-names></name></person-group> (<year>2005</year>). <article-title>Understanding how cells allocate metals using metal sensors and metallochaperones.</article-title> <source><italic>Acc. Chem. Res.</italic></source> <volume>38</volume> <fpage>775</fpage>&#x2013;<lpage>783</lpage>. <pub-id pub-id-type="doi">10.1021/ar0300118</pub-id> <pub-id pub-id-type="pmid">16231873</pub-id></citation></ref>
<ref id="B40"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Tottey</surname> <given-names>S.</given-names></name> <name><surname>Harvie</surname> <given-names>D. R.</given-names></name> <name><surname>Robinson</surname> <given-names>N. J.</given-names></name></person-group> (<year>2007</year>). &#x201C;<article-title>Understanding how cells allocate metals</article-title>,&#x201D; in <source><italic>Molecular Microbiology of Heavy Metals. Microbiology Monographs</italic></source>, <volume>Vol. 6</volume> <role>eds</role> <person-group person-group-type="editor"><name><surname>Nies</surname> <given-names>D. H.</given-names></name> <name><surname>Silver</surname> <given-names>S.</given-names></name></person-group> (<publisher-loc>Berlin</publisher-loc>: <publisher-name>Springer</publisher-name>), <pub-id pub-id-type="doi">10.1007/7171_2006_072</pub-id></citation></ref>
<ref id="B41"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Turner</surname> <given-names>J. S.</given-names></name> <name><surname>Glands</surname> <given-names>P. D.</given-names></name> <name><surname>Samson</surname> <given-names>A. C.</given-names></name> <name><surname>Robinson</surname> <given-names>N. J.</given-names></name></person-group> (<year>1996</year>). <article-title>Zn 2+-sensing by the cyanobacterial metallothionein repressor SmtB: different motifs mediate metal-induced protein-DNA dissociation.</article-title> <source><italic>Nucleic Acids Res.</italic></source> <volume>24</volume> <fpage>3714</fpage>&#x2013;<lpage>3721</lpage>. <pub-id pub-id-type="doi">10.1093/nar/24.19.3714</pub-id> <pub-id pub-id-type="pmid">8871549</pub-id></citation></ref>
<ref id="B42"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Turner</surname> <given-names>J. S.</given-names></name> <name><surname>Robinson</surname> <given-names>N. J.</given-names></name></person-group> (<year>1995</year>). <article-title>Cyanobacterial metallothioneins: biochemistry and molecular genetics.</article-title> <source><italic>J. Ind. Microbiol.</italic></source> <volume>14</volume> <fpage>119</fpage>&#x2013;<lpage>125</lpage>. <pub-id pub-id-type="doi">10.1007/BF01569893</pub-id> <pub-id pub-id-type="pmid">7766203</pub-id></citation></ref>
<ref id="B43"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>VanZile</surname> <given-names>M. L.</given-names></name> <name><surname>Chen</surname> <given-names>X.</given-names></name> <name><surname>Giedroc</surname> <given-names>D. P.</given-names></name></person-group> (<year>2002</year>). <article-title>Allosteric negative regulation of smt O/P binding of the zinc sensor, SmtB, by metal ions: a coupled equilibrium analysis.</article-title> <source><italic>Biochemistry</italic></source> <volume>41</volume> <fpage>9776</fpage>&#x2013;<lpage>9786</lpage>. <pub-id pub-id-type="doi">10.1021/bi020178t</pub-id> <pub-id pub-id-type="pmid">12146943</pub-id></citation></ref>
<ref id="B44"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>VanZile</surname> <given-names>M. L.</given-names></name> <name><surname>Cosper</surname> <given-names>N. J.</given-names></name> <name><surname>Scott</surname> <given-names>R. A.</given-names></name> <name><surname>Giedroc</surname> <given-names>D. P.</given-names></name></person-group> (<year>2000</year>). <article-title>The zinc metalloregulatory protein <italic>Synechococcus</italic> PCC7942 SmtB binds a single zinc ion per monomer with high affinity in a tetrahedral coordination geometry.</article-title> <source><italic>Biochemistry</italic></source> <volume>39</volume> <fpage>11818</fpage>&#x2013;<lpage>11829</lpage>. <pub-id pub-id-type="doi">10.1021/bi001140o</pub-id> <pub-id pub-id-type="pmid">10995250</pub-id></citation></ref>
<ref id="B45"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Waldron</surname> <given-names>K. J.</given-names></name> <name><surname>Robinson</surname> <given-names>N. J.</given-names></name></person-group> (<year>2009</year>). <article-title>How do bacterial cells ensure that metalloproteins get the correct metal?</article-title> <source><italic>Nat. Rev. Microbiol.</italic></source> <volume>7</volume> <fpage>25</fpage>&#x2013;<lpage>35</lpage>. <pub-id pub-id-type="doi">10.1038/nrmicro2057</pub-id> <pub-id pub-id-type="pmid">19079350</pub-id></citation></ref>
<ref id="B46"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Waterhouse</surname> <given-names>A. M.</given-names></name> <name><surname>Procter</surname> <given-names>J. B.</given-names></name> <name><surname>Martin</surname> <given-names>D. M.</given-names></name> <name><surname>Clamp</surname> <given-names>M.</given-names></name> <name><surname>Barton</surname> <given-names>G. J.</given-names></name></person-group> (<year>2009</year>). <article-title>Jalview Version 2&#x2014;a multiple sequence alignment editor and analysis workbench.</article-title> <source><italic>Bioinformatics</italic></source> <volume>25</volume> <fpage>1189</fpage>&#x2013;<lpage>1191</lpage>. <pub-id pub-id-type="doi">10.1093/bioinformatics/btp033</pub-id> <pub-id pub-id-type="pmid">19151095</pub-id></citation></ref>
<ref id="B47"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wu</surname> <given-names>X.</given-names></name> <name><surname>Lee</surname> <given-names>D. W.</given-names></name> <name><surname>Mella</surname> <given-names>R. A.</given-names></name> <name><surname>Golden</surname> <given-names>J. W.</given-names></name></person-group> (<year>2007</year>). <article-title>The <italic>Anabaena</italic> sp. strain PCC 7120 asr1734 gene encodes a negative regulator of heterocyst development.</article-title> <source><italic>Mol. Microbiol.</italic></source> <volume>64</volume> <fpage>782</fpage>&#x2013;<lpage>794</lpage>. <pub-id pub-id-type="doi">10.1111/j.1365-2958.2007.05698.x</pub-id> <pub-id pub-id-type="pmid">17462023</pub-id></citation></ref>
<ref id="B48"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Yang</surname> <given-names>J.</given-names></name> <name><surname>Yan</surname> <given-names>R.</given-names></name> <name><surname>Roy</surname> <given-names>A.</given-names></name> <name><surname>Xu</surname> <given-names>D.</given-names></name> <name><surname>Poisson</surname> <given-names>J.</given-names></name> <name><surname>Zhang</surname> <given-names>Y.</given-names></name></person-group> (<year>2015</year>). <article-title>The I-TASSER Suite: protein structure and function prediction.</article-title> <source><italic>Nat. Methods</italic></source> <volume>12</volume> <fpage>7</fpage>&#x2013;<lpage>8</lpage>. <pub-id pub-id-type="doi">10.1038/nmeth.3213</pub-id> <pub-id pub-id-type="pmid">25549265</pub-id></citation></ref>
<ref id="B49"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Yoon</surname> <given-names>H. S.</given-names></name> <name><surname>Golden</surname> <given-names>J. W.</given-names></name></person-group> (<year>1998</year>). <article-title>Heterocyst pattern formation controlled by a diffusible peptide.</article-title> <source><italic>Science</italic></source> <volume>282</volume> <fpage>935</fpage>&#x2013;<lpage>938</lpage>. <pub-id pub-id-type="doi">10.1126/science.282.5390.935</pub-id> <pub-id pub-id-type="pmid">9794762</pub-id></citation></ref>
<ref id="B50"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname> <given-names>Y.</given-names></name></person-group> (<year>2008</year>). <article-title>I-TASSER server for protein 3D structure prediction.</article-title> <source><italic>BMC Bioinformatics</italic></source> <volume>9</volume>:<fpage>40</fpage>. <pub-id pub-id-type="doi">10.1186/1471-2105-9-40</pub-id> <pub-id pub-id-type="pmid">18215316</pub-id></citation></ref>
</ref-list>
</back>
</article>