Front. Microbiol. Frontiers in Microbiology Front. Microbiol. 1664-302X Frontiers Media S.A. 10.3389/fmicb.2021.772637 Microbiology Correction Corrigendum: A Survey Using High-Throughput Sequencing Suggests That the Diversity of Cereal and Barley Yellow Dwarf Viruses Is Underestimated Sõmera Merike 1 * Massart Sébastien 2 Tamisier Lucie 2 Sooväli Pille 3 Sathees Kanitha 4 Kvarnheden Anders 4 5 1Department of Chemistry and Biotechnology, Tallinn University of Technology, Tallinn, Estonia 2Laboratory of Integrated and Urban Phytopathology, Gembloux Agro-Bio Tech – University of Liège, Gembloux, Belgium 3Department of Plant Protection, Estonian Crop Research Institute, Jõgeva, Estonia 4Department of Plant Biology, Swedish University of Agricultural Sciences, Uppsala, Sweden 5Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences, Tartu, Estonia

Approved by: Frontiers Editorial Office, Frontiers Media SA, Switzerland

 *Correspondence: Merike Sõmera merike.somera@taltech.ee

This article was submitted to Microbe and Virus Interactions with Plants, a section of the journal Frontiers in Microbiology

 19 11 2021 2021 12 772637 08 09 2021 26 10 2021 Copyright © 2021 Sõmera, Massart, Tamisier, Sooväli, Sathees and Kvarnheden. 2021 Sõmera, Massart, Tamisier, Sooväli, Sathees and Kvarnheden

This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

 A Corrigendum on A Survey Using High-Throughput Sequencing Suggests That the Diversity of Cereal and Barley Yellow Dwarf Viruses Is Underestimated by Sõmera, M., Massart, S., Tamisier, L., Sooväli, P., Sathees, K., and Kvarnheden, A. (2021). Front. Microbiol. 12:673218. doi: 10.3389/fmicb.2021.673218 HTS Luteovirus BYDV CYDV diagnostics wheat epidemiology OYV

In the original article, there was a typographical mistake in Table 1 as published. The sequence of Yan-R primer should read “TGTTGAGGAGTCTACCTATTTG”. The Yan-R primer sequence was given correct in the Supplementary Table 2. The correct Yan-R primer was used in experiments undertaken in this study and thus it does not impact on validity of the results. The corrected Table 1 appears below.

Primers used in the current study.

Primers Nucleotide sequence 5' to 3' Expected position References
P326(+) GACTTCGAGGCNGANCTCGCT 330–350 Liu et al., 2007
P12(-) GCTCCGTCTGTGACCGCAAT 1226–1245 Liu et al., 2007
P115(+) GGGTTTTTAGAGGGGCTCTGT 1157–1177 Liu et al., 2007
OYV5(-) TCACCATGTTGAAGCCGTATT 2199–2219 This study
OYV4(+) ATGTTCGTTGAGGATAAGATGC 1973–1994 This study
OYV1(-) AGTACGTGAGAGCTAATGTAC 2800–2820 This study
Shu-F TACGGTAAGTGCCCAACTCC 2650–2669 Malmstrom and Shu, 2004
Yan-R TGTTGAGGAGTCTACCTATTTG 3459–3480 Malmstrom and Shu, 2004
OYV2(+) TGAACTCGACACTGCGTGCA 3237–3256 This study
OYV3(-) CTACCCGAGCTTATGAACCT 4857–4876 This study
P47(+) GCAAAGGAGTACAAGGCACAAT 4777–4798 Liu et al., 2007
P55(-) GGATTGCTATGGTTTATGTCC 5491–5511 Liu et al., 2007
OYV5pR1 AAGTCCGTCCAAGCCTCGG 533–541 This study
OYV5pR2 CTTTGACGCTGGCTCCAATGAGC 161–183 This study
PasF GAAGAGGGCCAAATTCTATACC 3003–3024* This study
OyvF CCAATTCCTCAGGGATCC 3080–3097 This study
GavF GTTACAAGATCACAAACGTCAAG 3156–3178** This study
PavF CTTCACAATCAGCAGGAC 3261–3278*** This study

Primer binding positions are shown respective to full length sequence of BYDV-OYV Avinurme2 isolate (MK012645; unless mentioned otherwise).

BYDV-PAS (MK012660),

BYDV-GAV (MK012663), and

BYDV-PAV (MK012661).

The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.

Publisher's Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

 References Liu F. Wang X. Liu Y. Xie J. Gray S. M. Zhou G. . (2007). A Chinese isolate of barley yellow dwarf virus-PAV represents a third distinct species within the PAV serotype. Arch. Virol. 152, 1365–1373. 10.1007/s00705-007-0947-817347769 Malmstrom C. Shu R. (2004). Multiplexed RT-PCR for streamlined detection and separation of barley and cereal yellow dwarf viruses. J. Virol. Methods 120, 69–78. 10.1016/j.jviromet.2004.04.00515234811