The F. tularensis live vaccine strain (LVS, ATCC 29684) was grown at 37°C on Cystine Heart Agar (5.1% CHA supplemented with 1% hemoglobin, Difco) or in cation-adjusted Mueller–Hinton broth (CAMHB; BBL, 212322), supplemented with 2% defined growth supplement (IsoVitaleX Enrichment; BBL 211876) and 3 μM hematin (Sigma 3281), termed HLMHI. The Y. pestis strain EV76 (Ben-Gurion and Shafferman, 1981), the spontaneous ciprofloxacin-resistant mutant #66-6 (Steinberger-Levy et al., 2016) and doxycycline-resistant mutant #36-4-18 (Shifman et al., 2019), and the B. anthracis strain Vollum ΔpXO1 ΔpXO2 (Levy et al., 2014) were grown on Brain Heart Infusion agar (BHI-A; BD Difco 241830) plates at 28°C and 37°C, respectively. Colony-forming unit (cfu) counts were determined by plating 100 μl of serial 10-fold dilutions in phosphate-buffered saline (PBS, Biological Industries, Beth Haemek, Israel) on CHA for F. tularensis and BHI-A plates for B. anthracis and Y. pestis.

Ten milliliters of human blood obtained from the National Blood Services, MDA, Israel, under MDA research permit 08-0122 was inoculated with different concentrations of B. anthracis, Y. pestis, and F. tularensis. The inoculated blood was transferred to BACTEC^TM Plus Aerobic/F Culture vials (BD, Cat# 442192). The blood cultures (10 ml blood) or whole blood (1 ml) inoculated with bacteria were shaken at 150 rpm at 37°C in a New Brunswick Scientific C76 water bath for various time periods.

The Micro-Agar-PCR-test plates were prepared using MHA (BD 225250) for B. anthracis and Y. pestis and CHA for F. tularensis. Agar media was prepared according to the manufacturer’s guidelines. Agar dilution was performed basically as described in CLSI standard M07 (CLSI, 2018). Following autoclaving, the agar was cooled to 50°C and 40 ml was aliquoted to 50-ml tubes where the tested antibiotic doxycycline (Sigma D9891), ciprofloxacin (ciproxin 200, Bayer), and gentamicin (Sigma G1264) were added. Antimicrobial solution (10×) was diluted by making twofold serial dilutions in master tubes. Then, one part of the 10× antimicrobial solution was added to nine parts of melted agar. Agar with no antibiotics served as growth control. One-hundred-fifty-microliter aliquots of the antibiotic-supplemented melted agar were divided into a 96-well plate.

Ten microliters of the clinical sample (in duplicate) was plated in different wells of MAPt plates containing different concentrations of the tested antibiotics. The MAPt plates were incubated at the optimal growth temperature for each bacterial species (28°C for Y. pestis and 37°C for B. anthracis and F. tularensis) for the time required for each species. Of note, a 28°C incubation temperature for Y. pestis better supports bacterial growth without affecting the MIC (Frean et al., 2003; Hernandez et al., 2003; Heine et al., 2015), which led to shorter AST durations and easier MIC determination. Following the incubation period, the bacteria were extracted from the MAPt plates with 150 μl of PBS that was added to each well and pipetted up and down three times. One hundred microliters of the recovered bacteria was added to 100 μl of Triton buffer (20% Triton-X-100 in TE, Sigma), and the samples were heated for 30 min at 100°C in order to sterilize the sample and extract the DNA.

The qPCR reactions were performed in a total volume of 30 μl containing 2.3 μl of 20 mg/ml bovine serum albumin (BSA; Sigma A2153), 15.05 μl of SensiFAST Probe Lo-ROX Mix (Bioline BIO84005), 3.05 μl of forward primer (5 pmol/μl), 3.05 μl of reverse primer (5 pmol/μl), 1.55 μl of TaqMan probe (5 pmol/μl), and 5 μl of DNA extract. The primers and probes used were as follows:

For B. anthracis, the chromosomal marker targeting prophage lambdaBa03 (PL3; Weigel et al., 2010), PL3_F: AA AGCTACAAACTCTGAAATTTGTAAATTG, PL3_R: CAACG ATGATTGGAGATAGAGTATTCTTT, and Tqpro_PL3: FAM- AACAGTACGTTTCACTGGAGCAAAATCAA-BHQ-1. For Y. pestis, the gene capR encoding the Lon ATP-dependent serine protease (Steinberger-Levy et al., 2016), capF: GGATT ACGATCTCTCGGATGTGA, capR: AGCCGGACAGACGAAT AACTTC, and Taq-CapR: FAM-TTGTGGCGACCTCTAAC TCCATGAATATTCC-BHQ-1. For F. tularensis, the gene fopA encoding an outer membrane protein (Versage et al., 2003), fopAF: ATCTAGCAGGTCAAGCAACAGGT, fopAR: GTCAACACTTGCTTGAACATTTCTAGATA, and fopAP: FA M-CAAACTTAAGACCACCACCCACATCCCAA-BHQ-1. The PCR thermal conditions were as follows: 3 min at 60°C followed by 40 cycles of 15 s at 95°C and 35 s at 60°C.

Bacterial quantification by qPCR was determined using the Ct value, which was extracted by the 7,500 real-time PCR system Sequence Detection Software (version 1.4). The relative difference in bacterial growth between an untreated control and an antibiotic-treated sample (designated FC) was calculated by the formula FC = 2^–ΔCt, where ΔCt is the difference between the Ct of sampled bacteria compared to the Ct of the untreated control sample. A 10-fold change between the antibiotic-treated and untreated samples is reflected by ΔCt = 3.3 (log₂10) in an efficient PCR; thus, the MIC was defined as the lowest antibiotic concentration that reduced growth to ΔCt ≥ 3.3, which correlated with the lack of visible growth by the standard AST.

Standard broth microdilution was performed according to the CLSI guidelines (Clinical and Laboratory Standards Institute, 2010) in CAMHB for B. anthracis and Y. pestis, and HLMHI for F. tularensis. An inoculum of 5 × 10⁵ to 1 × 10⁶ cfu/ml suspended in CAMHB for B. anthracis and Y. pestis, and 2 × 10⁶ cfu/ml for F. tularensis were added at a 1:1 volumetric ratio to a 96-well plate (TPP, Cat# 92696) containing duplicates of twofold serial dilutions of doxycycline (Sigma D9891) or ciprofloxacin (ciproxin 200, Bayer) in CAMHB or HLMHI at a final volume of 0.1 ml. Bacteria grown in CAMHB or HLMHI without the addition of doxycycline or ciprofloxacin served as growth controls in each assay. The 96-well plate was incubated at 37°C for 20 h for B. anthracis, 28°C for 24 h for Y. pestis, and 37°C for 48 h for F. tularensis in an Infinite 200 plate reader (TECAN), and growth was monitored by measuring the optical density at 630 nm (OD₆₃₀) at 1-h intervals. A 28°C incubation temperature for Y. pestis was used because it better supported bacterial growth without affecting the MIC (Frean et al., 2003; Hernandez et al., 2003; Heine et al., 2015), which led to shorter AST durations and easier MIC determination. The MIC values were defined as the lowest doxycycline and ciprofloxacin concentrations that reduced growth to less than 10% of the OD₆₃₀ measured for the growth control. No growth was verified by visual inspection.

Of the three Tier-1 agents, F. tularensis is the most challenging to determine antibiotic susceptibility in terms of time. By the standard AST method, at least 5 days are required to determine antibiotic susceptibility. Dependent on the initial bacterial concentration, 1–4 days are required for a blood culture to flag positive (Shifman et al., 2021), 2 days are required for isolation, and 2 days are required for the standard microdilution test. To examine the applicability of MAPt, several concentrations of F. tularensis were inoculated into human blood cultures and allowed to grow for various lengths of time, yielding a range of concentrations of F. tularensis blood cultures. Similarly, whole blood samples inoculated with various F. tularensis concentrations were grown for 2 h. All samples were applied to MAPt plates containing ciprofloxacin, doxycycline, or gentamicin, antibiotics that are recommended treatments for F. tularensis (CDC, 2018), followed by incubation for 14 h at 37°C and qPCR to determine growth in the presence of the tested antibiotics. MIC values obtained by MAPt within 16 h, for all bacterial concentration tested, are presented in Tables 1, 2, and agree with those obtained by the standard microdilution test (ciprofloxacin 0.008–0.016 μg/ml, doxycycline 0.125–0.25 μg/ml, and gentamicin 0.032–0.06 μg/ml), which requires a defined bacterial concentration of 2 × 10⁶ cfu/ml. Graphic representations of the ΔCT results, for representative blood cultures and whole blood samples, for all three tested antibiotics, are depicted in Figure 1, showing the 10-fold change between the antibiotic-treated and the untreated sample as reflected by ΔCt = 3.3 (log₂10).

Of the three Tier-1 agents, Y. pestis is clinically the most challenging one as in vitro, its growth rates are slow, but in vivo, the bacteria proliferate quickly, leading to severe disease and death within 24 h following symptom onset (Inglesby et al., 2000), at times before AST results can be obtained. Hence, the ability to determine antibiotic susceptibility before deterioration bears clinical value. Similar to the method described for F. tularensis, different concentrations of Y. pestis were inoculated into human blood cultures and whole blood samples and allowed to grow for various lengths of time, yielding a range of bacterial concentrations in the samples. The samples were then applied to MAPt plates, incubated for 12 h at 28°C and subjected to qPCR to determine growth in the presence of the tested antibiotics. Tables 3, 4 summarize the results obtained by MAPt, showing suitable MIC values compared to the standard microdilution test (ciprofloxacin 0.008–0.032 μg/ml, doxycycline 0.5–1 μg/ml, and gentamicin 0.25–1 μg/ml), which requires a defined bacterial concentration and an overall time of 2–3 days. Graphic representations of the ΔCT results for blood cultures and whole blood are illustrated in Figure 2.

Bacillus anthracis is a fast-growing bacterium, and thus, a method that will allow MIC determination directly from patients’ blood is beneficial. A range of B. anthracis concentrations were inoculated into human whole blood, which was shaken at 37°C for 1–2 h, yielding a range of bacterial concentrations. The samples were applied to MAPt evaluation. MIC values obtained by MAPt after 7 h of incubation are presented in Table 5 and agree with the MIC values obtained by the standard AST within 2 days (ciprofloxacin 0.008–0.032 μg/ml and doxycycline 0.008–0.032 μg/ml). Graphic representations of the ΔCT results for whole blood are illustrated in Figure 3.

For the proof of concept that MAPt will detect a shift in MIC values as well as a shift in susceptibility categories, we applied MAPt on non-virulent Y. pestis derivatives with shifted ciprofloxacin (Steinberger-Levy et al., 2016) and doxycycline (Shifman et al., 2019) MIC values and categories. The same methodology was applied to the resistant strains as to the WT Y. pestis strain with extension to antibiotic concentrations that will include the expected elevated MIC values of the resistant derivatives. As can be seen in Table 6 and Figure 4, MAPt can detect elevated MIC values for doxycycline, at various bacterial concentrations, both in blood cultures as well as in whole blood samples, inoculated with a Y. pestis derivative with doxycycline-reduced susceptibility. The MIC values obtained were 8–16 μg/ml and were in agreement with the ones detected for this antibiotic-resistant derivative by the standard test; however, the duration of the MAPt was substantially shorter. Importantly, the doxycycline susceptibility breakpoint categories (S—susceptible ≤ 4 μg/ml, I—intermediate = 8 μg/ml, and R—resistant ≥ 16 μg/ml) (Clinical and Laboratory Standards Institute, 2015) were rapidly determined by MAPt. Indeed, the MIC values obtained for the doxycycline derivative alert that doxycycline is not the proper treatment in case of infection with these bacteria.

Similarly, MAPt detected elevated MIC values for ciprofloxacin (Table 7 and Figure 4), at various bacterial concentrations, both in blood cultures and in whole blood samples, inoculated with a Y. pestis derivative with ciprofloxacin-reduced susceptibility. The MIC value (4 μg/ml) was in agreement with the ones detected for this antibiotic resistant derivative by the standard test, and define the tested derivative as a non-sensitive bacteria (non-sensitive MIC > 0.25 μg/ml) (Clinical and Laboratory Standards Institute, 2015).

The ability to detect resistant bacteria within a relevant clinical time frame may be a matter of life and death especially in a Y. pestis infection where the in vivo growth rate of the bacteria is fast compared to the slow growth rate in vitro as reflected in the test duration of the standard AST.