Cryptosporidium parvum oocysts (IOWA isolate) were purchased from Waterborne, Inc. (New Orleans, LA, United States) and stored in PBS with penicillin, streptomycin, amphotericin B, and 0.01% Tween 20 at 4°C for less than 2 months. Prior to infection, oocysts were treated with 0.5% sodium hypochlorite on ice for 10 min and washed three times with PBS buffer. To obtain sporozoites, hypochlorite-treated oocysts were suspended in PBS buffer containing 0.75% taurodeoxycholic acid and 0.25% trypsin and incubated at 37°C for 1 h. The sporozoites released were harvested by centrifuging at 1300 g for 3 min. Genomic DNA was extracted from 6 × 10⁶ C. parvum oocysts using the Qiagen DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) and stored at −20°C for future use.

Human ileocecal adenocarcinoma HCT-8 cells were obtained from the Shanghai Branch of the Chinese Academy of Sciences. They were seeded into 12-well cell culture plates and cultured in RPMI 1640 medium containing 10% fetal bovine serum (FBS), 100 units/ml penicillin, and 100 μg/ml streptomycin at 37°C until ∼90% confluence. Each well was infected with 5 × 10⁵ hypochlorite-treated oocysts in 2% FBS-supplemented RPMI 1640 medium. After 2-h incubation, uninvaded parasites were washed off the culture with PBS. Fresh 2% FBS-supplemented RPMI 1640 medium was added to the culture, which was maintained for specified duration depending on the assay.

Sequences of the INS-21 (gene name: cgd7_2080) and INS-23 (gene name: cgd5_3400) genes were retrieved from the CryptoDB¹ and function domains in them were predicted using Pfam 31.0². Sequence alignment of INS-21, INS-23, and the α and β units of mitochondrial processing peptidase (MPP) from Starmerella bombicola (yeast) were made using ClustalX³. The cgd7_2080 gene was amplified using primers 5′-CCCGAGCTCATGATTCAACAGAAAAT-3′ (the SacI restriction site underlined) and 5′-CCC AAGCTTATAATTGCTGACTTG-3′ (the HindIII restriction site underlined), while the cgd5_3400 gene was amplified using primers 5′-CGGGATTCTCCATACTAAAACTTGGATG (the BamHI restriction site underlined) and 5′-CCG CTCGAGAGAATAGGAATGAAGATA (the XhoI restriction site underlined). The PCR was performed in a GeneAmp 9700 (Applied Biosystems, Foster City, CA, United States) with the following cycling conditions: 95°C for 5 min; 35 cycles of 95°C for 45 s, 55°C for 45 s, 72°C for 2 min; and 72°C for 7 min. The PCR products were purified and cloned into pET-28a (Novagen, Madison, WI, United States). The recombinant plasmids generated were transformed into Escherichia coli DH5α competent cells, with positive clones being identified by PCR using the T7/T7t universal primers. The sequence accuracy of the cloned genes was confirmed by DNA sequencing. The plasmids were named pET-28a-INS21 or pET-28a-INS23.

For the expression of recombinant INS-21 and INS-23, the pET-28a-INS21 or pET-28a-INS23 plasmid was transformed into E. coli BL21 (DE3) cells. For the mini culture, the single colony of each transformant was cultured at 37°C and 200 rpm overnight in 5 ml of LB medium containing 100 μg/ml kanamycin. The cells from the culture were transferred into 500 ml of LB medium containing 100 μg/ml kanamycin, which was cultured at 37°C and 200 rpm until the OD₆₀₀ reaches 0.6–0.8. At this time point, isopropyl β-D-1-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mM was introduced to induce protein expression, with the culture being maintained at 18°C and 200 rpm for 8 h. The cells were harvested by centrifuging at 4000 g for 10 min and stored in −20°C for future use. The expression level of the target protein was evaluated using the SDS-PAGE with Coomassie Blue G-250 staining.

For the purification of recombinant INS-21 and INS-23, frozen culture pellet was resuspended in 30 ml of cold PBS buffer with 1% protease inhibitor cocktail (Merck, Darmstadt, Germany) and lysed by sonication. The lysis was centrifuged at 8000 g and 4°C for 30 min, with the pellet being dissolved in 30 ml of PBS buffer containing 8 M urea. After another centrifugation, the supernatant was filtered through a 0.45-μm cellulose acetate membrane filter (Millipore, Billerica, MA, United States) and loaded onto Ni-NTA beads (Novagen) at 16°C and 90 rpm for 4 h. The beads were washed with 10 volumes of 6 M PBS-buffered urea containing 20 mM imidazole and eluted with 6 volumes of 6 M PBS-buffered urea containing 250 mM imidazole. The purified proteins were examined using SDS-PAGE with Coomassie Blue G-250 staining and analyzed for identity using Matrix-Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry (MALDI-TOF-MS).

Polyclonal antibodies against the recombinant INS-21 or INS-23 protein were prepared by GI Biochem Ltd. (Shanghai, China) in specific pathogen-free rabbits. Polyclonal antibodies were purified from the sera harvested from immunized rabbits using an affinity chromatographic column conjugated with purified recombinant protein. To assess the reactivity of these two antibodies, recombinant INS-21 and INS-23 were employed as the antigens in Western blot assays. Each recombinant protein (1 μg/lane) was loaded onto SDS-PAGE and transferred onto a nitrocellulose membrane. The latter was blocked with 5% non-fat milk–PBST for 2 h and incubated with anti-INS-21 (∼5.7 μg/ml) or anti-INS-23 (∼0.19 μg/ml) antibodies or pre-immune serum (1:1,000) diluted in PBS overnight at 4°C. After three washes, horseradish peroxidase (HRP)-conjugated goat anti-rabbit antibodies (Yeasen, Shanghai, China) were used as the secondary antibodies in 1-h incubation. After another three washes, the blots were treated with an enhanced chemiluminescence reagent (Thermo Fisher, Rockford, IL, United States) and analyzed with a Tanon 5200 imaging system (Tanon, Shanghai, China).

To assess the expression of the native INS proteins, the released sporozoites were washed twice with PBS buffer and resuspended in PBS containing 1% protease inhibitor cocktail (Merck, Darmstadt, Germany). They were lysed by adding protein-loading buffer and boiling for 5 min. The protein lysate (∼5 × 10⁶ sporozoites/lane) was analyzed by SDS-PAGE and transferred onto a nitrocellulose membrane, which was blocked with 5% non-fat milk-PBST for 2 h. The latter was incubated overnight at 4°C with anti-INS-21 (∼5.7 μg/ml), anti-INS-23 (∼0.19 μg/ml) antibodies, or pre-immune serum (1:1,000) dilution in PBS.

HCT-8 cells were grown on 12-well plates until ∼90% confluence. Cells were infected with 5 × 10⁵ bleach-treated oocysts/well and washed twice with PBS at 2 hpi, and fresh 2% FBS-supplemented RPMI 1640 medium was added. RNA was extracted at specific time points using RNeasy Mini Kit (Qiagen, Hilden, Germany) and stored at -80°C until further processing. Two microliters of RNA was converted into cDNA using the GoScript Reverse Transcription System (Promega, Beijing, China). The relative expression of the cgd5_3400 and cgd7_2080 genes in intracellular parasites developed in HCT-8 cells for 0–72 h was evaluated using qPCR analysis of the cDNA. Parallel data on the expression of the Cp18s rRNA gene were used for data normalization. The qPCR reaction contained 0.1 mM primers, 1 μl cDNA, and 10 μl of SYBR Green PCR Mix (TOYOBO, Osaka, Japan) in a 20-μl reaction. The primers used include 5′-CATCGCTGGGAATCATCATA-3′ and 5′-CCACCTGCCAACATTAATCC-3′ for the cgd7_2080 gene (amplicon: 163 bp), 5′-GGATGAGAGTTGCAACCATGA-3′ and 5′-GCACCTAAGTCTTCAATTTGGC-3′ for the cgd5_3400 gene (amplicon: 199 bp), and 5′-CTCCACCAACTAAG AACGGCC-3′ and 5′-TAGAGATTGGAGGTTGTTCCT-3′ for the Cp18s rRNA gene (amplicon: 256 bp) (Mauzy et al., 2012). The PCR was performed on a LightCycler 480 (Roche, Basel, Switzerland), with the following cycling conditions: 95°C for 3 min and 45 cycles of 95°C for 30 s, 58°C for 30 s, 72°C for 30 s. The transcription level of the INS gene in infected HCT-8 cells was calculated by using the 2^–ΔΔCT method (Livak and Schmittgen, 2001). The data presented were from three independent experiments performed in duplicate.

Sporozoites were dried onto microscopy slides and intracellular stages of C. parvum in HCT-8 cell cultures were grown on coverslips for 48 h. They were fixed with methanol for 15 min. After three washes with PBS, the slides were treated with 0.5% Triton-X 100 in PBS for 15 min and blocked with 5% bovine serum albumin (BSA) in PBS for 1 h. After another three washes, the slides were incubated with polyclonal antibodies against individual INS proteins (1:400 diluted in 5% BSA-PBS) for 1 h. Alexa Fluor 594-conjugated goat anti-rabbit IgG (Cell Signaling Technology, MA, United States) diluted 1:400 was used as the secondary antibodies. After 1-h incubation and three washes, the slides were counterstained with the nuclear stain 4’6-diamidino-2-phenylindole (DAPI, Roche) at room temperature for 5 min. The slides were mounted with No-Fade Mounting Medium (Booster, Wuhan, China), sealed with nail polish, and examined using differential interference contrast (DIC) and fluorescence microscopy on a BX53 microscope (Olympus, Tokyo, Japan).

Sporozoites were fixed at 4°C in freshly prepared mixture of 4% paraformaldehyde (Leagene, Beijing, China) and 0.1% glutaraldehyde (EMCN, Beijing, China) buffer for 60 min. Samples were washed five times with PBS buffer and embedded in 1% agarose (Macklin, Shanghai, China). They were dehydrated in a gradient ethanol series and infiltrated with LR White acrylic resin (EMCN, Beijing, China). Samples were sectioned with a Leica EM UC7 ultramicrotome and mounted on film-coated grids. The ultrathin sections of 60 nm generated were blocked with 1% BSA in PBS for 30 min and incubated at 4°C with anti-INS-21 or anti-INS-23 antibody for overnight. Following washes with 0.1% BSA in PBS, the sections were incubated at room temperature with goat anti-rabbit IgG conjugated with 10 nm colloidal gold (Sigma-Aldrich, St. Louis, MO, United States) for 60 min. They were stained with 2% uranyl acetate and Reynold’s lead citrate and viewed on a Talos L120C transmission electron microscope (Thermo Fisher Scientific, San Jose, CA, United States) equipped with Ceta-D camera (Thermo Fisher Scientific). All labeling experiments were conducted in parallel with controls omitting the primary antibody. These controls were consistently negative at the concentration of secondary antibodies used in these studies.

The role of individual INS in C. parvum invasion was assessed using a neutralization assay. Hypochlorite-treated oocysts were incubated at 37°C in culture medium containing increasing dilutions of pre-immune serum or post-immune serum for 15 min. The mixture was inoculated onto HCT-8 cells grown on coverslips in 12-well plates as described above. After 2 h of incubation, uninvaded parasites were washed off the culture with PBS and the cells were incubated for an additional 22 h in fresh culture medium. The coverslips were fixed, blocked with 5% BSA in PBS, stained with Cy3-labeled Sporo-Glo antibodies (Waterborne), and examined under a BX53 immunofluorescence microscope. Images of 50 microscope fields per coverslip were captured randomly under 200 × and analyzed using the ImageJ software⁴. The percentage of inhibition of infection was calculated by using the following formula: (1 - [No. parasites in cultures treated with post-immune serum/No. parasites in cultures treated with pre-immune serum]) × 100%. The mean percent inhibition was calculated based on data from three independent experiments. An unpaired t-test in GraphPad Prism 8 (GraphPad Software) was used to compare the means of two groups. For statistical analysis, two tailed P-values of ≤ 0.05 were considered significant.

The predicted INS-23 encoded by the cgd5_3400 gene has two domains: one active domain containing the zinc-binding motif “HFLEH” and one inactive domain without it. In contrast, INS-21 encoded by the cgd7_2080 gene has two inactive domains and a glycine-rich loop at the C-terminus (Figure 1). In order to obtain the recombinant proteins of INS-21 and INS-23, the cgd5_3400 and cgd7_2080 genes were amplified by PCR (Figures 2A,B) from genomic DNA of C. parvum and cloned into the pET-28a vector. Recombinant INS proteins were expressed in E. coli (Figures 2C,D) and purified using the His-tag incorporated (Figures 2E,F). In SDS-PAGE analysis, the expected bands of INS-21 and INS-23 were seen at ∼60 kDa and ∼45 kDa in agreement with the predicted sizes (Supplementary Table 1), respectively. The identity of the products was confirmed using the MALDI-TOF-MS analysis, yielding peptide sequences of each INS (Supplementary Table 1 and Supplementary Figure 1). The polyclonal antibodies against recombinant INS-21 or recombinant INS-23 were generated by immunizing rabbits.

In order to evaluate the reactivity of these antibodies to native INS proteins, we firstly tested the reactivity of anti-INS antibodies to recombinant INS-21 and INS-23 using Western blot. The anti-INS-21 antibodies reacted strongly with recombinant INS-21 protein and lightly with recombinant INS-23 protein. In contrast, the anti-INS-23 antibodies only recognized recombinant INS-23 protein, with no cross-reactivity with recombinant INS-21 protein (Supplementary Figure 2).

We then evaluated the reactivity of these antibodies to native INS proteins. In Western blot, the anti-INS antibodies recognized their corresponding INS proteins in crude extracts of sporozoites, while pre-immune serum did not (Figures 3B,D). The anti-INS-21 antibodies reacted with a protein of ∼60 kDa and two proteins smaller than 40 kDa in sporozoite lysate (Figure 3A), while the anti-INS-23 antibodies reacted with a protein of ∼45 kDa (Figure 3C) and a few proteins smaller than 35 kDa, suggesting that INS-21 and INS-23 might be expressed in sporozoites, and there could be proteolytic processing of these INS.

To examine the transcription of the INS-21 and INS-23 genes during the intracellular development of C. parvum in vitro, we infected HCT-8 cells with oocysts and tested transcription of the INS genes at different time points using reverse transcription-quantitative PCR (RT-qPCR). Both the cgd5_3400 and cgd7_2080 had the highest transcription at 0 h post infection (hpi). At this time point, all parasites were sporozoites in the culture, indicating that the expression of the INS-21 and INS-23 gene was at the highest level in this developmental stage. The cgd7_2080 gene, INS-21, kept a high transcription at 2 hpi and maintained some expression until 72 hpi (Figure 4A). The transcription of the cgd5_3400 gene, INS-23, decreased at 2 hpi compared with 0 hpi, but was maintained at relatively high levels until 72 hpi (Figure 4B), indicating that both INS-21 and INS-23 genes are probably transcribed in both asexual parasites and sexual parasites (Tandel et al., 2019; Funkhouser-Jones et al., 2020).

To visualize the stage-specific location of INS-21 and INS-23 expression, we performed immunofluorescence microscopy using antibodies against each INS. Anti-INS-21 antibodies had strong reaction with the apical region of sporozoites, while anti-INS-23 antibodies reacted with multiple areas of sporozoites with a dotted pattern. In the intracellular stage, anti-INS-21 and anti-INS-23 antibodies reacted with merozoites in patterns similar to those in sporozoites. Both antibodies also reacted with merozoites within type I and type II meronts (Figures 5A,B), consistent with the transcription level of the gene encoding each protein.

The organelles expressing INS-21 and INS-23 in sporozoites were assessed by immunoelectron microscopy. INS-21 was located in the anterior of sporozoites, probably the micronemes (Figure 5C), while INS-23 was located in almost the entire sporozoites in a dotted pattern, probably in dense granules (Figure 5D). Because of the lack of antibodies to known markers of most organelles in Cryptosporidium spp., it was impossible to use the co-localization approach to confirm the identification of organelles expressing INS-21 and INS-23.

We assessed the effect of anti-INS antibodies on C. parvum invasion by incubating bleached oocysts with anti-INS antibodies and keeping the antibodies in the media during the sporozoite infection of HCT-8 cells. Compared with the control culture, the cultures treated with antiserum against INS-23 or treated with antiserum against both INS-21 and INS-23 had a modest but significant reduction in parasite load. When the cultures were treated with antiserum INS-21, there was no significant reduction in parasite load. The inhibitory effect of antiserum against INS-21 was 18.8% [t₍₂₎ = 0.9207, P = 0.4093] at 1:1000 dilution, 20.4% [t₍₂₎ = 1.004, P = 0.3722] at 1:500 dilution, 30.5% [t₍₂₎ = 1.616, P = 0.1813] at 1:200 dilution, and 33.0% [t₍₂₎ = 1.768, P = 0.1519] at 1:100 dilution (Figure 6A). In contrast, the inhibitory effect of antiserum against INS-23 was 20.2% [t₍₂₎ = 4.003, P = 0.0161] at 1:1,000 dilution, 24.1% [t₍₂₎ = 3.191, P = 0.0332] at 1:500 dilution, 34.1% [t₍₂₎ = 5.255, P = 0.0063] at 1:200 dilution, and 36.1% [t₍₂₎ = 6.488, P = 0.0029] at 1:100 dilution (Figure 6B).

The inhibitory effect of C. parvum cultures with antisera against both INS-21 and INS-23 was 18.1% [t₍₂₎ = 2.438, P = 0.0714] at 1:1,000 dilution, 11.9% [t₍₂₎ = 2.615, P = 0.0591] at 1:500 dilution, 23.1% [t₍₂₎ = 3.069, P = 0.0373] at 1:200 dilution, and 37.1% [t₍₂₎ = 6.534, P = 0.0028] at 1:100 dilution (Figure 6C).